DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (<i>Elaeis guineensis</i> Jacq.)

doi:10.4236/ajps.2011.24064

Paper Menu >>

Journal Menu >>

American Journal of Plant Sciences, 2011, 2, 539-548

doi:10.4236/ajps.2011.24064 Published Online October 2011 (http://www.SciRP.org/journal/ajps)

539

DNA Sequence-Based Markers for Verification of

Ramet-to-Ortet Relationship in Oil Palm (Elaeis

guineensis Jacq.)

Claude Bakoumé1, Mohamad Y. Aziah2, Tangaya Praveena1, Chee Keng Teh2, Yahya Suzaini2, Musa

Hamidah3, Mohamad S. Jangi1, Mohd N. Basiran1, Hashim Khairudin2, Kulaveersingam Harikrishna1

1Sime Darby Technology Centre, Serdang, Selangor, Malaysia; 2Sime Darby R & D Centre, Banting, Selangor, Malaysia; 3Sime

Darby Biotechnology Laboratory, Port Dickson, Negeri Sembilan, Malaysia.

Email: [email protected], [email protected]

Received July 3rd, 2011; revised August 15th, 2011; accepted August 28th, 2011.

ABSTRACT

Since oil palm (Elaeis guineensis Jacq.) does not breed true, tissue culture-derived material is the resource of choice

for achieving oil palm homogeneity in terms of growth and yield. Currently, no genomic tagging method is available

with which one could verify the ortet (tissue donor oil palm) from which the clonal planting material (ramets) origi-

nated, particularly in cases of unsatisfactory performance. Thus, Sime Darby Plantation used 10 genomic microsatellite

markers to genotype 8 sets of 5 ramets +1 ortet and 2 single ortets. The average genetic distance (D) among oil pa lms

from the same set of ramets and ortet was 0.0000 with the exception of sets containing off-type ramets (D = [0.0834 -

0.1505]). The dendrogram showed that the ramets and their ortet of origin formed a sub-cluster, confirming their simi-

larity. The 10 microsatellite markers were valuable to Sime Darby as tools for verification of ramet-to-ortet relation-

ships and for the identification of off-types. Furthermore, the set of 10 markers revealed a high expected heterozygosity

(He = 0.634) that is a high expected heterosis effect on which yield depends.

Keywords: Tissue Culture, Ramet-to-Ortet Relationship, off-Type Ramet, Genetic Diversity, SSR Markers, Sime Darby

Plantation

1. Introduction

Despite all the efforts devoted to producing high oil-

yielding planting materials, a high level of heterogeneity

prevails among plants and contributes to leveling yield to

values which maintain the gap with the theoretical yield.

In fact, the heterogeneity is characteristic to seed-derived

planting materials of most plant species. In Malaysia, oil

yields of 14.9 t/ha have been obtained from the best indi-

vidual palms of progeny trials [1]. Unfortunately, oil

palm trunk has fibrous-like structure composed of nu-

merous vascular bundles, is cambium-less and possesses

one unique vegetative meristem, rendering the replication

of elite oil-yielding palms by cuttings or grafting impos-

sible. Furthermore, the nonexistence of fully inbred lines

is another limitation to the propagation of elite oil-

yielding oil palms [2]. Thus, clonal propagation of oil

palm via tissue culture allows a fast production of elite

palms that offer uniformity with high oil yield [3],

among other traits. Tissue culture can be a good route for

mass production of disease-tolerant planting materials

from single tolerant palms.

Cloning of oil palm consists of inducing somatic em-

bryogenesis on calli derived from young and immature

cabbage leaves. The oil yield of the best clones is esti-

mated at 21% - 25% more than that of seed-derived

planting materials [4-8]. One undesirable feature associ-

ated with clonal oil palms is the floral abnormality,

known as “mantling”, that transforms the stamens of both

male and female flowers into carpels, inducing the decay

of female inflorescences as fruits that are formed are

usually aborted [9], thus directly affecting oil production

[10]. In general, the rate of abnormality varies from one

tissue culture laboratory to another. With a view to re-

ducing the production of abnormal clones to economi-

cally viable levels, some preventative measures have

been proposed including: i) the cloning of seedlings [11],

ii) limitation of the production of clones from each em-

bryogenic callus [2] or iii) adoption of low hormone me-

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)

540

dia coupled with high culling rates [12]. Despite the flo-

ral abnormality associated with oil palm tissue culture,

public interest in oil palm clones remains high. Usually,

planters acquire clonal planting materials from different

oil palm tissue culture laboratories. Thus, traceability of

clones becomes an issue in those cases where the yields

are below expectations. Concurrently, tissue culture labo-

ratories would also like to be able to detect off-types,

which cannot be identified by the naked eye.

