Pharmacology & Pharmacy, 2011, 2, 151-158
doi:10.4236/pp.2011.23021 Published Online July 2011 (http://www.scirp.org/journal/pp)
Copyright © 2011 SciRes. PP
151
Characterization of Bucolome N-Glucuronide
Formation: Tissue Specificity and Identification of
Rat UDP-Glucuronosyltransferase Isoform(s)
Humihisa Kanoh1, Makiko Tada1, Shinichi Ikushiro2, Kiminori Mohri1*
1Clinical Pharmaceutics Laboratory, Department of Pharmacy and Health Sciences, Faculty of Pharmacy and Pharmaceutical Sci-
ences, Meiji Pharmaceutical University, Kiyose-shi, Tokyo, Japan; 2Department of Biotechnology, Faculty of Engineering, Toyama
Prefectural University, Imizu, Toyama, Japan.
Received March 3rd, 2011; revised March 30th, 2011; accepted May 24th, 2011.
ABSTRACT
Bucolome N-glucuronide (BCP-NG, main metabolite of bucolome (BCP) is the first N-glucuronide of barbituric acid
derivatives isolated from rat bile. The objective of this study wa s to identify the ma in tissue producing BCP-NG and the
molecular species of BCP-NG-producing UGT. Four target tissues were investigated: the liver, small and large intes-
tines, and kidney. To identify the UGT molecular species responsible for BCP-NG formation, yeast microsomes ex-
pressing each rat UGT isoform were prepared. BCP-NG formation was detected in all microsomal fractions of the 4
tissues. The liver microsomal BCP-NG-producing activity was the highest, followed by that in the small intestinal mi-
crosomes, showing about 41% of the liver microsomal activity level. BCP-NG-producing activity (min-1) was deter-
mined in yeast microsomal fractions expressing rat UGT isoforms, and the activity was detected in UGT1A1 (0.059),
UGT1A2 (0.318), UGT1A3 (0.001), UGT1A7 (0.003), UGT2B1 (0.004), UGT2B3 (0.091), and UGT2B6 (0.031), show-
ing particularly high levels for UGT1A1 and UGT1A2 among the UGT1A isoforms. It was clarified that UGT1A1,
widely distributed in rat tissues, is the molecular species responsible for BCP-NG formation.
Keywords: Bucolome, Bucolome N-Glucuronide, Rat Tissues, UGT1A1, LC/MS
1. Introduction
Bucolome (BCP, Figure 1 is a non-steroidal anti-in-
flammatory drug possessing a pyrimidine skeleton. This
drug is used to treat rheumatoid arthritis because it ex-
hibits analgesic and anti-inflammatory effects without a
sedative or hypnotic effect, unlike many other barbitu-
rates [1]. The drug has recently been clarified to inhibit
CYP2C9, and potentiation and prolongation of the dura-
tion of actions of concomitant drugs and inhibition of
metabolite production by combination with BCP have
been investigated [2-4]. However, BCP-metabolizing
enzymes have not been investigated in detail. Regarding
the metabolism of barbiturate derivatives, the N-gluco-
side forms of phenobarbital [5] and amobarbital [6] are
known as the main metabolites in humans, but no N-
glucuronide forms of these compounds have been con-
firmed. Neighbors et al. [7] reported the presence of N-
glucuronide and N-glucoside in urine of mice treated
with phenobarbital, and Mohri et al. [8] reported the
Figure 1. Chemical structure of bucolome and bucolome N-
glucuronide.
presence of N-glucuronic acid conjugate (BCP-NG,
Figure 1), in which glucuronic acid was directly bound
to nitrogen at position 3 of the pyrimidine skeleton of
BCP, in bile of BCP-treated rats; this was the initial re-
port on N-glucuronide of barbiturate derivatives.
In this study, we investigated the microsomal BCP-
NG-producing activity in the rat liver, small and large
intestines, and kidney, and identified the main tissue in-
Characterization of Bucolome N-Glucuronide Formation: Tissue Specificity and Identification of Rat
UDP-Glucuronosyltransferase Isoform(s)
152
volved in the metabolism. In addition, we investigated
BCP-NG-producing activities of 10 molecular species of
rat UGT (UGT1A1, 1A2, 1A3, 1A5, 1A6, 1A7, 2B1,
2B3, 2B6, and 2B12) using yeast microsomal fractions
expressing these species and identified the isoforms pos-
sessing such activity. The activity was detected in
UGT1A1, 1A2, 1A3, 1A7, 2B1, 2B3, and 2B6.
2. Methods
2.1. Chemicals
BCP was synthesized from cyclohexylurea (Tokyo Che-
mical Industry Co., Ltd., Tokyo) and n-butylmalonate
(Tokyo Chemical Industry) employing the method re-
ported by Senda et al. [1] BCP-NG was prepared as pre-
viously reported [8]. Lubrol WX, p-nitrophenol (p-NP),
p-nitrophenol glucuronide (p-NP-G), bovine serum al-
bumin (BSA), and phenylmethylsulfonyl fluoride (PMSF)
were purchased from Sigma-Aldrich Co. (St. Louis, MO).
