J. Biomedical Science and Engineering, 2009, 2, 651-655
doi: 10.4236/jbise.2009.28095 Published Online December 2009 (http://www.SciRP.org/journal/jbise/
JBiSE
).
Published Online December 2009 in SciRes.http://www.scirp.org/journal/jbise
Transforming growth factor-β3 induced rat bone
marrow-derived mesenchymal stem cells differentiation
into smooth muscle cells by activating Myocardin
Lin-Lin Ma1,2, Nan Wang1,2, Zhen Zhou1,2, Jun-Yun Zhang1,2, Xue-Gang Luo1,2, Yong Jiang1,2,
Tong-Cun Zhang1,2*
1Key Laboratory of Industrial Microbiology, Ministry of Education, Tianjin, China;
2College of Biotechnology, Tianjin University of Science and Technology, Tianjin, China.
Received 10 July 2009; revised 21 August 2009; accepted 31 August 2009.
ABSTRACT
Bone marrow mesenchymal stem cells (MSCs) can dif-
ferentiate into smooth muscle cells (SMCs) and have
tremendous potential for cell therapy and tissue engi-
neering. In this study, to understand the effects of
TGF-β3 on rat bone marrow-derived MSCs and the
underlying molecular mechanism of this differentiation
process, we investigated that the changes of myocar-
din-related transcription factors (MRTFs) at the tran-
scriptional level after rat MSCs were treated with
TGF-β3. The results showed that TGF-β3 increased the
expression of contractile genes, such as SM22, smooth
muscle-myosin heavy chain (SM- MHC), SM-α-actin in
MSCs. When TGF-β3 induced MSCs differentiation
into SMCs, myocardin and MRTF-A were activated.
The data indicated that TGF-β3 induced rat bone
marrow-derived MSCs differentiation into SMCs by
activating mypcardin and MRTF-A.
Keywords: Mesenchymal Stem Cells; Smooth Muscle
Cells; TGF-β; MRTFs
1. INTRODUCTION
In vivo, smooth muscle cells (SMCs) are found in the
vascular system, as well as in visceral organs, notably
the respiratory, genitourinary, and gastrointestinal sys-
tems. VSMCs were involved in atherosclerosis and hy-
pertension, leading causes of heart failure. Thus there
was the great interest in the field of cellular therapeutics
involving these tissues. However, one major limitation to
this approach has been that a reliable source of SMCs
can be impractical and morbid. In addition, biopsies
usually lead to limited amounts of cells. It has been
shown that SMCs derived from diseased organs can lead
to abnormal cells that are different from healthy SMCs
[1]. Therefore, there is a great need for alternative sour
ces of healthy SMCs.
Several groups have suggested the use of bone mar-
row-derived cells to repair smooth muscle tissues because
of their stem cell-like properties [2]. Bone marrow-de-
rived mesenchymal stem cells (MSCs) have a self-rene-
wal capacity, long-term viability. It is important that
MSCs can differentiate into a variety of cell types, such as
osteogenic, adipogenic, chondrogenic, skeletal muscle
cells, and SMCs in response to different microenviromen-
tal cues [3]. In vivo, MSCs transplanted into the heart can
differentiate into SMCs and contribute to the remodeling
of vasculature [4]. These findings indicated that MSCs
might be as sources of healthy SMCs under some specific
conditions, such as in the presence of some cytokine.
Transforming growth factor-β (TGF-β) proteins are
multifunctional proteins that regulate cell growth, dif-
ferentiation, migration, and extracellular matrix produc-
tion. It has been shown recently that TGF-β increases
smooth muscle (SM)-actin expression in MSCs [5].
Sphingosylphosphorylcholine (SPC) induces differentia-
tion of human adipose-tissue-derived MSCs into smoo-
th-muscle-like cells through a TGF-β-dependent mecha-
nism [6]. These results indicate that the TGF-β was in-
volved in mesenchymal lineage cell type differentiation
into SMCs. Therefore, we investigated the role of TGF-β
in bone marrow-derived MSC differentiation into SMCs.
