American Journal of Plant Sciences, 2011, 2, 461-466
doi:10.4236/ajps.2011.23054 Published Online September 2011 (http://www.SciRP.org/journal/ajps)
Copyright © 2011 SciRes. AJPS
461
Genetic Diversity of the Pepper Pathogen
Phytophthora capsici on Farms in the
Amazonian High Jungle of Peru
Jon Hulvey1, Oscar Hurtado-Gonzalez3, Liliana Aragón-Caballero4, Daniel Gobena2, Dylan Storey2,
Ledare Finley5, Kurt Lamour5
1Department of Plant, Soil, and Insect Sciences, University of Massachusetts, Amherst, USA; 2Genome Science and Technology
Graduate Program, University of Tennessee, Knoxville, USA; 3Pioneer Hi-Bred International Inc., Johnston, USA; 4Department of
Phytopathology, National Agrarian University-La Molina, Lima, Peru; 5Department of Entomology and Plant Pathology, University
of Tennessee, Knoxville, USA.
Received June 27th, 2011; revised July 7th, 2011; accepted July 15th, 2011.
ABSTRACT
Phytophthora capsici is an important oomycete pathogen of Capsicum peppers worldwide. Populations of P. capsici
recovered from coastal regions in Peru were previously shown to be dominated by a single clonal lineage referred to as
PcPE-1. During 2008, 219 isolates of P. capsici were collected from Capsicum pubescens (Rocoto), C. annum (Pi-
mento), and C. baccatum (Aji) at 9 farms in the Amazonian high jungle in the areas surrounding Oxapampa, and one
coastal location, Carabayllo. Two isolates of P. capsici were also recovered from Cyclanthera pedata (Caigua fruit)
near one field. All isolates were characterized using a panel of eight single nucleotide polymorphism (SNP) markers
that are fixed for heterozygosity in the PcPE-1 lineage. A subset of isolates was also characterized using amplified
fragment length polymorphism (AFLP) markers. Nine discreet SNP multi-locus genotypes were identified, and the
PcPE-1 lineage was recovered from all of the field sites. Both A1 and A2 mating types were recovered from two sites.
The implications of the genotypic diversity and distribution identified in this study are discussed.
Keywords: Population Genetics, DNA Markers, Clonality, Asexual Reproduction, Sexual Reproduction
1. Introduction
Phytophthora capsici is an important pathogen of vege-
table crops such as tomato, pepper, cucumber and squash
and more recently snap bean [1-3]. Infestations of Phy-
tophthora capsici on annual crops typically require warm
and wetter than average conditions, and can spread rap-
idly due to the production of asexually produced decidu-
ous sporangia and motile zoospores [4]. In North Amer-
ica, sexual recombination and the production of the thick
walled oospore is common and dormant oospores may
persist in the soil for years. For North American popula-
tions, the combination of asexual and sexual reproduc-
tion affords P. capsici the benefits of both explosive
clonal reproduction and the high genetic variation gener-
ated by sexual recombination [4]. Characterizing geno-
typic diversity plays an important role in determining
whether the asexual or sexual portion of the Phy-
tophthora life cycle is driving the epidemiology of the
pathogen. A number of techniques have been utilized to
assess genotypic diversity in Phytophthora (e.g. ampli-
fied fragment length polymorphism (AFLP), microsatel-
lite (SSR), and isozyme markers) and more recently, sin-
gle nucleotide polymorphisms (SNPs) have provided
useful markers for characterizing field isolates [5-7].
The population structure of P. capsici from fields in
the US includes considerable genotypic diversity, along
with the presence of both mating types [6,8,9]. It appears
that the winter (or fallow) season imposes an effective
selection pressure favoring the oospore for survival of
the pathogen. Populations of P. capsici from pepper fields
in Peru display a much different genotypic makeup, with
only three genotypes documented and a single clonal
lineage of the A2 mating type (designated PcPE-1)
dominating pepper and tomato fields in coastal Peru [10].
