Advances in Microbiology, 20 11, 1, 1-6
doi:10.4236/aim.2011.11001 Published Online December 2011 (http://www.SciRP.org/journal/aim)
Copyright © 2011 SciRes. AIM
1
Cocoa Powder as Delivery Medium for Probiotic
Lactobacillus Strains
Giovanni Ricci, Francesca Borgo, Chiara Ferrario, Maria Grazia Fortina*
Dipartimento di Scienze e Tecnologie Alimentari e Microbiologiche, Sezione di Microbiologia Industriale, Università
degli Studi di Milano, Milan, Italy
Received November 1, 2011; revised November 15, 2011; accepted December 10, 2011
Abstract
Three Lactobacillus strains previously isolated from artisanal Italian cheeses and identified by species-spe-
cific PCR as L. helveticus, L. paracasei and L. rhamnosus, were evaluated for the presence of functional
traits, such as acidifying activity, cell surface hydrophobicity, antibiotic resistance, survival in low pH and in
presence of bile salts, in comparison with two commercially available probiotic strains (Lactobacillus aci-
dophilus La-5 and L. rhamnosus GG). Subsequently, with the aim to develop a new non-dairy functional
product, cocoa powder was used as a medium for incorporating freeze-dried cultures of each tested strain and
survival at different time/temperature conditions was investigated. The results obtained demonstrated that
artisanal dairy products are interesting sources of new probiotic strains; in particular, the dairy origin strain L.
rhamnosus showed a good probiotic performance and the highest level of survival during storage. Finally,
we showed that cocoa powder represents a good delivery medium for lactobacilli: it could be considered a
novel functional food exhibiting high antioxidant power and presenting probiotic potential.
Keywords: Lactobacilli, Probiotics, Cocoa Powder
1. Introduction
In recent times, there has been an increased interest to
adapt healthy diets and as a consequence, the selection of
new probiotic strains and the development of new func-
tional foods has gained much importance 1,2. Milk and
dairy fermented products can be considered the most
common and traditional functional foods. The health
benefits are the high amounts of specific live probiotic
bacteria, mainly Lactic Acid Bacteria (LAB), naturally
present or selectively added 3. However, the increase in
the consumer vegetarianism and the allergy to dairy pro-
ducts that affects some persons determine a demand for
new products and new preparations 4,5. In this context,
the selection of new bacterial strains with characteristic
and differentiated functional traits is important. In par-
ticular, in addition to well known ideal properties of the
probiotic strains (Generally Regarded As Safe status -
GRAS, resistance to acids and bile, colonization of the
human intestine, production of antimicrobial substances)
6, other desirable characteristics must also be consid-
ered, such as viability during the processing and storage,
facility of the application in the products, resistance to
the technological processing of the food.
In this study we tested three Lactobacillus strains,
previously isolated from artisanal dairy products. A
comparison of the novel isolates with respect to probiotic
strains from commercial products allowed an evaluation
of the probiotic potential. Furthermore, with the aim of
creating a new functional food, cocoa powder was used
as a medium for incorporating lactobacilli, and survival
of the cultures during freeze-drying, and during storage
of the final product in different time/temperature condi-
tions was studied. Cocoa and chocolate have been sug-
gested as a good medium for the functional health ingre-
dients, because they are rich sources of flavan-3-ols
(flavanols) that have the ability to act as in vivo antioxi-
dants 7. Numerous dietary intervention studies in hu-
mans and animals indicate that flavanol-rich foods and
beverages might exert cardioprotective effects with re-
spect to vascular function and platelet reactivity 8,9.
Interestingly, cocoa powder has been shown to exhibit
greater antioxidant capacity than many other flavanol-
rich foods, such as green and black tea, red wine and
fruits and vegetables 10.