Phenylbutazone (PBZ, internal standard (I.S.)), D-glu-
cose, L-histidine, and bicinchoninic acid (BCA) protein
assay reagent were purchased from Nacalai Tesque Inc.
(Kyoto), and dimethylsulfoxide (DMSO) and ethanol
(EtOH) were purchased from Wako Pure Chemical In-
dustries Ltd. (Osaka). Alamethicin was purchased from
Enzo Life Sciences Inc. (New York). Hind III and pTA
vector were purchased from Toyobo Co., Ltd. (Osaka).
Amino acid-free yeast nitrogen base was purchased from
Funakoshi Corp. BCP and PBZ adjusted to 1 mg/ml with
DMSO were used as standard solutions and diluted with
solvent at the time of use. Reagents were stored at –30˚C
and used within 3 months. All chemical reagents used
were analytical or guaranteed grade. Water distilled
twice was used for the experiments. Rats (male Wistar-
ST weighing 235 g - 285 g, clean) were purchased from
Japan SLC Inc. (Shizuoka). Rats were housed in stainless
steel cages at 3 animals per cage and maintained in a
room controlled at 24˚C - 26˚C under a 12-hour lighting
cycle.
2.2. Preparation of Microsomes of Each Tissue
All animal procedures were approved by Meiji Pharma-
ceutical University Committee for Ethics of Experimen-
tation and Animal Care (approved No.2304). Micro-
somes of each tissue were prepared from 6 rats. Under
ether anesthesia, the liver, small and large intestines, and
kidney were excised from rats. Blood was removed from
each tissue by perfusion with ice-cold 1.15% KCl. Each
tissue was cut into pieces in 0.25 M sucrose-containing
10 mM Tris-HCl buffer (pH 7.4), homogenized in a glass
homogenizer, and adjusted to 20% (w/v). The small and
large intestines were prepared with PMSF as previously
reported [9]. The homogenates were centrifuged at 4˚C
for 10 minutes at 700 g, followed by centrifugation at
10,000 g for 10 minutes. The supernatant was further
centrifuged at 105,000 g for 60 minutes. The pellet was
resuspended with the same Tris-HCl buffer and centri-
fuged at 105,000 g for 60 minutes. The pellet was then
resuspended with 100 mM Tris-HCl buffer (pH 7.4)
containing 20% (w/v) glycerol and 10 mM EDTA. The
suspension was aliquoted into 1.5 ml plastic tubes at 500
μl/tube and stored at –80˚C. All procedures were per-
formed at 4˚C. The microsomal protein concentrations
were measured by the method of Lowry et al. [10] or
BCA protein assay reagent [11] using bovine serum al-
bumin (BSA) as the standard.
2.3. Expression of Rat
UDP-Glucuronosyltransferase Family 1 and
2 Isoforms in Yeast
Recombinant rat UGT isoforms were expressed in AH22
yeast cell as previously described [12]. The cDNA of rat
UGTs 1A1, 1A2, 1A3, 1A5, 1A6, and 1A7 was cloned in
previous works [13-15]. The cDNA of rat UGTs 2B1,
2B3, 2B6, and 2B12 was isolated by RT-PCR from total
liver RNA of Wistar rat using the set of primers de-
scribed below.
2B1: forward, cccaagcttaaaaaatgtctatgaaacagacttca,
reverse, cccaagcttctactctttcttcttctttcccatgttacg;
2B3: forward, cccaagcttaaaaaatgcctgggaagtggatttct,
reverse, cccaagcttctactcattcttcattttcttttccttctt;
2B6: forward, cccaagcttaaaaaatgccaggaaaatggattttt,
reverse, cccaagcttctactcattcttcattttcttttgdttctt;
2B12: forward, cccaagcttaaaaaatgtctgggaagtggatttct,
reverse, cccaagcttctactcattctttgttttcttttccttctt.
The pGYR vector with glyceraldehyde 3-phosphate
dehydrogenase promoter and terminator was used for the
expression of rat UGT isoforms [16]. To insert the
UGTcDNA into the pGYR yeast expression vector, the
sense primer upstream of each first ATG included a Hind
III site and the antisense primer downstream from the
stop codon contained a Hind III site. The amplified
full-length DNA was subcloned into the pTA vector
(TOYOBO, Japan) and sequenced in both directions to
confirm each UGT2B isoform. After the point mutational
changes of internal Hind III site in some UGT isoforms,
HindIII digested fragments were ligated into the Hind III
site of the pGYR1 expression vector. Yeast transforma-
tions with pGYR were performed by the lithium acetate
method [16]. Each transformant, AH22/pGYR-UGT,
was selected by the complementation of lue2 auxotro-
phy.
