J. Biomedical Science and Engineering, 2009, 2, 559-563
doi: 10.4236/jbise.2009.27081 Published Online November 2009 (http://www.SciRP.org/journal/jbise/
JBiSE
).
Published Online November 2009 in SciRes. http://www.scirp.org/journal/jbise
MRTF-A transactivates COMT gene and decreases the
anti-tumor effects of tamoxifen
Zhi-Peng Liu*, Xue-Gang Luo*, Shu Guo, Jian-Xin Wang, Xin Zhang, Nan Wang, Yong Jiang,
Tong-Cun Zhang
Key Laboratory of Industrial Microbiology, Ministry of Education, College of Biotechnology, Tianjin University of Science and
Technology, Tianjin, China; *The authors contributed equally to this work; Correspondence to: Pro. Tong-Cun Zhang.
Received 29 June 2009; revised 21 August 2009; accepted 1 September 2009.
ABSTRACT
Myocardin-related transcription factors A (MR TF-A)
is a myocardin-related transcription factor that have
been found strongly activated CarG box–containing
genes through its direct binding to serum response
factor (SRF). In the present study, the MRTF-A ex-
pression vector was constructed. The MTT assay
showed that transfection of MRTF-A could signifi-
cantly decrease the anti-tumor effect of tamoxifen on
MCF-7 breast cancer cells. The bioinformatics analy-
sis found that the CarG element existed in the pro-
moter region of COMT gene of many familiar verte-
brates, including of human, rhesus macaque, chim-
panzee, etc. The results of RT-PCR assay further
showed that MRTF-A could enhance the transcrip-
tion level of COMT. These results are the first to in-
dicate that COMT might be a target gene which
could be regulated by MRTF-A/SRF, and such
transactivation event might be involved in the proc-
ess of tamoxifen resistance.
Keywords: MRTF-A; Tamoxifen; COMT; Breast Cancer
1. INTRODUCTION
Breast cancer is the most common cancer diagnosed in
women in the world. Seventy percent of diagnosed
breast cancers express Estrogen Receptor alpha (ERa)
and are likely to be hormone-responsive. The most
common therapy for ERa–positive breast cancers has
employed the use of selective estrogen receptor modula-
tors (SERMs) such as tamoxifen. As an adjuvant therapy
in breast cancer, tamoxifen improves overall survival,
and its widespread use is thought to have made a sig-
nificant contribution to the reduction in breast cancer
mortality seen over the last decade. However, although
many patients benet from tamoxifen, the resistance is
an important clinical problem [1,2].
Myocardin-related transcription factors (MRTFs); in-
cluding myocardin, MRTF-A/MKL1/MAL, and MRTF-
B/MKL2, comprise a family of related transcriptional
coactivators. MRTFs drives transcription through inter-
action with the ubiquitous transcription factor serum
response factor (SRF), which acts on a responsive ele-
ment CC(A/T)6GG (known as CarG box) that is com-
monly found in many gene promoters. Myocardin is
expressed specifically in cardiac and smooth muscle
cells and activates muscle genes associated with the dif-
ferentiation of these cell types. MRTF-A and MRTF-B
are expressed in a broad range of cell types [3,4].
Previous publications have suggested that MRTF-A
might plays a role in development of mammary myoepi-
thelial cells and breast cancer [5,6]. In the present paper,
we further found that MRTF-A could decrease the
anti-tumor effect of tamoxifen on MCF-7 human breast
cancer cells, and the transcriptional activation of cath-
echol-O-methyltransferase (COMT), a phase II metabo-
lising enzyme of tamoxifen, might be involved in this
process.
2. METERIALS AND METHODS
2.1. Regents and Cell Culcure
Tamoxifen (Wako Pure Chemicals, Osaka, Japan) was
dissolved in Phosphate Buffered Saline (PBS). 1kb DNA
ladder marker was purchased from Solarbio Science &
Technology Co., Ltd (Beijing, China). Human liver cell
lines L02 and breast cancer cell line MCF-7 was cul-
tured in Dulbecco’s modified Eagle’s medium (DMEM;
Gibco, Paisley, UK) containing 10% fetal bovine serum
(FBS; Gibco).