G. RICCI ET AL.
2
2. Materials and Methods
2.1. Bacterial Strains and Culture Conditions
Two commercially available probiotic strains, Lactoba-
cillus acidophilus La-5 and L. rhamnosu s GG, were stud-
ied in comparison with three Lactobacillus strains, pre-
viously isolated from artisanal Italian cheeses. Their cor-
rect taxonomic position was determined by species-spe-
cific PCR according to protocols shown in Table 1. The
strains were cultivated in MRS (Difco, Becton Dickinson,
Sparks, MD) agar or broth at 37˚C under anaerobic con-
ditions (Anaerocult A, Merck, Darmstadt, Germany) and
maintained by weekly transfers. For long-term, cultures
were stored at –80˚C in MRS broth containing Bacto
glycerol (Difco). The cell concentration of individual
strains was evaluated by checking the optical density
value at 600 nm (OD600) and then by plating diluted sus-
pensions on MRS agar plates.
2.2. Acidifying Activity
Fresh milk cultures of each strain were inoculated at 1%
in 100 ml sterile reconstituted skimmed milk (10% w/v,
Difco) pre-warmed at 37˚C. The pH was measured and
recorded automatically, throughout the 48 h incubation
period. ΔpH values after 6, 10, 24 and 48 h were used to
compare the acidifying activity of the strains.
2.3. Hydrophobicity Studies
The cell surface hydrophobicity of the strains was deter-
mined as described by Rosenberg et al. 11 with some
modifications. Briefly, cells were harvested (late log
phase from MRS medium), washed twice in PBS buffer
and resuspended in 0.1 M KNO3 (pH 6.2) to give a cell
suspension with an OD600 of 0.5 - 0.6 (A0). Three ml of
cell suspension were mixed with 1 ml of xylene. After a
10 min of preincubation at room temperature, the two-
phase system was mixed by vortexing for 2 min. The
aqueous phase was removed after 20 min of incubation at
room temperature, and its absorbance at 600 nm (A1) was
measured. The percentage of bacterial adhesion to sol-
vent was calculated as (1 – A1/A0) × 100.
2.4. Antibiotic Resistance
The Minimal Inhibitory Concentration (MIC) of the an-
tibiotics, vancomycin, chloramphenicol, tetracycline and
streptomycin (Sigma, St Louis, Mo) was determined by
the broth dilution method 12, after growth in MRS
broth at 37˚C, using 105 cells/ml as the initial inoculum.
2.5. Acid and Bile Tolerance
Harvested bacterial cells from overnight cultures were
washed twice with PBS buffer (pH 7.2) and then resus-
pended in a medium containing peptone (1 g/l, Difco),
KCl 0.1 M, and pepsin (500 U/ml, Difco), adjusted to pH
2 and pH 3 using 1 M HCl. Samples were incubated for 2
h at 37˚C. The residual viable population was determined
by plate counting on MRS agar after 48 - 72 h of incuba-
tion under anaerobic conditions. Tolerance to bile salts
was tested at 37˚C by inoculation of fresh cultures in
MRS broth adjusted to pH 6.3 and enriched with 0.3%
Oxgall (Oxoid, Wesel, Germany). Resistance was as-
sessed in terms of viable count, enumerated after incuba-
tion for 0 and 2 h.
2.6. Freeze-Drying of Cell Cultures
The recovered strains were used as 1% inoculum for the
preparation of 100 ml of culture in MRS broth incubated
at 37˚C. The cells were collected from the exponential
growth phases (OD600 of 1.6), centrifuged (6000 g for 10
min at 4˚C) and washed twice with sterile saline solution
(0.9% NaCl in distilled water). After centrifugation, the
washed cells were resuspended in sterile 4% bovine
Table 1. PCR primers and conditions used for species-specific gene amplification.