2.4. Preparation of Yeast Microsomes
The yeast transformants with pGYR containing UGT
C
opyright © 2011 SciRes. PP
Characterization of Bucolome N-Glucuronide Formation: Tissue Specificity and Identification of Rat
UDP-Glucuronosyltransferase Isoform(s)
153
isoforms were cultivated in synthetic minimal (SD)
medium (2% (w/v) D-glucose and 0.67% (w/v) yeast
nitrogen base without amino acids) supplemented with
20 mg/l histidine. Rat UGT containing microsomal
fractions of yeast was prepared by the method of Oeda et
al. [17]. The protein concentration of the microsomes
was determined with the bicinchoninic acid (BCA)
protein assay reagent (Nacalai Chemical Co., Japan)
using bovine serum albumin (BSA) as a standard.
2.5. Immunoblot Analysis
Yeast microsomes were subjected to SDS-PAGE through
10% acrylamide gel [12]. The resulting polypeptide
bands were transferred to nitrocellulose membranes, and
polyclonal antibodies against the UGT isoforms were
used for detecting the immunoreactive bands. Anti-
UGT1A and anti-UGT2B antibodies can recognize the
C-terminal region, that is, 516GKGRVKKSHKSKTH529
and 355KWIPQNDLLGHPKT368, as described pre-
viously [18,19]. The content of expressed rat UGT in
yeast microsomes was estimated using a bacterially
expressed maltose binding protein (MBP) fused with
UGT proteins as a standard [19]. The MBP-UGT fusion
proteins containing C-terminal residues of rat UGT1A1
(MBP-UGT1AC; Met 307-His 530 of rat UGT1A1) and
UGT2B3 (MBP-UGT2B3C; Met 313-Glu 530 of
UGT2B3) were constructed using pMAL-c2 expression
vector (New England Biolabs). The fusion proteins were
purified by amylose-conjugated affinity chromatography.
The concentration of the standard proteins (MBP-
UGT1AC, 68 kDa; MBP-UGT2B3C, 68 kDa) was esti-
mated by bicinchoninic acid protein assay.
2.6. HPLC Apparatus and Chromatographic
Conditions
For the HPLC system and measurements of BCP and
BCP-NG, the method previously reported by Mohri et al.
[20] was used with modifications. An HPLC system of
JASCO Corporation was used, and data was processed
using JASCO chromatograph data station, Chrom NAV.
The detector was set at 268 nm using a sensitivity of
0.005 absorbance units full scale (a.u.f.s.). BCP, I.S. and
BCP-NG were separated on a reverse-phase Capcell Pak
C18 octadecylsilane (ODS) column (SG 120) [6.0 mm
(inside diameter, i.d.) × 150 mm; particle size, 5 µm]
(Shiseido Co. Ltd., Tokyo) equipped with a guard
column packed with the same resin [4.6 mm i.d. × 10
mm]. The mobile phase (0.05 M phosphate buffer (pH
5.7): MeOH:THF, 50:40:4, v/v/v) was pumped through
the column at 1.5 ml/min. Retention times of BCP, I.S.,
and BCP-NG were 7.2, 9.9, and 12.9 min. respectively.
For the mobile phase, 0.05 M phosphate buffer (pH 5.7):
MeOH:THF = 50:40:4 (v/v/v) was used at a flow rate of
1.5 ml/min for sample analysis. Regarding linearity of
BCP and BCP-NG calibration curves (0 - 100 µM), the
correlation coefficient (r) was greater than 0.99. The
detection limits of BCP and BCP-NG were 0.25 and 0.06
ng, respectively. All HPLC measurements were perform-
ed at 23˚C. All sample analyses were repeated 3 times.
2.7. LC/MS Analysis of BCP-NG
The entire LC/MS system and all columns were products
of Shimadzu Co. (Kyoto). Shimadzu mass spectrometric
analysis system LC/MS-2010EV equipped with the
following devices was used: pump for LC/MS, LC-
20AB; autosampler, SIL-20A; deairing device, DGU-
20A5; column oven, CTO-20SA; and system controller,
CBM-20A. Using Shim-pack VP-ODS (2.0 mm i.d. ×
150 mm) and guard column GVP-ODS at an oven
temperature of 40˚C, analysis was performed employing
the ESI negative ion mode under the following condi-
tions: mobile phase flow rate, 0.2 ml/min; N2 gas flow
rate, 1.5 l/min; probe voltage, 1.5 kv; probe temperature,
250˚C; CDL voltage, 20.0 V; and block temperature,
200˚C. In elution from reverse-phase HPLC employing
flow injection, the proportions of the mobile phase
components: A = 0.1% formic acid and B = acetonitrile,
were changed in a linear gradient from A:B = 7.3 at 0
minute to A:B = 4:4 at 5 minutes and then increased to
A:B = 2:8 in a linear gradient. This proportion was main-
tained for 5 minutes, and the proportion of acetonitrile
was then reduced to A:B = 7:3 in a stepwise gradient and
maintained for 6 minutes. On ion detection employing
the ESI method, BCP (m/z 265), BCP-NG (m/z 441.20),
and PBZ (I.S. m/z 307) were detected. The peak
retention times of PBZ (I.S. m/z 307) and BCP-NG (m/z
441.20) were about 13.9 and 9.8 min, respectively. The
correlation coefficient (r) representing linearity of the
calibration curve was greater than 0.99 within a range of
1.67 ng/ml to 2.09 μg/ml. The detection limit of BCP-
NG was 16.7 pg.