In this article, we assess the capacity of a set of mi-

crosatellite markers to verify ramet-to-ortet identity and

detect off-type oil palm clones produced by Sime

Darby’s tissue culture laboratory. Microsatellites or sim-

ple sequence repeats (SSRs) are tandem arrays of simple

nucleotide motifs that are ubiquitous components of eu-

karyotic genomes [13]. They are highly polymorphic,

owing to variation in the number of repeats [14]. They

show co-dominant inheritance, allowing discrimination

of homo- and heterozygous states. Furthermore, they are

locus-specific (one locus per primer pair), and the poly-

morphic information content (a measure of discrimina-

tion ability) is higher than that of RFLPs [15]. SSRs have

been successful in the monitoring of the uniformity of

different embryoid lines from a single oil palm clone

[12].

2. Materials and Methods

2.1. Plant Material

A total of 48 leaf samples from oil palms representing 8

sets of 5 ramets + 1ortet were used in the study. The

word ortet refers to an oil palm whose tissues have been

collected and used for clonal propagation. A ramet is a

clonal seedling at the nursery stage. The small number of

sets tested is a result of the relatively few original

sources of commercial oil palm planting materials. Some

of the sets contained from one to three blind contami-

nants (off-type ramets in the context of ortet-to-ramet

filiation). The tissue culture laboratory added off-type

ramets to some of the sets to check the usefulness of the

SSR marker combinations in identifying off-types. Two

more single ortets whose ramets were not available were

added in the assessment of the genetic diversity expected

within clonal materials exposed to various constraints in

the field. The 10 ortets were among the highest yielding

tenera oil palms from field 91A of Ampar Tenang Estate

and field 96A of Bukit Pelandok Estate, planted in 1991

and 1996, respectively. Field 91A, located in Serdang,

had a local alluvium soil series. The mean annual rainfall

was 2215 mm over 127 rainy days, on average, from

1999 to 2008. During the same period, field 96A, with a

local alluvium soil series, averaged a yearly rainfall of

1815 mm over 110 rainy days. The oil palm ramets were

raised at Bukit Talang Estate on Jawa soil series where

2145 mm of rainfall over 124 rainy days was recorded

annually, on average, from 1998 to 2008. Details of the

ramets and ortets are presented in Table 1.

DNA extraction from 3 g of fresh leaf tissues and pu-

rification of genomic DNA samples were performed ac-

cording to Doyle and Doyle [16] with minor modifica-

tions. Chloroform:isoamyl alcohol (24:1, v/v) was used

twice for improved removal of cell wall debris, denatured

protein and polysaccharides. The DNA pellet was

washed twice with a wash buffer (76% ethanol, 10 mM

ammonium acetate). The concentration of DNA for each

sample was determined using a NanoDrop 2000 spec-

trophotometer (NanoDrop Technologies Inc., USA) us-

ing 2 μl of diluted DNA sample. One aliquot of 100 µl at

10 ng/µl DNA concentration was prepared per sample

and stored at 4˚C for SSR analysis.

2.2. Microsatellite Analysis

A set of 10 E. guineensis SSR loci isolated by the French

Centre de Coopération en Recherche Agronomique pour

le Développement (CIRAD) and fluorescently labeled

was used for the present study. The 10 SSR loci repre-

sented 7 linkage groups out of 16, hence covering 44% of

the oil palm genome. Table 2 presents the characteristics

of the SSR loci.

The PCR amplification of genomic DNA was per-

formed according to Billotte et al. [17] using 12.5 l of

final reaction volume containing 25 ng of genomic DNA,

1 × PCR buffer (10 mM Tris HCl, pH 9.0, 50 mM KCl

and 0.1% Triton® X-100), 1.5 mM MgCl2, 200 µM of

each of the 4 deoxynucleotide triphosphates (dNTPs), 0.5

Unit of Taq DNA polymerase (Promega, USA), 0.2 µM

of each primer, and sufficient deionized distilled water

(dd H2O) to bring the total volume to 12.5 µl. PCR am-

plifications were performed in a MJ Research Gradient

Cycler (MJ Research, USA). The PCR programme pro-

tocol was as follows [17]:

Step 1 Denaturation at 94˚C for 5 minutes

Step 2 Denaturation at 94˚C for 30 seconds

Step 3 Annealing at 52˚C for 1 minute

Step 4 Elongation at 72˚C for 1 minute

Steps 2 to 4 repeated 35 times, then

Step 5 Elongation at 72˚C for 8 minutes

Step 6 Storage at 4˚C for 24 hours

PCR amplicons were separated by size via electropho-

resis in an ABI System 3730 xl DNA Analyzer (Applied

Biosystems, USA). The system effectively identifies po-

lymorphic microsatellite alleles with a sizing precision of

t least 0.15 bp. The alleles were sized with reference to a

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)

541

Table 1. Ortets selected from commercial oil palm plantations and their respective ramets.