Species Primer pair (5’ to 3’) Amplicon (bp) Thermal conditions
L. paracasei 15 Fw: CCCACTGCTGCCTCCCGTAGGAG
Rev: CACCGAGATTCAACATGG
290
94˚C × 2 min
54˚C × 1 min × 35
72˚C × 1min
L. rhamn osus 15 Fw: CCCACTGCTGCCTCCCGTAGGAG
Rev: TGCATCTTGATTTAATTTTG
290
94˚C × 45 s
54˚C × 1 min × 35
72˚C × 1 min
L. helveticus 16
Fw: CTGTTTTCAATGTTGCAAGTC
Rev: TTTGCCAGCATTAACAAGTCT
Fw: CGCTGATTCTAAGTCAAGCT
Rev: CGACTAAGAAGTGGAACATTA
Fw: TCTTATTACGCAATGGACCAA
Rev: AATACCGTTCTTGAGGTTAGA
524
726
918
94˚C × 2 min
58˚C × 1 min × 35
72˚C × 1 min
Copyright © 2011 SciRes. AIM
3
G. RICCI ET AL.
serum albumin and desiccated under vacuum in a freeze-
drier at room temperature. Freeze-dried cells were stored
in hermetically closed containers at 4˚C. For evaluation
of the viable counts, the samples were rehydrated to the
original volume with sterile deionized water and suitable
dilutions were then plated on MRS agar.
2.7. Cocoa Powder Samples and Inoculum of
Probiotic Strains
Commercially available cocoa powder was selected from
the most common cocoa powder products marketed in
Italy. This cocoa sample was checked for the absence of
microbial population (sterility), by plating serially di-
luted suspensions on potato dextrose agar (PDA, Difco),
plate count agar (PCA, Difco), MRS and M-17 (Difco).
Freeze-dried cultures of each tested strain were added
to the cocoa powder to attain approximately 1010 cfu/gr.
Viable cell numbers were calculated on MRS agar as
described elsewhere. After storage in different time/tem-
perature conditions, the number of cells surviving the
treatment was determined.
2.8. Sensory Tests
Sensory properties of the cocoa powder enriched with
probiotic strains was measured by untrained panelists (n
= 20) recruited from the staff and students of the Univer-
sity of Milan. The commercial cocoa powder as it is
(control) and enriched with probiotic strains (sample)
were mixed with milk. The subjects received 40 ml of
each product in 100 ml glasses at room temperature, in
individual booths. They were asked to compare the two
formulations and to indicate whether they differed from a
sensory point of view.
3. Results and Discussion
The three lactobacilli tested, previously phenotypically
characterized, were identified to the species level by spe-
cies-specific PCR. Strains were designated L. helveticus
ACH, L. paraca sei ACP and L. rhamnosus ACR.
All data reported below, regarding the characteristics
of these new isolates in comparison with two commercial
probiotic strains, represent an average of three repeats.
The values recorded in each experiment did not vary by
more than 5%. Single data points are, therefore, pre-
sented without standard deviation bars.
3.1. Acidifying Activity
At first, the isolates were screened for acidifying activity.
Lactic acid production, together with other low molecu-
lar weight metabolites, is an important parameter for
probiotic strains, since this primary metabolite shows
antagonistic properties against many harmful organisms
of the colonic flora. The lactic acid production profiles,
after growth in milk at 37˚C, are shown in Figure 1. The
performance of the newly isolated strains was compara-
ble or superior to those of the probiotic reference strains.
Particularly, the commercial L. rhamnosus GG strain
showed slower rates and extent of acid development; the
pH decrease was lower than 0.8 pH units, after 48 h of
growth. On the contrary, L. acidophilus La-5 and L. hel-
veticus ACH could be considered as fast-acidifying
strains, with a pH24h higher than 2.5 pH units.
3.2. Cell Surface Hydrophobicity of the Strains
To assess the potential adhesion ability, we studied the
cell wall hydrophobicity properties, a bacterial trait that
Figure 1. Acidif
ying activity of Lactobacillus strains after growth in skim milk (10% w/v) for different time intervals at 37˚C.
Copyright © 2011 SciRes. AIM
G. RICCI ET AL.
4
could be indicative of adhesiveness of probiotic bacteria.
Among the tested strains, only L. acidophilus La-5
showed strong affinity for xylene, demonstrating the
hydrophobicity of cell surface (Ta ble 2); the L. rhamno-
sus strain isolated from cheese exhibited a moderate hy-
drophobicity, while the remaining strains showed very
poor affinity for the apolar solvent.