2.8. BCP-NG Activity in Each Tissue of Rats
Reaction solutions were prepared by combining micro-
somes of the rat tissues solubilized with lubrol (final con-
centration: 0.1 mg/ml) (liver, small and large intestines,
and kidney, 2 mg/ml microsomal protein) with MgCl2
(final concentration: 8 mM), saccharolactone (final
concentration: 4 mM), BCP (final concentration: 2 mM),
0.5 M Tris-HCl (pH 7.4) (final concentration: 0.2 mM),
and UDP-Ga (final concentration: 8 mM), adjusting the
total volume to 250 μl. After preincubation of the re-
action solutions at 37˚C for 5 minutes, UDP-Ga or BCP
was added to start the enzyme reaction. After incubation
Copyright © 2011 SciRes. PP
Characterization of Bucolome N-Glucuronide Formation: Tissue Specificity and Identification of Rat
UDP-Glucuronosyltransferase Isoform(s)
154
at 37˚C for 20 minutes, the reaction was stopped by
adding 0.25 g of ammonium sulfate, followed by the
addition of 200 µl of EtOH solution containing 24 µM
phenylbutazone (PBZ, I.S.) and vigorous stirring for 1
minute. The mixture was then centrifuged at 18,000 g for
10 minutes, and 150 µl of the supernatant was combined
with 10 µl of 0.1% NaHCO3. Ten µl of this solution was
directly injected onto the HPLC. The level of BCP-NG
formed by the enzyme reaction was determined from the
BCP calibration curve as previously reported [9]. All
measurements were repeated 3 times.
2.9. BCP-NG Activities of Rat Recombinant
UGT Isoform Microsomes
Ten isoforms of rat microsomal UGT (1 mg/ml microso-
mal protein) were solubilized by adding alamethicin
(0.025 mg/ml DMSO solution). The enzyme reaction
was performed as in the experiment using rat liver micro-
somes. The reaction was stopped by adding 500 μl of
chloroform. The reaction mixtures were vigorously
mixed by vortex mixer and then centrifuged at 18,000 g
for 10 minutes. To 150 μl of the supernatant, the same
volume of 5 μM PBZ acetonitrile solution was added and
mixed vigorously, followed by centrifugation at 18,000 g
for 10 minutes. Fifty μl of the supernatant was combined
with 5 volumes of acetonitrile, mixed vigorously for 30
seconds, and centrifuged at 18,000 g for 10 minutes. Ten
μl of the supernatant was directly injected onto the LS/
MS system. All measurements were repeated 3 times.
2.10. Data Analysis
For post-hoc multiple comparison of 3 or more groups,
Scheffe’s test was employed. Using JMP® Statistical
Figure 2. BCP N-glucuronidation activities in microsomes
from rat liver, small intestine, large intestine, and kidney.
Each point and vertical bar represent the mean and s.d. (n
= 3). *p < 0.05 was regarded as significant.
Discovery Software (SAS Institute Japan Ltd., Tokyo), p
< 0.05 was regarded as significant (*).
3. Results
3.1. Tissue Distribution of UGT Activities
Responsible for BCP N-Glucuronidation
BCP-NG activity (nmol/mg/min) was detected in micro-
somal fractions of all 4 rat tissues: liver (0.44 ± 0.09),
small intestine (0.18 ± 0.01), large intestine (0.02 ±
0.004), and kidney (0.06 ± 0.004) (Figure 2). Of these 4
tissues, the highest BCP-NG-producing activity detected
in liver microsomes was about 22 times higher than the
lowest activity detected in large intestinal epithelial cell
microsomes. Regarding the activity in the liver as 1, the
activity level decreased in the order of small intestine
(0.41), kidney (0.14), and large intestine (0.05).
3.2. Expression of Rat
UDP-Glucuronosyltransferase Family 1 and
2 Isoforms in Yeast Cells
To examine the ability of rat UGT family 1 and 2 iso-
forms to form BCP-NG, the cDNAs cloned into the yeast
expression vector pGYR were expressed in AH22 yeast
cells. Rat UGT family 1 isoforms (UGT1A1, 1A2, 1A3,
1A5, 1A6, and 1A7) and family 2 isoforms (UGT2B1,
2B3, 2B6, and 2B12) were expressed in yeast AH22 cells,
(a)
(b)
Figure 3. Western blot analysis of rat UDP-glucuronosyl-
transferase isoforms expressed on AH22 yeast cells. Immu-
noreaction was performed using antibodies against the
common sequence of UGT1A family (Panel a) 3: UGT1A1,
4: UGT1A2, 5: UGT1A3, 6: UGT1A5, 7: UGT1A6, 8:
UGT1A7, and against UGT2B (Panel b) 1: UGT2B1, 2:
UGT2B3, 3: UGT2B6, 4: UGT2B12. Rat liver microsomes
and yeast microsomes with mock pGYR vector were used
for positive (lane 1 in Panel a) and negative (lane 2 in Panel
a) controls, respectively.