Set number Ortet Ramets Plantation or nursery locationSet numberOrtet Ramets Plantation or nursery location

1 GBL 7 (ort8) Bukit Pelandok 5 GBL 34C (ort6) Ampar Tenang

R8-1

R8-2*

R8-3

R8-4

R8-5

Bukit Talang

R6-4

R6-5

R6-7

R6-9

R6-10

Bukit Talang

2 GBL 8 (ort2) Bukit Pelandok 6 GBL 35C (ort7) Ampar Tenang

R2-1

R2-2

R2-3

R2-4

R2-5

Bukit Talang

R7-1

R7-2

R7-3

R7-4

R7-5

Bukit Talang

3 GBL 13 (ort4) Bukit Pelandok 7 GBL 37C (ort11) Ampar Tenang

R4-1

R4-4

R4-7

R4-8

R4-10

Bukit Talang

R11-1*

R11-2

R11-3

R11-4

R11-5

Bukit Talang

4 GBL 18 (ort1) Bukit Pelandok 8 GBL39C (ort13) Ampar Tenang

S1-3

S1-4

S1-6

S1-7

S1-9

Bukit Talang

R13-1*

R13-2*

R13-3*

R13-8

R13-10

Bukit Talang

Single GBL 10 (ort9) na Single GBL398C (ort14)na

Serial numbers of ortets are given in parentheses; ort1: ortet number 1; R8-1: ramet 1 from ortet 8; *: off-type; na: not available.

Table 2. Repeats, primer sequences and expected allele sizes of the 10 SSR markers.

Microsatellite loci Motif Primer sequences (5’-3’) Linkage groupReference allele size (bp) Annealing temperature (˚C)

mEgCIR0037 (GA)17 CCAGTCTGCTAACCATCCTATAC3 175 52

mEgCIR0195 (GA)21 CCCACCACCCCTAGCTTCTC 6 255 52

mEgCIR0254 (TA)4(GA)18 CCTTTTGTGCTTTCTTC 7 156 52

mEgCIR0257 (GA)17 GCAGCTAGTCACCTGAAC 1 286 52

mEgCIR0408 (CCG)5 TTGCGGCCCATCGTAATC 2 193 58

mEgCIR0425 (CCG)9 AGCAAGAGCAAGAGCAGAACT 3 232 58

mEgCIR0783 (GA)15 GAATGTGGCTGTAAATGCTGAGTG6 296 58

mEgCIR0790 (GA)19 TTGGTGGTCCTTTTGAATATC 12 215 52

mEgCIR0802 (GA)12 CTCCTTTGGCGTATCCTTTA 1 217 52

mEgCIR0825 (GA)21 AGTGAGGTATGGTTGATTAGGA10 200 52

GS500, a formamide containing red DNA size standard

(Applied Biosystems, USA). Alleles were generated in

the form of electropherogram, where the X-axis scaled

the allele sizes in bp and Y-axis the peak intensities.

Electropherogram profiles were collected using Data

Collection software version 2.0 and the alleles were sized

and genotyped using GeneMapper version 4.0 software

(Applied Biosystems, USA). Decimal values were

rounded to the nearest unit.

2.3. Data Analysis

The genotype data were used to study the similarity of

the ramets to the ortets and also the identity of one ramet

to another, based on estimates of genetic distance [18]. A

cluster analysis was performed using the unweighted pair

group method with arithmetic (UPGMA) clustering

method [19] for a better visualization of the grouping of

ortets and derived ramets. Genotypic data from the 10

ortets were used to estimate i) the number of alleles per

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)

542

locus (Ao), ii) the observed heterozygosity (Ho) [20],

which is the amount of heterozygosity observed at a sin-

gle locus or an average over several loci, and iii) the ex-

pected heterozygosity (He) [21], which is an appropriate

measure of genetic variability in inbred populations with

very few heterozygotes and several homozygote types.