Myocardin is expressed specifically in smooth and car-
diac muscle cell lineages and activates smooth and car-
diac muscle reporter genes by interacting with serum
response factor (SRF). Myocardin shares homology with
myocardin-related transcription factor-A (MRTF-A), and
MRTF-B, which are expressed in a broad range of em-
bryonic and adult tissues [7]. To understand whether
MRTFs are implicated in the SMC differentiation of
This work was financially supported by National Natural Science
Foundation of China (No.30800561), Tianjin Natural Science Founda-
tion (09JCZDJC18100) and Scientific Research Foundation of Tianjin
University of Science and Technology (20080409).
652 L. L. Ma et al. / J. Biomedical Science and Engineering 2 (2009) 651-655
SciRes Copyright © 2009 JBiSE
MSCs, we investigated the changes of MRTF family
mRNA level after MSCs were induced by TGF-β3.
In this report, we show that TGF-β3 induced rat bone
marrow-derived MSC differentiation into SMCs. TGF-
β3 increased the expression of contractile genes, such as
SM22, smooth muscle-myosin heavy chain (SM-MHC),
SM-α-actin in MSCs. We also demonstrated that myo-
cardin and MRTF-A play important roles in the TGF-
β3-induced SMC differentiation in MSCs.
2. MATERIALS AND METHODS
2.1. Reagents
Dulbecco’s modified Eagle’s medium-low glucose
(DMEM-LG) was purchased from Hyclone Co. TGF-β3
was purchased from Peoro Tech. Co. Fetal bovine serum
(FBS) was obtained from Hycolon Lab, Inc. Fluorescein
isothiocyanate (FITC)-conjugated or phycoerythrin (PE)-
conjugated antibodies CD14, CD29, CD34, CD44,
CD45, CD105 were purchased from BD Pharmingen,
San Diego, CA. Mouse anti-rat SM-MHC and FITC-
goat anti-mouse IgG were purchased from Santa Cruz.
3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium
(MTT) was purchased from Sigma. Co. Trizol reagent
was purchased from Invitrogen, USA. All other reagents
were ultrapure grade.
2.2. Cell Culture
Rat MSCs were isolated from the femurs and tibias of
male Sprague-Dawley rats (90–100g) with a modified
method originally described by Pittenger [3]. Briefly,
bone marrow mononuclear cells were obtained by Per-
coll (1.073 g/ml) density gradient centrifugation. The
cells were seeded in Dulbecco’s modified Eagle’s me-
dium-low glucose (DMEM-LG) supplemented with 10%
fetal bovine serum (FBS) and penicillin/streptomycin at
37 in humified air with 5% CO2. At 24 h after plating,
nonadherent cells were removed by replacing medium.
The antibiotic was removed after one media change. The
medium was changed every 2–3 days and the cells were
passaged in 0.05% trypsin-1 mM EDTA. All the cells
were used between passages 4 and 6.
2.3. Flow Cytometric Analysis
Rat MSCs were phenotypically characterized by flow
cytometry (Becton-Dickinson, San Jose, CA) by the
method of Li [8]. The antibodies used in this study in-
cluded FITC-conjugated or PE-conjugated antibodies
CD14, CD29, CD34, CD44, CD45, CD105. To detect
surface antigens, cells were collected and incubated (30
min at 48C) with the respective antibody at a concentra-
tion previously established by titration. At least 1×105
cells for each sample were acquired and analyzed.
2.4. Cell Differentiation Induction
When the cultures of MSCs reached subconfluence, cells
were washed twice with the medium and divided into
two groups. In control group, the cells were cultured in
basal DMEM medium (without FBS); in TGF-β treat-
ment group, the cells were incubated with 5, 10 ng/ml
TGF-β in basal medium. Fresh TGF-β was dissolved in
phosphate buffered saline (PBS) and applied to cells.
The cells in the two groups were incubated for 24 hours.
The morphological changes of the cells were observed
under phase contrast microscope (Nikon, Japan).
2.5. Immunocytochemistry Assay
After MSCs were treated in the two ways mentioned
above for 24 h, cells were fixed in 4% paraformaldehyde
for 15 min, blocked with normal goat serum for 20 min
at room temperature (RT). Then, primary antibodies
(mouse anti-rat SM-MHC) were added and incubated in
a humid chamber over night. After washing with 0.1 M
phosphate buffered saline (PBS) three times, cells were
incubated with appropriate secondary antibodies (FITC-
goat anti-mouse IgG) for 30 min at 37. After washing
with 0.1 M PBS, the samples were evaluated under in-
verted fluorescence microscope (Nikon, Japan).