C
opyright © 2011 SciRes. PP
Characterization of Bucolome N-Glucuronide Formation: Tissue Specificity and Identification of Rat
UDP-Glucuronosyltransferase Isoform(s)
155
as shown by immunoblotting analysis (Panels A and B in
Figure 3). All isoforms in this yeast expression system
showed clear activities toward p-nitrophenol (data not
shown). Quantitative immunoblot analysis of UGT1A
isozymes and UGT2B using the corresponding MBP-
UGT fusion proteins enabled the contents of the UGTs in
microsomes to be determined. Taken together with the
data for relative expression levels of the UGT1A isozy-
mes, the contents of UGT1A1, 1A2, 1A3, 1A6, 1A7, and
2B3 in microsomes were estimated to be 70, 30, 60, 5,
130, 210, and 13 pmol/mg protein, respectively. On the
basis of the assumption that the reactivity of the anti-
UGT2B toward UGT2B1, 2B6, and 2B12 is similar to
that of UGT2B3, the expression levels of UGT2B1, 2B6,
and 2B12 were estimated to be 25, 16, and 24 pmol/mg
protein, respectively.
3.3. Identification of UGT Isoforms Responsible
for BCP N-Glucuronidation
BCP-NG-producing activity (min–1) was detected in 7 of
10 rat UGT isoforms (1A1, 1A2, 1A3, 1A7, 2B1, 2B3,
and 2B6), and particularly high activity levels were ob-
served in UGT 1A1 and 1A2 (Figure 4). The highest
BCP-NG-forming activity was observed in UGT1A2
(0.318), followed by other isoforms in the order of 1A1
(0.059), 2B3 (0.091), 2B6 (0.031), 2B1 (0.004), 1A7
(0.003), and 1A3 (0.001). Regarding the activity level of
1A1 as 1, the activity level of 1A2 was 2.3 times higher.
The activity levels of the other UGT isoforms were 1A3
(0.01), 1A7 (0.15), 2B1 (0.02), 2B3 (0.29), and 2B6
(0.12). The activity levels of 1A3 and 2B1 were very low
and those of 1A5, 1A6, and 2B12 were lower than the
detection limit.
4. Discussion
4.1. BCP-NG Activity in Microsomal Fraction by
Tissue
BCP-NG-producing activity was detected in the microso-
mal fraction of all 4 tissues including the liver as the
highest. The BCP N-glucuronidation activity level was
the highest in liver microsomes, followed by that in
small intestinal microsomes, which was about 41% of
that in liver microsomes (Figure 2). This was more than
8 times higher than that in large intestinal microsomes
(about 5% of liver microsomal activity), suggesting that
the liver contains many molecular species of UGT at
high activity levels with detoxication functions, and BCP
N-glucuronidation is also performed at relatively high
activity levels in the microsomal fraction in the small
intestine responsible for absorption and excretion. There-
fore, it was suggested that the small intestine is also
Figure 4. Glucuronidation activity of each recombinant rat
UGT isozyme. The v/E0 (minutes-1) of the glucuronidation
activity for each UGT was determined at the substrate
(BCP) concentration of 2 mM. N.D., not detected (less than
0.01).
closely involved in phase II drug metabolism in vivo.
4.2. Expression and BCP-NG Activity of
Recombinant Rat UGT Isoforms
We prepared recombinant yeast specifically expressing
each UGT isoform by introducing the genes encoding 10
rat UGT isoforms. However, the expression level per
microsomal protein markedly varied among the trans-
formants (Figurt 3). The expression level of 1A7 (210
pmol/mg protein) was the highest, and that of 1A5 was
the lowest, showing a 42-fold difference. The cause of
this was unclear, but the expression efficiency was not
homogeneous among the UGT isoforms. Thus, the initial
BCP-NG formation rate (pmol/min) divided by the yeast
microsomal content (mg) could not be directly compared
as the BCP-NG-producing activity level (pmol/min/mg
microsomal protein) of the isoform. The UGT molecule
expression level determined by quantitative western blot
analysis (expression (pmol/mg) = number of UGT
molecules (pmol)/total protein (mg)) is presented as the
value calculated by dividing the number of expressed
UGT molecules by the yeast microsomal protein content
(mg) (Figure 3). Therefore, the value calculated by di-
viding the apparent BCP-NG-producing activity (pmol/
min/mg) by the expression level (pmol/mg) represents
the turnover level (min–1) per enzyme molecule [19].
BCP-NG-producing activity was compared among the
expressed UGT isoforms on the basis of this value (min–1)
(Figure 3).
When BCP-NG-producing activity was investigated in
yeast microsomal fractions expressing the 10 rat UGT
isoforms, activity was detected for a wide range of iso-
forms (1A1, 1A2, 1A3, 1A7, 2B1, 2B3, and 2B6), con-
firming that BCP widely overlaps in substrate selectivity
of UGT (Figure 4). No BCP-NG-producing activity was
Copyright © 2011 SciRes. PP
Characterization of Bucolome N-Glucuronide Formation: Tissue Specificity and Identification of Rat
UDP-Glucuronosyltransferase Isoform(s)
156
detected for 1A5, 1A6, or 2B12, although these were
expressed at the second highest level.