The data analysis was carried out by PowerMarker pro-

gramme [22].

3. Results

3.1. Allele Detection and Genetic Distances

Alleles were generated in a form of peak intensities on

the electropherogram. Homozygote individuals showed a

unique peak while heterozygote showed two peaks (Fig-

ure 1). The number of alleles per locus varied from 2 at

the SSR marker mEgCIR048 to 6 at mEgCIR257 (mean

= 4.2). The ramet R11-1 revealed unique alleles at SSR

markers mEgCIR0037, mEgCIR0257, mEgCIR0790, and

mEgCIR0802, and unique genotypes at SSR markers

mEgCIR0254, mEgCIR0425, mEgCIR0790, and mEg-

CIR0802.

The average genetic distance among oil palms from or-

tet-ramet sets was 0.0000 for 5 out of 8 sets used. The ge-

netic distance within sets varied from 0.1672 in the set No.

7 to 0.6500 in the set No. 1 in sets containing off-type

ramets. The genetic distance between the ramets R13-1,

R13-2 and R13-3, off-types from set No. 8, was zero. They

may have originated from the same ortet. Similarly,

the genetic distance between the ramet R8-2, an off-type

in the set no.1, and the ortet and ramets from the set No.

3 was zero (Table 3). The lowest value (0.2000) of ge-

netic distance among ortets was observed between ortet 1

and ortet 4, the highest (0.8500) between ortet 1 and ortet

11, and the mean was average (0.5308). The mean values

of the genetic distance between an ortet and its ramets

varied from 0.0834 to 0.1505 in the other three sets,

which contained off-type ramets (Table 4).

The UPGMA clustering of ortets and ramets based on

genetic distance [18] (Figure 2) showed 10 sub-cluster

branches, 8 of which grouped ramets with their ortet of

provenance while the other two sub-clusters were formed

by the off-type ramets: one by R11-1 (sub-cluster II) ini-

tially attributed to the set 7, which individualized earlier

in the dendogram, and the second, the sub-cluster III

grouping three off-types initially attributed to set 8 from

which it separated later to form two different sub-clusters.

The off-type ramet R8-2, which originally derived from

ortet 8, joined sub-cluster VII (set 3 from ortet 4).

3.2. Genetic Diversity among Ortets

All the 10 microsatellite markers used in this study

yielded amplification products. A total of 37 alleles were

detected among the 10 ortets. The mean number of al-

leles (Ao) within ortets was found to be 3.7, varying from

two for microsatellite loci mEgCIR095 and mEg-

CIR0408 to 6 for locus mEgCIR0783 (Table 5). Based

Figure 1. Electropherogram showing two peaks (or two alleles) for a heterozygote oil palm and one peak (one allele) for a

homozygote at the microsatellite marker mEgCIR0405.

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)543

Table 3. Nei & Takezaki’s

[

]

enetic distances amon

ortets and ramets.

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)

544

Values of genetic distance between an off-type and other members of these same putative set are shaded.

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)

545

Table 4. Average genetic distance within ortet-ramets sets.

Set No. Ortet Number of

ramets

Number of

off-type rametsDA

1 GBL 7 (ort8) 5 1 0.1259

2 GBL 8 (ort2) 5 0 0.0000

3 GBL 13 (ort4) 5 0 0.0000

4 GBL 18 (ort1) 5 0 0.0000

5 GBL 34C (ort6) 5 0 0.0000

6 GBL 35C (ort7) 5 0 0.0000

7 GBL 37C (ort11) 5 1 0.0834

8 GBL 39C (ort13) 5 3 0.1505

Ort1: ortet number 1, DA: Nei & Takezaki’s [18] genetic distance.

Table 5. Genetic variability parameters within ortets.

SSR loci Ao H

o H

mEgCIR0037 5.0 0.900 0.690

mEgCIR0195 2.0 0.200 0.480

mEgCIR0254 4.0 0.900 0.715

mEgCIR0257 3.0 0.700 0.595

mEgCIR0408 2.0 0.200 0.500

mEgCIR0425 3.0 0.700 0.620

mEgCIR0783 6.0 0.800 0.765

mEgCIR0790 5.0 0.700 0.765

mEgCIR0802 3.0 0.600 0.645

mEgCIR0825 4.0 0.600 0.565

Mean 3.7 0.630 0.634

on the dinucleotide composition there were two classes

of microsatellites, including perfect and compound mi-

crosatellites. No clear relation was observable between

the two classes and the number of alleles per locus in the

study. The observed heterozygosity (Ho) varied from

0.200 for SSR markers mEgCIR0195 and mEgCIR0408

to 0.900 for SSR marker mEgCIR0037 (mean = 0.630).