2.6. Cell Viability Assay
Cells were seeded into 96-well plates and treated with or
without TGF-β for 24 h, respectively. The viability of
cells determined by using the method of MTT assay as
described previously [9]. The light absorption was
measured at 570 nm using Multiskan Spectrum (Thermo
Labsystems). The viability (%) was calculated by the
formula as follow. Viability (%)=(OD of control or treat-
ed group/OD of normal group)×100%. The viability of
normal group was presumed as 100%.
2.7. RNA Isolation and Semi-Quantitative
Reverse-Transcription Polymerase Chain
Reaction (RT-PCR)
MSCs were treated in the two ways mentioned above for
24 h. Semi-quantitative RT-PCR analysis was carried out
as described previously [6]. Briefly, total RNA was iso-
lated from cells using Trizol reagent, two microgram of
the sample was reverse-transcribed using M-MLV re-
verse transcriptase (Promega, USA) according to the
manufacturer’s instructions. The PCR primer sequences
are listed in Table 1. Semiquantitative analysis of mRNA
expression was performed by using the Biorad software,
using human glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) as a housekeeping gene.
2.8. Statistical Analysis
Data were expressed as mean±SE and accompanied by
the number of experiments performed independently,
and analyzed by t-test. Differences at P<0.05 were con-
sidered statistically significant.
L. L. Ma et al. / J. Biomedical Science and Engineering 2 (2009) 651-655 653
SciRes Copyright © 2009
3. RESULTS
3.1. Immunophenotypic Characterization of Rat
MSCs
JBiSE
Rat MSCs isolated in this study were uniformly positive
for CD29, CD44, CD105. In contrast, these cells were
negative for other markers of the hematopoietic lineage
CD14, CD34, the leukocyte common antigen CD45.
Flow cytometry analyses showed that the MSC was a
homogeneous cell population devoid of hematopoietic
cells (Figure 1).
3.2. TGF-β Induced the SMC Differentiation of
Rat MSCs
Rat MSCs were exposed to 5, 10 ng/ml TGF-β3 respec-
tively in the absence of serum. The treatment of MSCs
with TGF-β3 significantly changed the cell morphology.
As show in Figure 2A, 24 hours after TGF-β3 treatment,
MSCs have a more spread out and myoblast-like mor-
phology, and intracellular fibrous structures were visible.
There were no obvious morphological changes in the
control group. To confirm the SMC differentiation of
these MSCs, we analyzed the expression of SM-MHC
by immunocytochemistry. The cells treated with 5 ng/ml
TGF-β3 exhibited the positive SM-MHC (Figure 2B).
The cells were treatment under the serum-free condition,
thus we analyzed the cell viabilities. As shown in Figure
3, the viabilities in the control and D609 treatment
groups were decreased obviously at 24 h, and are only
about 60%. There were no significant between control
group and each experiment group (P>0.05). These re-
sults shown that 10 ng/ml TGF-β3 did not regulate the
cell growth, but could induce the differentiation of
MSCs.
To confirm the characters of these differentiated MSCs,
the expression of SM22, SM-α-actin, SM-MHC mRNA
were examined. RT-PCR experiment results showed that
at 24 h, the MSCs treated with 5 ng/ml TGF-β3 dis-
played weak expression of SM22, SM-α-actin, SM-
MHC and 10 ng/ml TGF-β3 induced the intensive increa-
se of SM22, SM-α-actin, SM-MHC in rat MSCs (Figure
4). In the control group, no expression of SM22,
SM-α-actin, SM-MHC were detected (Figure 4). These
results showed that TGF-β3 induced rat bone mar-
row-derived MSC differentiation into SMCs and in-
creased the expression of contractile genes, such as
SM22, SM-MHC, SM-α-actin.
Table 1. The PCR primer sequence.