4.3. Liver Microsomal BCP-NG Activity
When the isoforms with BCP-NG-producing activity
were arranged in order of UGT mRNA level in the liver,
highest first, as reported by Vansell et al. [21], the order
was as follows: UGT2B1, UGT1A1, UGT2B6, UGT1A7,
and UGT2B3. It was reported that the mRNA levels of
UGT1A2 and UGT1A3 in the liver were lower than the
detection limit. The BCP-NG-producing activity level of
UGT1A2 was 2.3 times higher than that of 1A1, but in
consideration of the mRNA expression ratio, it was con-
cluded that UGT1A1 is most likely to be the UGT1A
subfamily mainly involved in BCP-NG formation in the
rat liver. BCP-NG-producing activity was also observed
in the UGT 2B subfamily (UGT2B1, 2B3, and 2B6),
although the activity level was low (the total activity
level of UGT2B1, 2B3, and 2B6 was about 1/2 and 1/5
of those of A1 and 1A2, respectively). UGT2B1 has been
reported to be the most abundant UGT isoform in the rat
liver (21), suggesting that UGT2B1 also contributes to
BCP-NG formation.
Shelby et al. [22] reported on the UGT isoform distri-
bution at the mRNA level in 10 rat tissues (liver, kidney,
lung, stomach, duodenum, jejunum, ileum, large intestine,
cerebellum, and cerebral cortex), in which 3 UGT iso-
forms (UGT1A1, UGT1A6, and UGT2B12) were de-
tected in many tissues, but the distributions of other UGT
isoforms were tissue-specific. However, UGT1A6 and
UGT2B12 showed no BCP-NG-producing activity. They
also reported that mRNAs of UGT1A2, UGT1A3, and
UGT1A7, which showed BCP-NG-producing activity in
our study, were mainly present in the digestive tract, and
their expressions were very low in the liver. Furthermore,
they confirmed that UGT2B1, UGT2B2, UGT2B3,
UGT2B6, and UGT2B12 of the UGT 2B subfamily were
expressed mainly in the liver [22], in which the total
mRNA expression level of UGT2B1, UGT2B3, and
UGT2B6, which showed BCP-NG-producing activity in
our study, was lower than that of UGT1A1.
We previously reported that the liver microsomal
BCP-NG activity levels in UGT1A family-deficient
Gunn rats [23] was lower than 8.5% of that in normal
rats, and BCP-NG formation activities in phenobarbital-
and clofibric acid-pretreated microsomes were 1.5- and
1.6-fold higher than those in untreated microsomes, re-
spectively [24]. On the basis of these findings of mRNA
expression level [22] and BCP-NG-producing activity,
the main UGT isoform responsible for BCP-NG forma-
tion in the rat liver may be UGT1A1, and UGT2B1,
UGT2B3, and UGT2B6 may be supplementarily in-
volved.
4.4. Small Intestinal Microsomal BCP-NG
Activity
The contribution of small intestinal epithelial cells to
drug metabolism has recently been discussed. However,
drug-metabolizing activity varies depending on the me-
thod of preparing the microsomal fraction of intestinal
epithelial cells, to which attention should be paid [9]. It
has been reported that the mRNA expression level of the
UGT1A subfamily (UGT1A1, UGT1A2, UGT1A3, and
UGT1A7) is high in the rat small intestine, whereas that
of the UGT 2B subfamily (UGT2B1, UGT2B3, and
UGT2B6) is low [22]. In the UGT 2B subfamily, the
mRNA expression level of UGT2B3 was the highest, but
this was lower than that of UGT1A3, which was
expressed at the lowest mRNA level among the UGT 1A
subfamily. Considering that the reported UGT mRNA
levels expressed in the small intestine and BCP-NG-
producing activity observed in our study, it was suggest-
ed that the main BCP-NG-producing UGT isoforms in
the rat small intestine are UGT1A1 and UGT1A2, and
UGT1A3, UGT1A7, UGT2B1, UGT2B3, and UGT2B6
may be supplementarily involved.
4.5. Large Intestinal Microsomal BCP-NG
Activity
In the large intestine, mRNA expression of all isoforms
of the UGT1A subfamily has been confirmed [22], and
the expression level of UGT1A1 was the highest, fol-
lowed by UGT1A7 expressed at a level less than 1/2 of
that of UGT1A1 [22]. The mRNA expression level of the
UGT2B subfamily in the large intestine has been re-
ported to be lower than the detection limit [22]. su-
ggesting that the main UGT isoform responsible for
BCP-NG formation in the large intestine is UGT1A1,
and UGT1A2, UGT1A3, and UGT1A7 are supplementa-
rily involved.
4.6. Renal Microsomal BCP-NG Activity
Microsomal activity level was also observed in the kid-
ney, and it was about 14% of that in the liver, suggesting
that the kidney is also responsible for some parts of drug
metabolism, similarly to the small intestine. It has been
reported that the UGT1A1 mRNA expression level was
the highest, whereas those of the other UGT were 1/80 or
lower in the kidney [22]. Considering that the mRNA
expression level of UGT1A2, possessing the highest
BCP-NG-producing activity among the isoforms, was
lower than the detection limit in the kidney, UGT1A was
assumed to be the isoform responsible for BCP-NG for-
mation in the kidney.