The expected heterozygosity (He) ranged from 0.480 for

SSR marker mEgCIR0195 to 0.765 for SSR markers

mEgCIR 0783 and mEgCIR0790 (mean = 0.634). The

values of heterozygosity obtained are not related to the

number of alleles at the microsatellite locus. Few alleles

at a locus lead to high value heterozygosity because or-

tets were heterozygote for the loci used.

4. Discussion

4.1. Ramet-to-Ortet Genetic Relationship

The high polymorphism of the microsatellite markers

used (i.e. their capacity of revealing even a single nu-

cleotide difference among DNA sequences from closely

related genotypes) allowed the detection of differences

within ortet-ramet sets. The visualization of the geno-

typic data showed that the ramet R11-1 from set No. 7

was distinct from the ortet and ramets of its putative set

as well as from the rest of the ortets and ramets studied.

In fact, this ramet got showed unique alleles and unique

genotype at certain microsatellite loci, indicating that it

was not only an off-type but also not derived from the

tissue culture. The ramets R8-2 from set No. 1 and R13-1,

R13-2, R13-3 from set No. 8 differed from those of the

rest of the members of their respective sets, showing that

they were intruders. Cochard [23] also identified ille-

gitimate genetic configurations among oil palms as a first

step of his study of the legitimacy of oil palm breeding

populations through a visual comparison of genotypic

data from a microsatellite analysis.

The genetic distance is a measure of the amount of

genetic and is useful for grouping of populations or indi-

viduals [24]. In the present study, the genetic distance

among ortets and ramets should be understood as the

degree to which the various alleles do not occur equally

in the oil palms studied. The statistic of Nei and Takezaki

[18], also known as Nei and Takezaki’s genetic distance

(DA), varies from 0 to 1 with 0 meaning total similarity

and 1 total divergence. Thus, for the sets 2, 3, 4, 5, and 6

where the within DA was zero, the ramets derived from

tissues collected from their respective ortets. The ramet

R8-2, which showed total similarity (DA = 0) to ortet and

ramets of the set No. 3, probably derived from the culture

of tissues collected from the ortet ort4. The ramets R13-1,

R13-2, and R13-3 did not derive from the ortet ort13.

Nevertheless, the genetic distance among the three

ramets was zero, suggesting that they derived from the

same ortet, one not represented in this study.

For a further understanding of the relations between

ortets and ramets, the cluster analysis yielded a dendo-

gram according to Nei and Takezaki [18]. In this den-

drogram the ramet R8-2, initially included in set no. 1, is

seen to be finally joined to the sub-cluster of its ortet of

provenance (ortet ort1). It is most likely that the ramets

R13-1, R13-2, and R13-3, whose sub-cluster is on the

same branch as the sub-cluster of its putative set 3,

probably derived from an ortet closely related to the ortet

ort13. The dendogram confirmed the uniqueness of ramet

R11-1. It has no relationship with any of the ortets used

in this study. Cochard [23] also found some incoherence

as regards the legitimacy of materials from breeding pro-

gramme via use of the software Structure which also al-

lows visualization of the relationships among oil palms

used as genitors and their putative ascendances.

According to Corley [25], the number of markers

eeded for identification purposes might be fewer than n

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)

546

Figure 2. UPGMA clusteri ng of ortets and ramets based on genetic distance over 10 SSR loci. R2-4: 4 th ramet derive d from

ortet number 2, ort2: orte t number 2, S1: ortet number 1, S1-3: 3rd ramet derive d fr om ortet number 1.

five due to their high polymorphism at the locus level.

Rajinder et al. [12] obtained satisfactory separation of six

ortet-ramet sets using five SSR loci. Limitation of the

number of SSR markers to be used for clonal identifica-

tion and detection of off-types to 5 is justified given the

tedious nature of the procedure for the development of

SSR markers in general and particularly for oil palm. The

procedure involves the building of microsatellite-en-

riched genomic libraries, following a hybridization-based

capture methodology using labeled microsatellite oligo-

probes and sequencing of microsatellite-containing se-

quences [26]. Another concern is with the related high

cost of SSR marker development. Nowadays, with the

availability of the oil palm genome sequence, microsatel-

lite motives are identified through bioinformatics data

mining and primers designed accordingly, easing the

development of SSR markers and reducing its cost. Fur-

thermore, microsatellites are amenable to high-through-

put from DNA extraction to the scoring of amplicons so

that large numbers of markers can be analysed with large

numbers of samples. Comparing genotypes at 10 SSR

loci representing 7 linkage groups (or chromosomes) out

of 16 would be more comprehensive because they cover

almost half of the oil palm genome.The set of SSR

markers used demonstrated a strong capacity for identi-

fying off-type ramets, so it can contribute to the certifica-

tion of the purity of commercial clonal planting materials.