In some cases, cropping in the coastal area of Peru in-
cludes pepper production year round as well as irrigation
from common river systems. In these areas, the irrigation
strategy and the availability of host material may explain
Genetic Diversity of the Pepper Pathogen Phytophthora capsici on Farms in the Amazonian High Jungle of Peru
462
the widespread occurrence of PcPE-1, as surface waters
have been shown to harbor abundant populations of P.
capsici [11].
Our objective was to determine if epidemic popula-
tions of P. capsici from locations further inland across
the Andes Mountains and into the Amazon rainforest
harbored the PcPE-1 clonal A2 genotype, or if evidence
of a more heterogeneous population structure character-
istic of North American P. capsici populations could be
detected.
2. Materials and Methods
2.1. Collection and Culturing
Isolates were collected from eleven pepper fields in Peru
during May 2008. These include nine fields surrounding
Oxapampa, Peru, one field in Azucazu, just north of
Oxapampa, and one field located on the coast in Cara-
bayllo (Figure 1). The nine fields surrounding Oxa-
pampa span a total of approximately 200 km2, and all
fields in total span a distance of 400 km, from Azucazu
to Carabayello. Isolates were obtained by plating small
sections of infected fruit, crown, or root material of Cap-
sicum spp. on V8-PARP agar medium (40 ml V8 juice, 3
g CaCO3, 16 g Bacto agar and 960 ml water amended
with 25 ppm pimaricin, 100 ppm ampicillin, 25 ppm ri-
fampicin, and 25 ppm pentachloronitrobenzene). Plates
were observed daily and single hyphal tips recovered
from expanding colonies. A single isolate was recovered
per plant and used in the subsequent analyses.
2.2. Mating Type and DNA Extraction
Mating type determination was accomplished using P.
capsici A1 and A2 tester isolates (CBS121656 and
CBS121657, respectively). Seven millimeter agar discs
from the leading edge of colonies of tester and query
isolates were plated together onto dilute V8-PARP plates.
After 7 to 14 days, the colony intersection was excised,
slide mounted and observed microscopically. The pres-
ence or absence of oospores was then determined by light
microscopy observation at 400X magnification. DNA
was produced by 1) growing mycelium in V8 PARP
broth for 7 days; 2) lyophilizing the harvested mycelium;
and 3) extracting high molecular weight DNA from the
pulverized dried mycelium according to the methods
outlined previously [12].
2.3. SNP Genotyping Using DNA Melting
Analysis
Eight high resolution DNA melting analysis (HR-DMA)
assays were optimized to resolve SNP genotypes at loci
heterozygous within single genes of the PcPE-1 clonal
lineage. The assays were designed to differentiate ho-
mozygote and heterozygote alleles. Marker loci were
chosen from an expressed sequence tag (EST) library of
the P. capsici genome, and these genes were re-se-
quenced in a PcPE-1 representative isolate (LT2135). A
single heterozygous SNP was targeted from each of the
eight genes. Primers were designed using the LightScan-
ner primer design software (Idaho Technologies, Salt
Lake City, UT) to amplify a 45 - 65 bp amplicon that
spanned a single heterozygous site (See Table 1 for
primer sequences). PCR reactions for DMA consisted of
4 μl Lightscanner Mastermix (Idaho Technologies, Salt
Lake City, UT), 1 μl of genomic DNA at 10 to 20 ng/μl,
and 1 μl of each primer at 2.5 μM conc. The PCR tem-
perature protocol was as follows: initial denaturation at
95 C for 2 min, then 45 cycles of 95 C for 30 s and 64 C
for 30 s, and then a final step of 95 C for 30 s followed
by 28 C for 30 s. HR-DMA was performed according to
manufacturer’s instructions using a 384 well format
Lightscanner instrument (Idaho Technologies, Salt Lake
City, UT). All assays were repeated to ensure reproduci-
bility. Data analysis and normality parameters were ad-
justed using LightScanner 2.0 software. DNA sequencing
of an isolate representing each of the DMA melt curve
types was performed to confirm genotypes. Known iso-
lates of the PcPE-1 clonal lineage were included in all
assays to detect the presence of the clonal lineage.