C
opyright © 2011 SciRes. PP
Characterization of Bucolome N-Glucuronide Formation: Tissue Specificity and Identification of Rat
UDP-Glucuronosyltransferase Isoform(s)
157
5. Conclusions
BCP-NG-producing activity was detected in 4 tissues in
rats. The main tissues were the liver and small intestine,
but the kidney was also assumed to contribute to BCP-
NG formation. UGT1A1 was the main BCP-NG-pro-
ducing isoform in all 4 tissues, and the other UGT iso-
forms (1A2, 1A3, 1A7, 2B1, 2B3, and 2B6) were sup-
plementarily involved in the formation in an tissue-spe-
cific manner. This is the first report in which the UGT
isoforms involved in the N-glucuronidation of barbitu-
rate derivatives have been identified in rats.
This research received no specific grant from any
funding agency in the public, commercial, or not-for-
profit sectors.
6. References
[1] S. Senda, H. Izumi and H. Fujimura, “On Uracil Deriva-
Tives and Related Compounds. 6,5-alkyl-2,4,6-Trioxo-Per
Hydrophyrimidine Derivatives as Antiphlogistics,” Arz-
neimittel Forschung, Vol. 17, No. 12, 1967, pp. 1519-1523.
[2] N. Takamura, T. maruyama, E. Chosa, K. Kawai, Y.
Tsutsumi, Y. Uryu, K. Yamasaki, T. Deguchi and M.
Otagiri, “Bucolome, a Potent Binding Inhibitor for Fu-
Rosemide, Alters the Pharmacokinetics and Diuretic Ef-
fect of Furosemide: Potential for Use of Bucolome to Re-
store Diuretic Response in Nephrotic Syndrome,” Drug
Metabolism and Disposition, Vol. 33, No. 4, 2005, pp.
596-602.
[3] M. Osawa, N. Hada, K. Matsumoto, T. Hasegawa, D.
Kobayashi, Y. Morimoto, M. Yamaguchi, I. Kanamoto, T.
Nakagawa and K. Sugibayashi, “Usefulness of Coadmin-
Istration of Bucolome in Warfarin Therapy: Pharmacoki-
Netic and Pharmacodynamic Analysis Using Outpatient
Prescriptions,” Internal Journal of Pharmaceutics, Vol.
293, No.1-2, 2005, pp. 43-49.
doi:10.1016/j.ijpharm.2004.12.009
[4] M. Kobayashi, M. Takagi, K. Fukumoto, R. Kato, K.
Tanaka and K. Ueno, “The Effect of Bucolome, a
CYP2C9 Inhibitor, on the Pharmacokinetics of Losartan,”
Drug Metabolism and Disposition, Vol. 23, No. 2, 2008,
pp. 115-119. doi:10.2133/dmpk.23.115
[5] B. K. Tang, W. Kalow and A. A. Grey, “Metabolic Fate
of Phenobarbital in Man N-Glucoside Formation,” Drug
Metabolism and Disposition, Vol. 5, No. 5, 1979, pp.
315-318.
[6] B. K. Tang, W. Kalow and A. A. Grey, “Amobarbital
Metabolism in Man: N-Glucoside Formation,” Research
Communications in Chemical Pathology and Pharmacol-
Ogy, Vol. 21, No. 1, 1978, pp. 45-53.
[7] S. M. Neighbors and W. H. Soine, “Identification of
Phenobarbital N-Glucuronides as Urinary Metabolites of
Phenobarbital in Mice,” Drug Metabolism and Disposi-
tion, Vol. 23, No. 5, 1995, pp. 548-552.
[8] K. Mohri, T. Uesugi, and K. Kamisaka, “Bucolome N-
Glucuronide: Purification and Identification of a Major
Metabolite of Bucolome in Rat Bile,” Xenobiotica, Vol.
15, No. 7, 1985, pp. 615-621.
doi:10.3109/00498258509045891
[9] K. Mohri, and Y. Uesawa, “Enzymatic Activities in the
Microsomes Prepareted from Rat Small Intestinal Epithe-
lial Cells by Differential Procedures,” Pharmaceutical
Research, Vol. 18, No. 8, 2001, pp. 1232-1236.
doi:10.1023/A:1010951732288
[10] O. H. Lowry, N. J. Rosebrough, A. L. Farr and R. J.
Randall, “Protein Measurement with the Folin Phenol
Reagent,” Journal of Biological Chemistry, Vol. 1, No. 1,
1951, pp. 265-275.
[11] P. K. Smith, R. I. Krohn, G. T. Hermanson, A. K. Mal-
liam F. H. Garther, M. D. Provenzano, E. K. Fujimoto, N.