In fact, culture mixtures inevitably happen, given the

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)547

large number of cultures handled in the tissue culture

laboratory [12]. Thus, the success of the 10 SSR loci

used in showing ramet-to-ortet relationships and clear

identification of off-type ramets confirms the main ex-

pectation of the study.

4.2. Genetic Variability within Ortets’ Clonal

Progenies

Clonal progenies are duplicates of an ortet. Thus, the

genetic variability within ortets well reflects the genetic

variability among their clonal progenies. The average

number of alleles (Ao) per locus is one of the genetic di-

versity measures commonly used. The Ao found among

the 10 ortets studied is relatively high. In a previous as-

sessment of the number of alleles per locus over 21 ac-

cessions of oil palms from 7 African countries and one

Deli dura using 21 microsatellite loci, the Ao was equal

to 5.3 [17]. Bakoume et al. [27], using 16 SSR markers,

obtained 13.1 alleles per locus over 494 oil palms repre-

senting 45 native oil palm populations from 10 African

countries, three breeding populations and one semi-wild

collection material. A lower value of Ao found in the 10

ortets, all of tenera oil palm type, could have been ex-

pected. In fact, both the dura and the pisifera, parents of

the hybrid (tenera), have a narrow basic allelic diversity.

Dura populations (female parents) trace their descent to

only four original palms introduced in 1848 in Bogor,

Indonesia [28]. Pisifera populations (pollen donors) are

derived from only two palms, notably SP540T “Djongo”,

the best selected in the Palmeraie de la Rive at Eala,

Democratic Republic of Congo. Furthermore, selection

carried out over years in both the dura and pisifera

populations has led to inbreeding and elimination of cer-

tain alleles. However, it should be noted that the rela-

tively low Ao value detected in the present study could

also be related to the small number of ortets available.

Despite the low mean number of alleles per locus, the

values of observed (Ho) and expected (He) heterozygosi-

ties were 0.630 and 0.634, respectively. The He value

was 0.68 within 21 accessions of oil palm belonging to 7

African countries using 21 SSR markers [17] and, using

16 SSR markers, 0.644 within 49 natural oil palms

populations from Africa, breeding populations, and semi-

wild material [27]. Despite the low mean number of al-

leles per locus, the value of He found in this study could

be considered high. This value is congruent with breed-

ers’ objective of getting as high heterogosity as possible

in tenera hydrids released to oil palm growers. A high

value of He implies high heterosis on which oil palm

yield depends.

The high He value found among ortets should be ex-

pected among their clonal progenies. The high genetic

diversity found in oil palm can explain its plasticity as

regards its adaptation to various environments and to its

actual large distribution area [29]. Some of the heterotic

allelic combinations existing in the ortets may improve

the synthesis of more flavonoids, which are compounds

that stop or kill pathogens in oil palm [30]. Hence,

blending of different oil palm clones during planting in

the field may contribute to controlling environmental

constraints, including diseases, which are real threats to

oil palm plantations, regardless of the continent on which

they are found.

5. Conclusions

The set of 10 microsatellite markers used in the study

successfully traced the ramet-to-ortet relationship and

identified off-type ramets. They should be routinely used

to verify ramet-to-ortet identity and detect off-type oil

palm clones produced by Sime Darby’s tissue culture

laboratory. The 10 microsatellite markers also revealed a

high level of genetic diversity among ortets, which

should be expected among their clonal progenies.

6. Acknowledgements

The authors would like to express their deepest gratitude

to Sime Darby Plantation Sdn Bhd for allowing the pub-

lication of this work.

REFERENCES

[1] N. Rajanaidu and A. Kushairi, “Strategies for the Devel-

opment of Future Oil Palm Planting Materials,” Paper

Presented at ISOPB Seminar on the Progress of Oil Palm

Breeding and Selection, Medan, 6-9 October 2003.