Figure 1. Map of collection sites surrounding Oxapampa.
Sites are numbered 1 through 9. Inset is Peru map, with
Oxapampa marked with a black dot.
Copyright © 2011 SciRes. AJPS
Genetic Diversity of the Pepper Pathogen Phytophthora capsici on Farms in the Amazonian High Jungle of Peru
Copyright © 2011 SciRes. AJPS
463
Table 1. Summary information for high resolution DNA melting analysis markers.
Locus IDa Genbank accession Base pair of SNPb SNP Forward Primer/Reverse Primer
Flc3 BTO32098 2010 T/C
GCCCAAGTAGCAAAGCTCA/
GTCCACAGCGATGGTCT
Flc12 BTO31712 2137 C/T
TATCCTCCACGTACTCGAAG/
AGGTTGCTCAGGTGATG
Flc18 BTO32197 3395 T/C
GCACCTCTTCTGTGCAG/
GTCGTCTGGTCTTCACTTG
Flc19 BTO31656 2831 C/T
CATCATGCACCATGAGTTTG/
CCTTCTTACCGTCTTCGT
Flc23 BTO31999 1048 C/T
TCTGACGATGCTGTCCC/
TTCGTTCCTTAACGCCG
Flc24 BTO32352 989 C/T
ATCCTGGACATGGACCC/
CAGGTACAGGTGCCTCA
Flc29 BTO31539 684 C/A
AATGACCCGAACGAAGT/
GAAATAGCTGAAGAAATGCTCC
Flc34 BTO31610 1773 G/T
CGCCCCTGTATCAGAAG/
CACGCGTCCTTGCTTAC
aInformal locus identifiers; bBase pair number of polymorphic site from the 5’ end of the Genbank sequence.
2.4. AFLP Analyses
Amplified Fragment Length Polymorphism (AFLP) ana-
lysis was performed using Eco RI, and MseI restriction
enzymes, adapters, and polymerase chain reaction (PCR)
amplification primers following the method of [13]. Se-
lective PCR amplifications were performed with Eco-CG
and Mse-CG primer pairs. Amplicons were fluorescently
labeled in separate reactions following the method of
[14], and the resultant fluorescently labeled amplicons
were resolved by a Beckman-Coulter CEQ8000 capillary
genetic analysis instrument. Fragment peaks were manu-
ally confirmed, and peaks between 100 and 600 base
pairs in size were manually scored for presence or ab-
sence.
3. Results
A total of 219 isolates were recovered from infected
plants at the eleven locations sampled (Figure 1, Ta ble
2). Isolates of A2 mating type were recovered from all
fields.
Table 2. Isolate summary information.
Locationa Hosts No. isolates Mating Type
Field 1* C. pubescens 60 A2
Field 2 C. pubescens
C. baccatum 18 A2 (8), A1 (10)
Field 3 C. pubescens,
C. baccatum 12 A2 (6), A1 (6)
Field 4* C. baccatum 7 A2
Field 5* C. pubescens 2 A2
Field 6* C. pubescens 2 A2
Field 7* C. pubescens 33 A2
Field 8 C. pubescens 1 A2
Field 9* C. pubescens,
Cyclanthera pedata 66 A2
Acuzazu C. pubescens 8 A2
Carabayllo C. annum 14 A2
aAll isolates were of the PcPE-1 genotype.
Genetic Diversity of the Pepper Pathogen Phytophthora capsici on Farms in the Amazonian High Jungle of Peru
464
Seven percent of the isolates were of the A1 mating
type, originating from only two fields (Table 2). The
majority of isolates (166) were recovered from rocoto
(Figure 2), with fewer isolates from Aji (37), Pimento
(14), and Caigua (2) (Table 2). The isolates were found
to comprise nine genotypes based on the multi-locus
SNP genotyping (Tables 3 and 4). These included the
genotypes PcPE-1, PcPE-2, and PcPE-3 previously iden-
tified from samples recovered at more coastal locations
(e.g. west of the Andes Mountains) [10] (Tables 3, 4).