2.2. Construction of MRTF-A Expression Vector
Total RNA of the LO2 cells was isolated using the me-
thod described in molecular cloning. First-strand cDNA
was synthesized from the total RNA using M-MLV re-
verse transcriptase (Promega, Madison, USA) and oligo
(dT)18 (Sangon, Shanghai, China). The full-ength MR-
Z. P. Liu et al. / J. Biomedical Science and Engineering 2 (2009) 559-563
SciRes Copyright © 2009 JBiSE
560
TF-A gene was amplified by polymerase chain reaction
(PCR) using the cDNA and the following primer pair: 5'-
CAAGGTACCATGCCGCCTTTGAAAAG -3' (forward)
and 5'- CCCGAATTCAGCCAGAGAGCTA- CAAGC
-3' (reverse). PCR was performed at 94°C for 5 min,
then 28 cycles at 94°C for 45 s, at 60°C for 45 s, and at
72°C for 3 min; extension was carried out at 72°C for 10
min. The PCR product (2824 bp) was double- digested
with kpnI and EcoRI (Takara, Kyoto) and inserted into
the pcDNA3.1 (+) mammalian expression vector (Invi-
trogen, Carlsbad, Canada). The recombinant construc-
tion was analyzed by restriction-enzyme digestion and
sequencing to determine reading frame orientation and
confirm sequence fidelity, and the positive recombinant
plasmid was named pcDNA-MRTF-A.
2.3. Cell Transfection
Transient transfection of pcDNA-MRTF-A plasmid into
the MCF-7 cells using LipofectaminTM 2000 transfection
reagents (Invitrogen, Carlsbad, USA) according to the
manufacturer’s instructions. As a negative control, the
empty vector pcDNA3.1 (+) (mock) was transfected in
parallel, and to assess the transfection efficiency, the
pEGFP-C3 plasmid was also transfected as a positive
control simultaneously.
2.4. Evaluation of the Inhibition Rate of
Tamoxifen on MCF-7 Cells
The MCF-7 human breast cancer cells were plated in
96-well plates at a density of 8×103 cells/well and trans-
fected with the pcDNA-MRTF-A plasmid or pcDNA3.1
(+). After 24h, the medium was removed and replaced
with fresh medium containing tamoxifen at concentra-
tions of 5, 10 and 20 μM. Forty-eight hours later, MTT
assay was performed. In brief, MTT (5 mg/ml) was
added to the wells (20 µl/well). The plate was incubated
in a cell incubator for 4 h, then the supernatant was re-
moved and 150 µl of dimethyl sulfoxide was added into
each well. After incubation for 10 min, the absorbance of
each well was measured using a microplate reader
(Bio-Rad) with a wavelength of 570 nm, with the refer-
ence wavelength set at 630 nm. Absorbance (A) was
directly proportional to the number of viable cells. All
assays were performed using six replicates. The inhibi-
tion rate was calculated as follows:
2.5. Bioinformatics Screen of the CarG Box in
the Promoter of COMT Gene
The genomic sequence of COMT gene was extracted
from the Database of GenBank. Their transcription start
sites were then located by using the University of Cali-
fornia at Santa Cruz (UCSC) genome brower, and the
Table 1. Primers used in RT-PCR analysis. (a. F: forward
primer. R: reverse primer)
Gene Primersa Product
(bp)
F: 5’-ATTCAACGGCACAGTCAAGG-3’
GAPDH R: 5’-GCAGAAGGGGCGGAGATGA-3’ 213
F: 5’-ACCGTGACCAATAAGAATGC-3’
MRTFA R: 5’-CCGCTCTGAATGAGAATGTC-3’ 269
F: 5’-GGATTTCGCTGGCGTGAAG-3’
COMT R: 5’-TCCACCACCTCCCTGTATTCC-3’ 306
sequence from 2000 bp upstream of the transcription
sites to 200 bp downstream of the transcription start sites
(–2000~+200) was extracted by using the UCSC data-
base assemblage, and then the potential CarG box was
analyzed using the primer premier 5.0 software [7].
2.6. RT-PCR Analysis
Total RNA of the transfected cells was extracted, and
then the potential residual genomic DNA was eliminated
with RNase-free Dnase I (Bio Basic Inc, Ontario, Can-
ada). First-strand cDNA was synthesized as described
above. For PCR amplification, primers specific for the
cDNA of the MRTF-A, COMT gene and the constitutive
glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
gene were used (Ta b l e 1 ). PCR was performed at 94°C
for 5 min, then 25 cycles at 94°C for 30 s, at 54°C for 30
s, and at 72°C for 45 s; extension was carried out at
72°C for 10 min. PCR products were electrophoretically
separated in 1.5% agarose gels and visualized by
ethidium bromide staining. The densities (D) of the
bands were analyzed with Quantity One software and
relative mRNA levels were deduced from the ratio of the
mean values of MRTF-A or COMT to that of GAPDH.