[2] S. Mayes, F. Hafeez, Z. Price, D. MacDonald, N. Billotte

and J. Roberts, “Molecular Research in Oil Palm, the Key

Oil Crop for the Future,” In: P. H. Moore and R. Ming,

Eds., Genomics in Tropical Crop Plants, Nottingham

University Press, Nottingham, 2008, pp. 371-404.

doi:10.1007/978-0-387-71219-2_15

[3] G. Van Der Linden, S. A. Sharifah, G. Angenent, S. C.

Cheah and R. Smulders, “Molecular Characterization of

Flower Development in Oil Palm in Relation to the Man-

tling Abnormality,” Proceedings MPOB 2001 Interna-

tional Palm Oil Congress―Agriculture, Kuala Lumpur,

2005, pp. 531-549.

[4] V. Le Guen, G. Samaritaan, Z. Othman, C. W. Chin, K. E.

Konan and T. Durand-Gasselin, “Oil Production in

Young Oil Palm Clones,” Oleagineux, Vol. 46, 1991, pp.

347-359.

[5] Y. Duval, P. Amblard, A. Rival, E. Konan, S. Gogor and

T. Durand-Gasselin, “Progress in Oil Palm Tissue Culture

and Clonal Performance in Indonesia and Côte d’Ivoire,”

Proceedings ISP Conference Plantation Management for

21st Century, Kuala Lumpur, 1997, pp. 291-307.

[6] A. B. Maheran and O. Abu Zarin, “Felda’s Experience in

Clonal Oil Palm Planting on Inland Soils,” Proceedings

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)

548

of the PORIM Oil Palm Congress, Kuala Lumpur, 1999,

pp. 330-343.

[7] A. C. Soh, Y. Y. Yong, Y. W. Ho and N. Rajanaidu,

“Commercial Potential of Oil Palm Clones: Early Results

of Their Performances,” In: V. Rao, I. E. Henson and N.

Rajanaidu, Eds., Recent Developments in Oil Palm Tissue

Culture and Technology, Palm Oil Research Institute of

Malaysia, Kuala Lumpur, 1995, pp. 134-144.

[8] A. C. Soh, G. Wong, C. C. Tan, P. S. Chew, T. Y. Hor, S.

P. Chong and K. Gopal, “Recent Advances towards Com-

Mercial Production of Elite Oil Palm Clones,” Proceed-

ings of the MPOB 2001 International Palm Oil Con-

gress―Agriculture, Kuala Lumpur, 2001, pp. 33-44.

[9] C. J. Eeuwens, S. Lord, C. R. Donough, V. Rao, G.

Vallejo and S. Nelson, “Effects of Tissue Culture Condi-

Tions during Embryoid Multiplication on the Incidence of

‘Mantled’ Flowering in Clonal Propagated Oil Palm,”

Cell Plant, Tissue Organ Culture, Vol. 70, 2002, pp.

311-323. doi:10.1023/A:1016543921508

[10] S. Jouannic, X. Argout, F. Lechauve, C. Fizames, A.

Borgel, F. Morcillo, F. Aberlec-Bertossi, Y. Duval and J.

W. Tregear, “Analysis of Expressed Sequence Tags from

Oil Palm (Elaeis guineensis),” FEBS Letters, Vol. 579,

2005, pp. 2709-2714. doi:10.1016/j.febslet.2005.03.093

[11] A. C. Soh, G. Wong, C. C. Tan, T. Y. Hor and C. K.

Wong, “Revisited: Cloning Seedling of Reproduced Best

Dxp Cross Strategy,” Paper Presented at ISOPB Seminar

on the Progress of Oil Palm Breeding and Selection,

Medan, 6-9 October 2003.

[12] S. Rajinder, N. Jayanthi, T. Soon-Guan, M. P. Jothi and S.

C. Cheah, “Development of Simple Sequence Repeat

(SSR) Markers for Oil Palm and Their Application in

Genetic Mapping and Fingerprinting of Tissue Culture

Clones,” Asia Pacific Journal of Molecular Biology and

Biotechnology, Vol. 15, 2007, pp. 121-131.

[13] M. Delseny, M. Laroche and P. Penon, “Detection of

Sequences with Z-DNA Forming Potential in High

Plants,” Biochemical and Biosphysical Research Com-

mununications, Vol. 116, 1983, pp. 113-120.

doi:10.1016/0006-291X(83)90388-1

[14] W. Amos, S. J. Sawcer, R. W. Feakes and D. C.