AFLP fingerprinting resulted in the identification of 50
informative bands. All 48 of the isolates analyzed using
AFLP had identical PcPE-1 genotypes and the SNP typ-
ing confirmed that all isolates were fixed for heterozy-
gosity at all 8 loci assayed. The PcPE-1 genotype was
recovered from all eleven fields, and comprised 75% of
all isolates collected, whereas, isolates of the remaining
eight additional genotypes each comprised less than 10%
of the total isolates (Table 3).
4. Discussion
Our objective was to determine if the PcPE-1 clonal
lineage was also present at sites on the eastern side of the
Andes Mountains where peppers (primarily “rocoto”, C.
pubescens) are often grown on smaller plots. Samples
were collected in March of 2008 shortly after the rainy
season ended. The plants had mature fruit and the pepper
harvest was ongoing. Although isolates of P. capsici
were recovered from C. baccatum, C. annum, and what is
known as the wild cucumber (Cyclan thera pedata), most
of the isolates were recovered from infected fruit of ro-
coto. The rocoto fruit has a thick waxy cuticle which
becomes detached during the infection process, and is
referred to as the “pealing pealing” disease in the areas
around Oxapampa (Figure 2).
Figure 2. (Top) Rocoto fruit infected with Phytophthora
capsici and (Bottom) Healthy Rocoto fruit.
Table 3. Summary of the distribution of Phytophthora capsici genotypes.
Genotype Mating Type Host(s) Locations Number of isolates (percent of total)
PcPE-1 A2 C. pubescens, C. ann um,
C. baccatum, Cyclanthera sp. 1-7, Azucazu, Carabayllo 134 (61)
PcPE-2 A2 C. pubescens 1 9 (4)
PcPE-3 A2 C. pubescens 7 20 (9)
PcPE-4 A2 C. pubescens 3, 7, 9 2 (1)
PcPE-5 A2 C. pubescens, C. baccatum 9 18 (8)
PcPE-6 A2 C. pubescens, C. baccatum 9 12 (6)
PcPE-7 A2 C. pubescens, C. baccatum 9 7 (3)
PcPE-8 A1 C. pubescens 2, 3 10 (5)
PcPE-9 A1 C. pubescens 2, 3 7 (3)
Copyright © 2011 SciRes. AJPS
Genetic Diversity of the Pepper Pathogen Phytophthora capsici on Farms in the Amazonian High Jungle of Peru465
Table 4. Summary of SNP genotypes for nine clonal lineages of Phytophthora capsici recovered from Peru.
Genotype FL3a FL12 FL18 FL19 FL23 FL24 FL29 FL34
PcPE-1 G/A C/T A/C G/A G/A C/T G/T A/C
PcPE-2 A/A C/T A/C G/A G/A C/T G/T A/C
PcPE-3 G/A C/T A/C G/A G/A C/C G/G A/C
PcPE-4 G/A C/T A/C G/G G/A C/C G/G A/C
PcPE-5 G/A C/T C/C G/A A/A C/C G/G A/C
PcPE-6 G/A C/T C/C G/A G/G C/C G/G A/C
PcPE-7 G/A C/T C/C G/A G/G C/C G/G A/A
PcPE-8 A/A C/C A/C G/G G/A C/C G/T A/A
PcPE-9 G/G C/C A/C G/G G/A C/C G/T A/A
aMarker details are listed in Table 1.
In contrast to some of the areas sampled along the
coast (e.g. along the Supe River), none of the sites were
irrigated by a common river source. All of the sites were
located at relatively steep areas of the cloud forest where
the forest and undergrowth had been cut and burned or
manually cleared. The farmers indicated that individual
rocoto plants had often been productive for up to 5 years
prior to an increase of the “pealing pealing” disease over
the past 3 to 4 years. The current strategy to combat the
disease is to clear new forest every 1 to 2 years due to an
increase in the prevalence of the disease. Our results in-
dicate that the PcPE-1 clonal genotype is a prevalent
member of the population structure of P. capsici in the
areas surrounding Oxapampa. The PcPE-1 lineage was
recovered from all of the hosts sampled and was present
at every location. Although PcPE-1 is the most frequent,
interestingly, we also recovered two clonal lineages of
the A1 mating type (PcPE-8 and PcPE-9) which were
present at two different locations. Tests are underway to
determine the fecundity of crosses between these A1
lineages and the dominant PcPE-1 lineage. Preliminary
observations indicate that crosses produce normally
formed oospores but recovery of progeny and genotypes
has yet to be attempted.