3.3. Antibiotic Resistance
Antibiotic susceptibility of the strains is shown in Table
2. All strains, with the exception of L. rhamnosus ACR,
were susceptible to tetracycline (break-point 8 µg/ml),
whereas for the chloramphenicol, MICs for all strains
were determined only just higher (8 µg/ml) than the
break-point level (4 µg/ml). In the case of vancomycin,
all strains, with the exception of L. acidophilus La-5
were highly resistant (>100 µg/ml). Finally, all strains
were found to be resistant to streptomycin, with MICs
ranging from 50 to 500 µg/ml. From a safety point of
view, this phenotypic result underlines the difficulty to
find antibiotic-susceptible strains. Due to the indiscrimi-
nate use of antibiotics in human and veterinary medicine
and in animal growth promoters, antibiotic resistance has
become an increasingly common characteristic in micro-
organisms 13. Lactobacilli display a wide range of
natural antibiotic resistances 14, but in most cases anti-
biotic resistance is not of the transmissible type. Lacto-
bacillus strains with non-transmissible antibiotic resis-
tances do not usually form a safety concern 1. However,
checking the ability of a proposed probiotic strain to act
as a donor of antibiotic resistance genes may be a further
prudent precaution.
3.4. Acid and Bile Tolerance
Determination of resistance to upper gastrointestinal
transit was obtained by exposing bacterial cells to simu-
lated gastric juice environment, which contains pH-de-
pendent and enzymatic barriers (Table 2). All strains
tested retained their viability after 2 h of exposure to pH
3 in presence of pepsin. When the strains were subjected
to the pepsin solution at pH 2, a loss of viability, ranging
between 1.3 and 3.0 log cycles, was found. The per-
formance of the dairy strains was superior to those of the
probiotic reference strains: highest survival was observed
with L. paracasei ACP (1.3 log cycle reduction), while
the two commercial strains, L. acidophilus La-5 and L.
rhamnosus GG displayed the highest loss of viability (3
log cycles). In addition, all strains were resistant in the
presence of 0.3% bile salts. Bile tolerance is an important
characteristic since it enables the probiotic strains to sur-
vive, grow, and exert their beneficial effects in the host.
These results highlight the potential of the strains of
dairy origin to survive under gastrointestinal conditions.
3.5. Development of a Novel Product Enriched
with Probiotic Bacterial Strains
As a delivery medium for probiotic Lactobacillus strains,
we selected cocoa powder, a food product naturally rich
in antioxidant compounds and that can be consumed in
compatible amounts, with a balanced and diversified
normal feeding, as a component of milk, soymilk or non
dairy beverages. Namely, we tested the finished food
product, into which the probiotic lactobacilli have been
directly incorporated as freeze-dried cultures. For this
scope, firstly we investigated survival of the tested strains
during freeze-drying. All tested strains retained their
viability with little (<1 log cycle) or no loss at all. More-
over, all the freeze-dried cultures could be stored for
long time at 4˚C without any significant loss of viability.
Subsequently, 1 gr of cocoa powder was mixed, in sterile
conditions, with an aliquot of freeze-dried samples con-
taining about 1010 viable cells of each tested strain, and
stored in hermetically closed containers at different time/
temperature conditions. The calculated viability of the
probiotic strains during storage is reported in Figure 2.
In refrigerated conditions (4˚C) all strains, with the ex-
ception of L. acidophilus La-5, showed a high-level of
Table 2. Antibiotic resistance and probiotic proper t ie s of Lactobacillus strains.
Strains Antibiotic resistance MIC
(µg/ml)a HydrophobicitybViability of the strai ns a t lo w pH and in presence of bile salts (log
cfu/ml)
Cm Str Tet Van Pepsin at pH 2 Pepsin at pH 3 Oxgall (0.3%)
0 h 2 h 0 h 2 h 0 h 2 h
L. helveticus ACH 8 500 5 >100 5 7.0 4.8 6.8 6.7 6.5 6.3
L. paracasei ACP 8 250 5 >100 2 6.7 4.9 7.5 7.0 6.3 6.0
L. rhamnosus ACR 8 500 20 >100 35 7.0 5.3 7.0 6.8 7.7 7.7
L. rhamnosus GG 8 250 5 >100 5 6.7 3.7 6.8 6.5 6.0 6.0
L. acidophilus La-5 8 50 5 <5 90 7.3 4.3 7.8 7.0 6.9 6.8
aAbbrevations: Cm, chloramphenicol; Str, streptomycin; Tet: tetraclycline; Van: vancomycin. bDetermined as xylene adhesion (%).