SM22 sense AGCCAGTGAAGGTGCCTGAGAAC
antisenseTGCCCAAAGCCATTACAGTCCTC
SM-α-actinsense GAGAAGCCCAGCCAGTCG
antisenseCTCTTGCTCTGCGCTTCG
SM-MHC sense TGAGTGACAGAGTCCGCAAG
antisenseGCCGCAACAGTGGACTTAAG
myocardin sense TCACCGCCTTAGCTCATACC
antisenseCTGTCCCTCTGACCATTCTG
MRTF-A sense CTGACCCGAATGCTCCAACA
antisenseCCAGGGCCATCTGCACTCTT
MRTF-B sense GTAGCCAGACCCTTGTTGCC
antisenseTGTTTGGTGCCGAGTTTGTG
GAPDH sense ATTCAACGGCACAGTCAAGG
antisenseGCAGAAGGGGCGGAGATGA
Figure 1. Immunophenotypic Characterixation of rat MSCs. the X-axis represents the cell number.
654 L. L. Ma et al. / J. Biomedical Science and Engineering 2 (2009) 651-655
SciRes Copyright © 2009 JBiSE
Figure 2. TGF-β3 induce SMC differentiation of MSCs. (a)
.3. Myocardin and MRTF-A were activated
Cs
To iRTF family in the SMC dif-
development and postnatal life.
The morphological changes of rat MSCs; (b) The expression of
SM-MHC in undifferentiated and differentiated cells. The cells
were cultured in the serum-free medium with/without TGF-β3
at 24 h.
3
during the SMC differentiation of rat MS
induced by TGF-β
nvestigate the role of M
ferentiation of rat MSC, we detected the expression of
myocardin, MRTF-A, MRTF-B by RT-PCR. It was ob-
served that myocardin, MRTF-A were activated (Figure
5) during the SMC differentiation of rat MSCs induced
by TGF-β3, while no expression of MRTF-B was de-
tected (data not shown). This result showed that myo-
cardin, MRTF-A might contribute to the SMC differen-
tiation of rat MSCs induced by TGF-β3, but MRTF-B
might not be implicated in this differentiation process.
4. DISCUSSION
SMCs are critical in
SMCs have been implicated in vascular development as
well as in a variety of cardiovascular diseases, including
Figure 3. The viability of rat MSCs treated with TGF-
, studies aimed at
theSCs are of great impor-
β3. The cells were cultured in the serum-free medium
with/ without TGF-β3 at 24 h.
SMCs differentiation of rat M
hypertension and atherosclerosis. Hence
tance and will provide evidence for tissue engineering and
therapeutic applications. Cellular transplantation therapy
Figure 4. Expression of contractile genes in rat
MSCs treated with TGF-β3. (a) During the SMC
differentiation of MSCs, the mRNA levels of
SM22, SM-α-actin, SM-MHC were elevated ob-
viously. (b) Semiquantitative analysis of the con-
tractile gene mRNA expression.
Figure 5. Expression of myocardin and MRTF-A
in rat MSCs treated with TGF-β3. (a) During the
SMC differentiation of MSCs, myocardin and
MRTF-A were activated. (b) Semiquantitative
analysis of myocardin and MRTF-A mRNA ex-
pression.
L. L. Ma et al. / J. Biomedical Science and Engineering 2 (2009) 651-655 655
SciRes Copyright © 2009
for tossi-
bly b using the regenerated SMCs from autolo-
chanisms involved in the differen-
tia
induced rat bone marrow-derived MSC di
en
NCES
oon, J. J. Yoo, T. Wulf, and A. Atala.
and functional characterization of in
. Li, et al. (2001) Bone marrow cells
. Herve, et al. (2003) Mesenchymal
actin expression and contraction in
. C. Bae, et al., (2006) Sphingosylphosphoryl-
:
cells derived
al. (2004) Mechanical stress promotes the
differentia-
en-
G. K. Owens. (2004) Transforming growth
JBiSE
he patients with cardiovascular diseases might p
e achieved
gous bone marrow cells in the near future. MSCs have
great appeal for tissue engineering and therapeutic ap-
plications because of their general multipotentiality and
relative ease of isolation. In vitro, MSCs have been
shown to differentiate to SMCs in response to mechani-
cal stress [10], growth factor, such as PDGF-BB and
TGF-β [11], and direct contact with vascular endothelial
cells [12]. TGF-β can contribute to development of
SMCs from embryonic stem cells [13]. In this study, we
found that TGF-β3 could induce SMC differentiation of
rat bone marrow-derived MSCs and increased the ex-
pression of contractile genes, such as SM22, SM- MHC,
SM-α-actin in MSCs.