Cells transfected with the empty plasmid pcDNA3.1 (+)
was used as blank control. The assay was performed
using three replicates. The relative mRNA level was
defined as:
GAPDH
genetarget
D
D
levelmRNA Relative
2.7. Statistical Analysis
The data from the above mentioned experiments were
expressed as mean ± SD. The statistical significance of
differences was determined using Student’s t test. The
minimal level of significance was P < 0.05.
3. RESULTS
3.1. Construction of MRTF-A Expression Vector
The cDNA encoding human MRTF-A was obtained by
RT-PCR from Human liver cell lines L02 and cloned
into the pcDNA3.1 (+) vector. By the methods of restric-
tion digestion and sequence analyses, we confirmed that
the length, position and orientation of the inserted
MRTF-A gene were all correct, suggesting that the re-
100
)
A
(
control
Aexperimental
1(%)
rateInhibition
Z. P. Liu et al. / J. Biomedical Science and Engineering 2 (2009) 559-563
SciRes Copyright © 2009
561
3.5. Effect of MRTF-A on the Transcri ption
Level of COMT
combinant pcDNA-MRTF-A plasmid was constructed
successfully (Figure 1).
3.2. Cell Transfection To further detect whether the transcription of COMT
could be regulated by MRTF-A, the RT-PCR analysis
was performed to detect the effect of MRTF-A on the
The endotoxin-free plasmids were extracted and trans-
fected into the MCF-7 cells using LipofectaminTM 2000
transfection reagents. To assess the transfection effi-
ciency, 0.5μg pEGFP-C3 plasmid was also transfected as
a positive control simultaneously. As shown in Figure 2,
the MCF-7 cell transfected with pEGFP-C3 exhibited
bright fluorescence, indicating that the transfection effi-
ciency in the experiment was high enough to perform the
following experiments.
3.3. Effect of MRTF-A on the Anti-Tumor
Activity of Tamoxifen
To investigate the effect of MRTF-A on the anti-tumor
activity of tamoxifen, the MCF-7 breast cancer cells
were transfected with the MRTF-A or the mock plasmid,
and then treated with tamoxifen at different doses for 48
h. The inhibition rate was determined by MTT assay. As
inhibition rates of cells transfected with MRTF-A were
shown in Figure 2, at 5, 10 and 20 μM tamoxifen, the all
significantly lower than the cells transfected with mock
plasmid (p<0.05).
Figure 1. Identification of recombinant pcDNA-
MRTF-A plasmid by restriction endonuclease. Lane
1: pcDNA3.1(+) plasmid double-digested with kpnI
and EcoRI; Lane 2: pcDNA-MRTF-A double- di-
gested with kpnI and EcoRI; Lane M: 1kb DNA
ladder marker.
3.4. Bioinformatics Screen of the Potential Carg
Box in the Promoter of COMT Gene
To investigate whether COMT was a potential target
gene of MRTF-A, the sequence from 2000 bp upstream
of the transcription sites to 200 bp downstream of the
transcription start sites (–2000~+200) of COMT gene of
familiar vertebrate was analyzed. As shown in Ta b l e 2 ,
the CarG-like element existed in many vertebrates, in-
cluding of human, rhesus macaque, chimpanzee, etc.
This result indicated that COMT might be a target gene
which could be regulated by MRTF-A/SRF.
Figure 2. Cell image of MCF-7 transfected with PEGFP-C3-
C3 plasmid. The left one was the normal micrograph and the
right one was the fluorescence micrograph in the same visual
field.
Table 2. The carg box in the promoter region of comt gene.