Rubinsztein, “Microsatellites Show Mutational Bias and

Heterozygote Instability,” Nature Genetics, Vol. 13, 1996,

pp. 390-391. doi:10.1038/ng0896-390

[15] J. S. C. Smith, E. C. L. Chin, H. Shu, O. S. Smith, S. J.

Wall, M. L. Senior, S. E. Mitchel, S. Kresovich and J.

Ziegle, “An Evaluation of the Utility of SSR Loci as Mo-

Lecular Markers in Maize (Zea mays L.), Comparisons

with Data from RFLPs and Pedigree,” Theoretical and

Applied Genetics, Vol. 95, 1997, pp. 163-173.

doi:10.1007/s001220050544

[16] J. Doyle and L. Doyle, “Isolation of Plant DNA from

Fresh Tissue,” Focus, Vol. 12, 1990, pp. 13-15.

[17] N. Billotte, N. A. M. Risterucci, E. Barcelos, L. Noyer, P.

Amblard and F. C. Baurens, “Development, Characterisa-

tion, and Across-Taxa Utility of Oil Palm (Elaeis

guineensis Jacq.) Microsatellite Markers,” Genome, Vol.

44, 2001, pp. 413-425.

[18] M. Nei and N. Takezaki, “Estimation of Genetic Dis-

tances and Phylogenetic Trees from DNA Analysis,”

Proceedings of the 5th World Congress on Genetics. Ap-

plied to Livestock Production, Vol. 21, 1983, pp. 405-

412.

[19] P. H. A. Sneath and R. R. Sokal, “Numerical Taxonomy,”

W. H. Freeman Press, San Francisco, 1973.

[20] B. S. Weir, “Genetic Data Analysis II,” MA: Sinauer As-

sociates, Inc., Sunderland, 1996.

[21] M. Nei, “Analysis of Gene Diversity in Subdivided

Populations,” Proceedings of the National Academy of

Science of the USA, Vol. 70, 1973, pp. 3321-3323.

doi:10.1073/pnas.70.12.3321

[22] K. Liu and S. V. Muse, “PowerMarker: Intergrated

Analysis Environment for Genetic Marker Data,” Bioin-

formatics, Vol. 21, 2005, pp. 2128-2129.

doi:10.1093/bioinformatics/bti282

[23] B. Cochard, “Etude de la Diversité Génétique et du

Déséquilibre de Liaison au Sein de Populations

Améliorées de Palmier à Huile (Elaeis guineensis Jacq.),”

Ph.D. Dissertation, SUPAGRO, Montpellier, 2008.

[24] F. C. Yeh, “Population Genetics,” In: A. Young, D. Bosh-

ier and T. Boyle, Eds., Forest Conservation Genetics:

Principles and Practice, CSIRO Publishing, Collingwood,

2000, pp. 21-37.

[25] R. V. H. Corley, “Illegitimacy in Oil Palm Breeding,”

Journal of Oil Palm Research, Vol. 17, 2005, pp. 64-69.

[26] N. Billotte, P. J. L. Lagoda, A. M. Risterucci and F. P.

Baurens, “Microstellite-Enriched Libraries: Applied

Methodology for the Development of SSR Markers in

Tropical Crops,” Fruits, Vol. 54, 1999, pp. 277-288.

[27] C. Bakoumé, R. Wickneswari, N. Rajanaidu, A. Kushairi,

P. Amblard and N Billotte, “Allelic Diversity of Natural

Oil Palm (Elaeis guineensis Jacq.) Populations Detected

by Microsatellite Markers: Implication in Conservation,”

Plant Genetic Resources Characterization and Utilization,

Vol. 5, 2007, pp. 104-107.

doi:10.1017/S1479262107710870

[28] C. W. S. Hartley, “The Oil Palm (Elaeis guineensis

Jacq.),” Longman Scientific and Technical, New York,

1988.

[29] C. Bakoumé, “Genetic Diversity of Natural Oil Palm

(Elaeis guineensis Jacq.) Populations Using Microsatel-

lite Markers,” unpublished Ph.D. dissertation, Universiti

Kebangsaan Malaysia, Bangi, 2006.

[30] S. Diabate, H. De Franqueville, D. Allou, K. E. Konan, O.

A. Coulibaly and W. P. N’Guessan, “Phenolic Diversity

in the Defense Reaction of the Oil Palm against Vascular

Wilt Disease,” Proceedings of the 2009 International

Palm Oil Congress on Palm Oil: Balancing Ecologics

with Economics, Kuala Lumpur, 2009, pp. 1027-1034.