However, the induction action of TGF-β3 and the un-
derlying molecular me
tion of MSCs into SMCs are not well known. Myo-
cardin is known to be a potent serum response factor
(SRF) cofactor that plays important roles in regulating
smooth muscle and cardiac muscle gene transcription [7].
It is reported that the expression of myocardin at the
transcriptional level were increased during the SMC
differentiation of hATSCs induced by SPC [6]. Taken
together with previous experimental results, our findings
are consistent with the idea that myocardin and MRTF-A
is activated during the process of SMC differentiation in
MSCs.
In summary, our results in this study showed that
TGF-β3ffer- tumor cells to ionizing radiation. Cancer Res., 50,
1392–1396.
[10] N. Kobayashi, T. Yasu, H. Ueba, M. Sata, S. Hashimoto,
M. Kuroki, et
tiation into SMCs. TGF-β3 increased the expression of
contractile genes, such as SM22, smooth muscle-myosin
heavy chain (SM-MHC), SM-α-actin in MSCs. When
TGF-β3 induced MSCs differentiation into SMCs, myo-
cardin and MRTF-A were activated. The data indicated
that TGF-β3 induced rat bone marrow-derived MSCs
differentiation into SMCs by activating mypcardin and
MRTF-A. Obviously, further studies are needed to clar-
ify, for example, the interaction of myocardin and smad
proteins as major intracellular mediators of TGF-β signal
pathways.
REFERE
[1] J. Y. Lai, C. Y. Y
(2002) Phenotypic
bivo tissue engineered smooth muscle from normal and
pathological bladders. J. Urol., Sugar Land, 168,
1853–1857.
[2] D. Orlic, J. Kajstura, S. Chimenti, I. Jakoniuk, S. M.
Anderson, B
regenerate infarcted myocardium. Nature, 410, 701–705.
[3] M. F. Pittenger, A. M. Mackay, S. C. Beck, R. K. Jaiswal,
R. Douglas, J. Mosca, et al., (1999) Multilineage poten-
tial of adult humanmesenchymal stem cells. Science, 284,
143–147.
[4] S. Davani, A. Marandin, N. Mersin, B. Royer, B.
Kantelip, P
progenitor cells differentiate into an endothelial pheno-
type, enhance vascular density, and improve heart fun-
ction in a rat cellular cardiomyoplasty model. Circulation,
108, II253–II258.
[5] B. Kinner, J. M. Zaleskas, M. Spector. (2002) Regulation
of smooth muscle
adult human mesenchymal stem cells. Exp. Cell Res, 278,
72–83.
[6] E. S. Jeon, H. J. Moon, M. J. Lee, H. Y. Song, Y. M.
Kim, Y
choline induces differentiation of human mesenchymal
stem cells into smooth-muscle-like cells through A TGF-
beta-dependent mechanism. J Cell Sci., 119, 4994–5005.
[7] G. C. Pipes, E. E. Creemers, E. N. Olson. (2006) The
myocardin family of transcriptional coactivators
versatile regulators of cell growth, migration, and
myogenesis. Genes Dev., 20, 1545–1556.
[8] C. D. Li, W. Y. Zhang, H. L. Li, X. X. Jiang, Y. Zhang,
P. H. Tang, et al. (2005) Mesenchymal stem
from human placenta suppress allogeneic umbilical cord
blood lymphocyte proliferation. Cell Res., 15, 539–547.
[9] P. Price and T. J. McMillan. (1990) Use of the
tetrazolium assay in measuring the response of human
epression of smooth muscle-like properties in marrow
stromal cells. Exp. Hematol., 32, 1238–1245.
[11] J. J. Ross, Z. Hong, B. Willenbring, L. Zeng, B. Isenberg,
E. H. Lee, et al. (2006) Cytokine-induced
tion of multipotent adult progenitor cells into functional
smooth muscle cells, J Clin Invest., 116, 3139–3149.
[12] S. G. Ball, A. C. Shuttleworth, C. M. Kielty. (2004)
Direct cell contact influences bone marrow mes
chymal stem cell fate. Int. J. Biochem, Cell Biol., 36,
714–727.
[13] S. Sinha, M. H. Hoofnagle, P. A. Kingston, M. E.
McCanna,
factor-β1 signaling contributes to development of smooth
muscle cells from embryonic stem cells. Am. J. Physiol.
Cell. Physiol., 287, C1560–C1568.