Organism
Sciencific name Common name GenBank ID CarG seq Position
Homo sapiens Human NT_011519 CCTTTTATGG -1105
Macaca mulatta Rhesus macaque NW_001095157 CCTTTATTGG -933
Pan troglodytes Chimpanzee NW_001230944 CCTTTTATGG -1187
Mus musculus Laboratory mouse NT_039624 CCTATTGGGG -834
Rattus norvegicus Rat NW_047358 CCTGTTTTGG -616
Bos taurus Cattle NW_001493554 CCAATACTGG -9
CCTAAAGTGG -1175
Gallus gallus Chicken NW_001471459 CCTTATCAGG -21
CCTAAAAGGG -1582
CCCTAAAAGG -1583
Monodelphis domestica (Opossum), Ornithorhynchus
anatinus (duck-billed platypus), Bubalus bubalis (river
buffalo), Canis lupus familiaris (Dog), Felis catus
(Cat), Ovis aries (Sheep), Sus scrofa (Pig), Danio
rerio (Zebrafish)
The typical CarG box was not found in the promoter of COMT gene. Alternatively, the
COMT gene still remained unclear
JBiSE
Z. P. Liu et al. / J. Biomedical Science and Engineering 2 (2009) 559-563
SciRes Copyright © 2009 JBiSE
562
Figure 3. Decrease in anti-tumor of tamoxifen on MCF-7
breast cancer cells following transfection of MRTF-A. *p<0.05;
**P<0.01 (compared with the mock).
Figure 4. Promotion of COMT mRNA expression transfected
with MRTF-A. (A) Electrophoretica graph of the RT-PCR
assay; (B) The relative mRNA level determinded with the ratio
of the band density of MRTF-A or COMT to that of GAPDH.
*p<0.05; **P<0.01 (compared with the mock).
mRNA level of COMT. As shown in Figure 3, the rela-
tive mRNA level of MRTF-A and COMT of cells trans-
fected with MRTF-A were both significantly higher than
those of the mock cells, suggesting that MRTF-A could
promote the transcription level of COMT.
4. DISCUSSION
In 1980s, tamoxifen was approved by the Food and Drug
Administration (FDA) as an adjuvant therapy for the
breast cancer. Despite the benefits of tamoxifen therapy,
almost all tamoxifen-responsive breast cancer patients
develop resistance to therapy. The drug resistance to
tamoxifen therapy can take many forms, and one of the
important possible mechanisms may be the metabolic
activation [2,8,9].
The metabolic activation of tamoxifen involves the
transformation of tamoxifen into the 4-OH-tamoxifen
and 3, 4-di-OH-tamoxifen (catechol). It has been sug-
gested that the anticancer activity of tamoxifen may be
due to its 4-hydroxylated metabolite. However, because
4-OH-tamoxifen could be subsequently hydroxylated
into the 3, 4-di-OH-tamoxifen, the 4-hydroxylated me-
tabolite is usually at low observable levels in mammals.
The 3, 4-di-OH-tamoxifen is a suitable substrate of
COMT, which always catalyzes the transfer of a methyl
group from S-adenosyl-methionine (SAM) to one of the
phenolic hydroxyl groups in a variety of catechols in-
cluding catechol estrogens and catecholamine neuro-
transmitters. In the presence of SAM, the 3, 4-di-
OH-tamoxifen would be catalyzed into monomethoxy 3,
4-di-OH-tamoxifen [10,11,12].
MRTF-A is a member of Myocardin-related transcrip-
tion factors family, which transactivates the promoters
containing consensus CarG box. Compared with myo-
cardin, which is expressed specifically in cardiac and
smooth muscle cells, MRTF-A is expressed in a broad
range of cell types and has more extensive transactivat-
ing functions than myocardin [13]. Previous studies have
showed that the metabolizing function of COMT within
the coronary artery may be an important determinant of
the cardiovascular protective effects of circulating estra-
diol, and the COMT expression may be regulated in the
myometrium to control the local action of estrogen
[14,15,16]. In the present study, the bioinformatics
analysis found that the CarG element widely existed in
the promoter region of COMT gene of many familiar
vertebrates, especially in human, rhesus macaque and
chimpanzee, and the results of RT-PCR further showed
that MRTF-A could enhanced the transcription level of
COMT. These results indicated that COMT might be a
target gene which could be regulated by MRTF-A/SRF,
and such transactivation might be involved in the proc-
ess of tamoxifen resistance. Further studies addressing
the detail relationship between MRTF-A, COMT and
tamoxifen and the mechanism should provide funda-
mental insights into the function of MRTF-A in the de-
velopment and overcome of the breast cancer.
5. ACKNOWLEDGMENTS
This study was financially supported by the Tianjin natural science
foundation (No. 07JCYBJC16400).
REFERENCES
[1] Deroo, B. J. and Korach, K. S., (2006) Estrogen recep-
tors and human disease, J. Clin. Invest. Ann. Arbor., 116,
561–570.