Clearly clonal reproduction is driving population
structures in the areas surrounding Oxapampa. Due to the
limited number of unique genotypes it is difficult to as-
sess the importance of sexual recombination—although
the allelic combinations resolved via the SNP typing in-
dicate that sexual recombination may have played a role
in generating at least some of the observed genotypic
variation. Similar to some of the coastal areas where
pepper is produced, there is susceptible host material
(pepper and caigua) throughout the year and there is
likely limited selection pressure working against the sur-
vival and spread of clonal lineages. How the PcPE-1
lineage has become so widespread is difficult to assess as
there is very little genotypic diversity. It may be that a
single clonal lineage has been dispersed throughout Peru
by the exchange of infected plant material or seed, as is
seen with many economically important Phytophthora
pathogens, such as P. ramorum, P. infestans, and other
oomycete pathogens [15-17].
Although the genotypic diversity was higher in this re-
gion than the coastal areas, it is still much lower than
findings for P. capsici in North America [6,9,18]. The
PcPE-1 genotype was also isolated from Cyclanthera
pedata in the nearby cloud forest of one field, indicating
this host may be an important reservoir for P. capsici in
the surrounding Amazon. This is not surprising as Phy-
tophthora capsici has also been reported to infect weedy
plants such as American black nightshade and Purslane
in the US near vegetable farms [19]. The finding of lim-
ited genotypic diversity throughout Peru indicates that
the strategic deployment of tolerant or resistant pepper
germplasm may be effective in reducing the overall sig-
nificance of this important disease.
REFERENCES
[1] A. J. Gevens, R. S. Donahoo, K. H. Lamour and M. K.
Hausbeck, “Characterization of Phytophthora capsici
Causing Foliar and Pod Blight of Snap Bean in Michi-
gan,” Plant Disease, Vol. 92, No. 2, 2008, pp. 201-209.
doi:10.1094/PDIS-92-2-0201
[2] C. R. Davidson, R. B. Carroll, T. A. Evans, R. P. Mul-
rooney and S. H. Kim, “First Report of Phytophthora
capsici Infecting Lima Bean (Phaseolus lunatus) in the
Mid-Atlantic Region,” Plant Disease, Vol. 86, No. 9,
2002, pp. 1049-1049. doi:10.1094/PDIS.2002.86.9.1049A
Copyright © 2011 SciRes. AJPS
Genetic Diversity of the Pepper Pathogen Phytophthora capsici on Farms in the Amazonian High Jungle of Peru
466
[3] D. C. Erwin and O. K. Ribeiro, “Phytophthora Diseases
Worldwide,” APS Press, St. Paul, 1996.
[4] K. Lamour and S. Kamoun, “Oomycete Genetics and
Genomics: Diversity, Interactions, and Research Tools,”
Wiley-Blackwell, Hoboken, 2009.
[5] D. P. Garnica, A. M. Pinzon, L. M. Quesada-Ocampo, A.
J. Bernal, E. Barreto, N. J. Grunwald and S. Restrepo,
“Survey and Analysis of Microsatellites from Transcript
Sequences in Phytophthora Species: Frequency, Distribu-
tion, and Potential as Markers for the Genus,” BMC Ge-
nomics, Vol. 7, 2006, p. 245.
doi:10.1186/1471-2164-7-245
[6] A. R. Dunn, M. G. Milgroom, J. C. Meitz, A. McLeod, W.