Copyright © 2011 SciRes. AIM
5
G. RICCI ET AL.
(a)
(b)
Figure 2. Survival of freeze-dried probiotic bacteria in cocoa powder after storage at room temperature (a), or in refrigerated
conditions (b). All data represent an average of three repeats. The values recorded in each experiment did not vary by more
than 5%. Single data points are, therefore, pre sented without standar d de viation bar s.
survival, because the viable count remained relatively
constant throughout a 120 day-storage period. At room
temperature, a loss in viability in the time was observed,
however, most strains retained a high level of survival
for 10 days. After this time, for L. helveticus ACH strain
number of viable cells declined from about 106 to less
than 100 cfu/gr within 14 days of storage, while counts
for L. rhamnosus ACR fell only to about 108 cfu/gr over
the same storage period, and remained at about 107
cfu/gr after 36 days. Finally, no clear differences could
be observed between the sensory characteristics of the
novel food and the control, when cocoa powder was
added to milk beverage.
The results reported here suggest that cocoa powder is
a suitable substrate for delivering probiotic strains: the
level of viable cells was more than 108 cfu/gr during
storage in refrigerated conditions for the commercial L.
rhamnosus GG and for the three dairy strains L. helveti-
cus ACH, L. paracasei ACP and L. rhamnosus ACR.
The latter strain also shows a good survival at room
temperature. Considering a minimal cocoa-intake of
about 1 - 2 gr per day, an amount of 108 cfu of viable
probiotic strains could be ingested using preparations
stored for 4 months at 4˚C. These amounts are compara-
ble to those of milk-based probiotic products, e.g., bioyo-
gurt, containing about 106 cfu of probiotic bacteria per
ml at the end of their shelf life, which does not exceed 30
days when stored under refrigeration.
4. Conclusions
Our preliminary results suggest that artisanal dairy pro-
Copyright © 2011 SciRes. AIM
G. RICCI ET AL.
6
ducts are interesting sources for the isolation of bacterial
strains with useful probiotic traits and satisfying techno-
logical characteristics. Notably, the isolates characterized
in this study, and particularly L. rhamno sus ACR, exhib-
ited high tolerance to bile salts and were able to survive
in high numbers during storage either in refrigerated con-
ditions or at room temperature.
The results obtained also suggest that cocoa powder
represents a simple formulation of a non-dairy functional
food in which the probiotic strains, manufactured under
industrial conditions, are able to survive and to retain
their functionality during storage. Moreover it can be
consumed as a component of milk, soymilk or non dairy
beverages in amounts compatible with a balanced and
diversified normal feeding.
This is the first information on the survival of lactoba-
cilli in cocoa powder: these initial assessments will pro-
vide useful and helpful information for continue studying
the performance of new isolates and the development of
new functional foods.
5. References
[1] M. Saarela, G. Mogensen, R. Fondén, J. Mättö and T.
Mattila-Sandholm, “Probiotic Bacteria: Safety, Func-
tional and Technological Properties,” Journal of Bio-
technology, Vol. 84, No. 3, 2000, pp. 197-215.
doi:10.1016/S0168-1656(00)00375-8
[2] S. Salminen, A. Ouwehand, Y. Benno and Y. K. Lee,
“Probiotics: How Should They Be Defined?” Trends in
Food Science and Technology, Vol. 10, No. 3, 2000, pp.
