TITLE:
Can Irrational Numbers (Such as Square Root of the Number Five) Be Reached by Analysis of Genetic Sequences?
AUTHORS:
Tahir Ölmez
KEYWORDS:
Quantum Perspective Model, Biochemistry, DANIO RERIO (Zebra Fish), The Square Root of Five and NCBI (National Biotechnology Information Center)
JOURNAL NAME:
Open Access Library Journal,
Vol.8 No.1,
January
26,
2021
ABSTRACT: Irrational numbers didn’t have reoccurrence sequence but this paper calculated a sequence with respect to Quantum Perspective Model. One of the irrational numbers is the square root of five numbers. This article researches whether there is a link between the square root of five numbers and the genetic sequences. At first, the square root digits of the number five after the comma are added respectively. Secondly, the resulting sum corresponds to the nucleotide bases, the results obtained in this way are expressed as nucleotide bases (A, T, C, G, and U): (A) Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, when the first three hundred digits of the square root of the number five after the comma are calculated, the gene sequence is obtained as follows: [ATTTATTCAATACATAACCCCATTGA]. Thirdly, in this sequence, some of reoccurrences were detected just like as “CAT” and “ATT”. Fourthly, after researching this sequence at NCBI (National Biotechnology Information Center), the search result is similar to bony fishes, especially DANIO RERIO (Zebra fish). Lastly, the genetic codes of Zebra fishes were found to be similar to human genetic codes. In summary, the connection between these results and the square root of the five in mathematical science and the genetic codes in biochemistry may shed light on explaining irrational numbers.