M. Goeke, B. J. Olson and D. C. Klenk, “Measurement of
Protein Using Bicinchoninic Acid,” Analitycal Bio-
chemistry, Vol. 150, No. 1, 1985, pp. 76-85.
doi:10.1016/0003-2697(85)90442-7
[12] S. Ikushiro, M. Sahara, Y. Emi, Y. Yabusaki and T. Iya-
nagi, “Functional Coexpression of Xenobiotic Metabo-
lizing Enzymes, Rat Cytochrome P4501A1 and UDP-
Glucuronosyltransferase 1A6, in Yeast Microsomes,” Bio-
chimica et Biophysica Acta, Vol. 1672, No. 2, 2004, pp.
86-92. doi:10.1016/j.bbagen.2004.02.012
[13] T. Iyanagi, M. Haniu, K. Sogawa, Y. Fujii-Kuriyama, S.
Watanabe, J. E. Shively and K. F. Anan, “Cloning and
Characterization of cDNA Encoding 3-Methylcholanthrene
Inducible Rat mRNA for UDP-Glucuronosyltransferase,”
Journal of Biological Chemistry, Vol. 261, No. 33, 1986,
pp. 15607-15614.
[14] T. Iyanagi, “Molecular Basis of Multiple UDP-Glu-
curonosyltransferase Isoenzyme Deficiencies in the Hy-
perbiliru-Binemic Rat (Gunn Rat),” Journal of Biological
Chemistry, Vol. 266, No. 35, 1991, pp. 24048-24052.
[15] Y. Emi, S. Ikushiro and Y. Kato, “Thyroxine-Metaboiizing
Rat UDP-Glucuronosyltransferase 1A7 is Regulated by
Thyroid Hormone Receptor,” Endocrinology, Vol. 148,
No. 12, 2007, pp. 6124-6133. doi:10.1210/en.2007-0443
[16] H. Ito, Y. Fukuda, K. Murata and A. Kimura, “Trans-
formation of Intact Yeast Cells Treated with Alkali
Cations,” Journal of Biological Chemistry, Vol. 153, No.
1, January, 1983, pp. 163-168.
[17] K. Oeda, T. Sakai, and H. Ohkawa, “Expression of Rat
Liver Cytochrome P-450MC cDNA in Saccharomyces
Cerevisiae,” DNA, Vol. 4, No. 3, 1985, pp. 203-210.
doi:10.1089/dna.1985.4.203
[18] S. Ikushiro, Y. Emi and T. Iyanagi, “Identification and
Analysis of Drug-Responsive Expression of UDP-Glu-
Curonosyltransferase Family 1 (UGT1) Isozymes in Rat
Hepatic Microsomes Using Anti-Peptide Antibodies,”
Archives of Biochemistry and Biophysics, Vol. 324, No. 2,
1995, pp. 267-272. doi:10.1006/abbi.1995.0039
[19] N. Kasai, T. Sakai, R. Shinkyo, S. Ikushiro, T. Iyanagi, M.
Kamao, T, Okano and K. Inoue, “Sequential Metabolism
of 2,3,7-Trichlorodibenzo-p-Dioxin (2,3,7-triCDD) by
Copyright © 2011 SciRes. PP
Characterization of Bucolome N-Glucuronide Formation: Tissue Specificity and Identification of Rat
UDP-Glucuronosyltransferase Isoform(s)
Copyright © 2011 SciRes. PP
158
Cytochrome P450 and UDP-Glucuronosyltransferase in
Human Liver Microsomes,” Drug Metabolism and Dis-
position, Vol. 32, No. 8, 2004, pp. 870-875.
[20] K. Mohri, Y. Uesawa and T. Uesugi, “Metabolisme of
Bucolome in Rats. Stability and Biliary Excretion of Bu-
colome N-Glucuronide,” Journal of Chromatogrphy B,
Vol. 759, No. 1, 2001, pp. 153-159.
doi:10.1016/S0378-4347(01)00218-3
[21] N. R. Vansell, and C. D. Klaassen, “Increase in Rat Liver
UDP-Glucuronosyltransferase mRNA by Microsomal
Enzyme Inducers that Enhance Thyroid Hormone Glu-
curonidation,” Drug Metabolism and Disposition, Vol. 30,
No. 3, 2002, pp. 240-246. doi:10.1124/dmd.30.3.240
[22] M. K. Shelby, N. J. Cherrington, N. R. Vansell and C. D.
Klaassen, “Tissue mRNA Expression of the Rat UDP-
Glucuronosyltransferase Gene Family,” Drug Metabolism
and Disposition, Vol. 31, No. 3, 2003, pp. 326-333.
doi:10.1124/dmd.31.3.326
[23] J. R. Chowdhury, R. Kondapalli and N. R. Chowdhury,
“Gunn Rat: A Model for Inherited Deficiency of
Bilirubin Glucuronidation,” Advances in Veterinary Sci-
ence and Comparative Medicine, Vol. 37, 1993, pp.
149-173.
[24] H. Kanoh, K. Okada, and K. Mohri, “Identification of the
UDP-Glucuronosyltransferase Responsible for Bucolome
N-Glucuronide Formation in Rats,” Pharmazie, Vol. 65,
No. 11, 2010, pp. 840-844.