[2] Ring, A., and Dowsett, M., (2004) Mechanisms of ta-
moxifen resistance, Endocr-relat cancer, Bristol., 11 ,
643–658.
[3] Wang, D. Z., Li, S., Hockemeyer, D., Sutherland, L.,
Wang, Z., Schratt, G., et al, (2002) Potentiation of serum
response factor activity by a family of myocardin-related
transcription factors, Proc. Natl. Acad. Sci., USA, Wash-
ington, 99, 14855–14860.
[4] Teg Pipes, G. C., Creemers, E. E., and Olson, E. N.,
(2006) The myocardin family of transcriptional coacti-
vators: Versatile regulators of cell growth, migration, and
myogenesis, Gene dev, Cold Spring Harbor, 20, 1545–
1556.
[5] Sun, Y., Boyd, K., Xu, W., Ma, J., Jackson, C. W., Fu, A.,
Z. P. Liu et al. / J. Biomedical Science and Engineering 2 (2009) 559-563
SciRes Copyright © 2009
563
JBiSE
et al, (2006) Acute myeloid leukemia-associated mkl1
(mrtf-a) is a key regulator of mammary gland function,
Mol. Cell Biol., Washington, 26, 5809–5826.
[6] Li, S., Chang, S., Qi, X., Richardson, J. A., and Olson, E.
N., (2006) Requirement of a myocardin-ralated transcrip-
tion factor for development of mammary myoepithelial
cells, Mol. Cell Biol., Washington, 26, 5797–5808.
[7] Sun, Q., Chen, G., Streb, J. W., Long, X., Yang, Y.,
Stoeckert, C. J., et al, (2006) Defining the mammalian
CarGome, Genome. Res., Cold Spring Harbor, 16, 197–
207.
[8] Jordan, V. C., (2003) Is tamoxifen the rosetta stone for
breast cancer, J. Natl. Cancer. Inst. Bethesda, 95, 338–
340.
[9] Hilsenbeck, S. G., Friedrichs, W. E., Schiff, R., O’Con-
nell, P., Hansen, R. K., Osborne, C. K., et al, (1999) Sta-
tistical analysis of array expression data as applied to the
problem of tamoxifen resistance, J. Natl. Cancer. Inst.
Bethesda, 91, 453–459.
[10] Mannisto, P. T. and Kaakkola, S., (2008) Catechol-O-
methyltransferase (COMT): Biochemistry, molecular bi-
ology, pharmacology, and clinical efficacy of the new se-
lective COMT inhibitors, Pharmacol. rev. Bethesda, 51,
593–628.
[11] Singh, M. N., Stringfellow, H. E., Walsh, M. J., Ashton,
K. M., Paraskevaidis, E., Abdo, K. R., et al, (2008)
Quantifiable mRNA transcripts for tamoxifen-metabolising
enzymes in human endometrium, Toxicology, Limerick,
249, 85–90.
[12] Dehal, S. S. and Kupfer, D., (1995) Evidence that the
catechol 3, 4-dihydroxytamosifen is a proximate inter-
mediate to the reactive species binding covalently to
proteins, Cancer Res. Baltimore, 56, 1283–1290.
[13] Cen, B., Selvaraj, A., Burgess, R. C., Hitzler, J. K., Ma,
Z., Morris, S. W., et al, (2003) Megakaryoblastic leuke-
mia 1, a potent transcriptional coactivator for serum re-
sponse factor (SRF), is required for serum induction of
SRF target genes, Mol Cell Biol., Washington, 23, 6597–
6606.
[14] Dubey, R. K., Gillespie, D. G., Zacharia, L. C., Barchiesi,
F., Imthurn, B., and Jackson, E. K., (2003) CYP450- and
COMT-derived estradiol metabolites inhibit activity of
human coronary artery SMCs, Hypertension, Dallas, 41,
807–813.
[15] Dubey, R. K., Tofovic, S. P., and Jackson, E. K., (2004)
Cardiovascular pharmacology of estradiol metabolites, J.
Pharmacol. Exp. Ther., Bethesda, 308, 403–409.
[16] Wentz, M. J., Jamaluddin, M., Garfield, R. E., Al-Hendy,
A., (2006) Regulation of catechol-O-methyltransferase
expression in human myometrial cells, Obstet. Gynecol.,
Hagerstown, 108, 1439–1447.