107-110. doi:10.1016/S0924-2244(99)00027-8
[3] G. W. Tannock, “A Special Fondness for Lactobacilli,”
Applied and Enviromental Microbiology, Vol. 70, No. 6,
2004, pp. 3189-3194.
doi:10.1128/AEM.70.6.3189-3194.2004
[4] P. Lavermicocca, F. Valerio, S. L. Lonigro, M. De An-
gelis, L. Morelli, M. L. Callegari, et al., “Study of Adhe-
sion and Survival of Lactobacilli and Bifidobacteria on
Table Olives with the Aim of Formulating a New Probi-
otic Food,” Applied and Environmental Microbiology,
Vol. 71, No. 8, 2005, pp. 4233-4240.
doi:10.1128/AEM.71.8.4233-4240.2005
[5] F. C. Prado, J. L. Parada, A. Pandey and C. R. Soccol,
“Trends in Non-Dairy Probiotic Beverages,” Food Re-
search International, Vol. 41, No. 2, 2008, pp. 111-123.
doi:10.1016/j.foodres.2007.10.010
[6] L. Morelli, “In Vitro Assessment of Probiotic Bacteria:
From Survival to Functionality,” International Dairy
Journal, Vol. 17, No. 11, 2007, pp.1278-1283.
doi:10.1016/j.idairyj.2007.01.015
[7] H. Osman, R. Nasarudin and S. L. Lee, “Extracts of Co-
coa (Theobroma cacao L.) Leaves and Their Antioxida-
tion Potential,” Food Chemistry, Vol. 86, No. 1, 2004, pp.
41-46. doi:10.1016/j.foodchem.2003.08.026
[8] E. L. Ding, S. M. Hutfless, X. Ding and S. Girotra,
“Chocolate and Prevention of Cardiovascular Disease: A
Systematic Review,” Nutrition and Metabolism, Vol. 3,
2006, pp. 2-12. doi:10.1186/1743-7075-3-2
[9] U. Campia and J. A. Panza, “Flavanol-Rich Cocoa: A
Promising New Dietary Intervention to Reduce Cardio-
vascular Risk in Type 2 Diabetes?” Journal of the Am-
erican College of Cardiology, Vol. 51, No. 22, 2008, pp.
2150-2152. doi:10.1016/j.jacc.2008.02.058
[10] K. W. Lee, Y. J. Kim, H. J. Lee and C. Y. Lee, “Cocoa
Has More Phenolic Phytochemicals and a Higher Anti-
oxidant Capacity than Teas and Red Wine,” Journal of
Agricultural and Food Chemistry, Vol. 51, No. 25, 2003,
pp. 7292-7295. doi:10.1021/jf0344385
[11] M. Rosenberg, D. Gutnick and E. Rosenberg, “Adherence
of Bacteria to Hydrocarbons: A Simple Method for Meas-
uring Cell-Surface Hydrophobicity,” FEMS Microbiology
Letters, Vol. 9, No. 1, 1980, pp. 29-33.
doi:10.1111/j.1574-6968.1980.tb05599.x
[12] M. J. Andrews, “Determination of Minimum Inhibitory
Concentrations,” Journal of Antimicrobial Chemistry,
Vol. 48, 2001, pp. 5-16.
[13] D. J. Austin, K. G. Kristinsson and R. M. Anderson, “The
Relationship between the Volume of Antimicrobial Con-
sumption in Human Communities and the Frequency of
Resistance,” Proceedings of the Natural Academy of Sci-
ences (USA), Vol. 96, No. 3, 1999, pp.1152-1156.
doi:10.1073/pnas.96.3.1152
[14] W. P. Charteris, P. M. Kelly, L. Morelli and J. K. Collins,
“Antibiotic Susceptibility of Potentially Probiotic Lacto-
bacillus Species,” Journal of Food Protection, Vol. 61,
1998, pp. 1636-1643.
[15] L. J. H. Ward and M. J. Timmins, “Differentiation of
Lactobacillus casei, L. paracasei and L. rhamnosus by
Polymerase Chain Reaction,” Letters in Applied Microbi-
ology, Vol. 29, No. 2, 1999, pp. 90-92.
doi:10.1046/j.1365-2672.1999.00586.x
[16] M. G. Fortina, G. Ricci, D. Mora, C. Parini and P. L.
Manachini, “Specific Identification of Lactobacillus hel-
veticus by PCR with pepC, pepN and htrA Targeted
Primers,” FEMS Microbiology Letters, Vol. 198, No. 1,
2001, pp. 85-89.
doi:10.1111/j.1574-6968.2001.tb10623.x
Copyright © 2011 SciRes. AIM