E. Fry, M. T. McGrath, H. R. Dillard and C. D. Smart,
“Population Structure and Resistance to Mefenoxam of
Phytophthora capsici in New York State,” Plant Disease,
Vol. 94, No. 12, 2010, pp. 1461-1468.
doi:10.1094/PDIS-03-10-0221
[7] F. Niepold, “Application of the SNP-Analysis for Char-
acterization of Phytophthora infestans Isolates,” Nachri-
chtenblatt des Deutschen Pflanzenschutzdienstes, Vol. 57,
No. 9, 2005, pp. 183-187.
[8] K. H. Lamour and M. K. Hausbeck, “Investigating the
Spatiotemporal Genetic Structure of Phytophthora capsici
in Michigan,” Phytopathology, Vol. 91, No. 10, 2001, pp.
973-980.
[9] K. H. Lamour and M. K. Hausbeck, “The Dynamics of
Mefenoxam Insensitivity in a Recombining Population of
Phytophthora capsici Characterized with Amplified Frag-
ment Length Polymorphism Markers,” Phytopathology,
Vol. 91, No. 6, 2001, pp. 553-557.
[10] O. Hurtado-Gonzales, L. Aragon-Caballero, W. Apaza-
Tapia, R. Donahoo and K. Lamour, “Survival and Spread
of Phytophthora capsici in Coastal Peru,” Phytopathology,
Vol. 98, No. 6, 2008, pp. 688-694.
[11] A. J. Gevens, R. S. Donahoo, K. H. Lamour and M. K.
Hausbeck, “Characterization of Phytophthora capsici from
Michigan Surface Irrigation Water,” Phytopathology, Vol.
97, No. 4, 2007, pp. 421-428.
[12] K. Lamour and L. Finley, “A Strategy for Recovering
High Quality Genomic DNA from a Large Number of
Phytophthora Isolates,” Mycologia, Vol. 98, No. 3, 2006,
pp. 514-517.
[13] P. Vos, R. Hogers, M. Bleeker, M. Reijans, T. Vandelee,
M. Hornes, A. Frijters, J. Pot, J. Peleman, M. Kuiper and
M. Zabeau, “AFLP: A New Technique for DNA-Finger-
printing,” Nucleic Acids Research, Vol. 23, No. 21, 1995,
pp. 4407-4414. doi:10.1093/nar/23.21.4407
[14] L. Habera, N. Smith, R. Donahoo and K. Lamour, “Use
of a Single Primer to Fluorescently Label Selective Am-
plified Fragment Length Polymorphism Reactions,” Bio-
techniques, Vol. 37, No. 6, 2004, pp. 902-904.
[15] W. E. Fry, S. B. Goodwin, A. T. Dyer, J. M. Matuszak, A.
Drenth, P. W. Tooley, L. S. Sujkowski, Y. J. Koh, B. A.
Cohen, L. J. Spielman, K. L. Deahl, D. A. Inglis and K. P.
Sandlan, “Historical and Recent Migrations of Phytoph-
thora infestans: Chronology, Pathways, and Implications,”
Plant Disease, Vol. 77, No. 7, 1993, pp. 653-661.
doi:10.1094/PD-77-0653
[16] E. Stokstad, “Nurseries May Have Shipped Sudden Oak
Death Pathogen Nationwide,” Science, Vol. 303, No.
5666, 2004, p. 1959.
[17] E. Hansen, “Alien Forest Pathogens: Phytophthora Spe-
cies Are Changing the World Forests,” Boreal Environ-
ment Research, Vol. 13, 2008, pp. 33-41.
[18] K. H. Lamour and M. K. Hausbeck, “The Spatiotemporal
Genetic Structure of Phytophthora capsici in Michigan
and Implications for Disease Management,” Phytopa-
thology, Vol. 92, No. 6, 2002, pp. 681-684.
[19] R. D. French-Monar, J. B. Jones and P. D. Roberts, “Cha-
racterization of Phytophtho ra capsici Associated with Roots
of Weeds on Florida Vegetable Farms,” Plant Disease , Vol.
90, No. 3, 2006, pp. 345-350. doi:10.1094/PD-90-0345
Copyright © 2011 SciRes. AJPS