Establishment and molecular characterization of breast cancer mesenchymal stem cell line derived from human non-metastasis breast cancer tumor

doi:10.4236/scd.2011.12003

Paper Menu >>

Journal Menu >>

Vol.1, No.2, 21-28 (2011)

doi:10.4236/scd.2011.12003

Stem Cell Discovery

Establishment and molecular characterization of breast

cancer mesenchymal stem cell line derived from human

non-metastasis breast cancer tumor

Pravin Potdar, Sachin Chaugule

Department of Molecular Medicine and Biology, Jaslok Hospital and Research Centre, Mumbai, India;

Corresponding Author: [email protected]

Received April 29th, 2011; revised May 23rd, 2011; accepted May 31st, 2011.

ABSTRACT

Breast cancer remains a leading cause of mor-

bidity and mort ality in women mainly because o f

the propensity of primary breast tumors to me-

tastasize. It is composed of heterogeneous cell

populations with different biological properties.

Breast cancer-initiating c ells have been rec ently

identified in breast carcinoma as CD44+/CD24−/low

cells, which display stem cell like properties. In

the present study, we have isolated breast can-

cer stem cells from non-met astasis tumor tissue,

which is presently at passage 18 and designated

as human Breast Cancer Mesenchymal Stem

Cells (hBCMSCs) line. These cells showed spin-

dle shaped morphology and formed mammos-

pheres as well as pluripotency clones indicating

their stem cell nature. Molecular marker study

confirmed mesenchymal nature as well as

pluripotency, plasticity and oncogenicity of

these cells. The hBCMSCs cell line may likely

contain a heterogeneous population of malig-

nant cells. Interestingly, we also found that

these cells exhibit BRCA 2 mutation, which was

found in Indian population. Overall, this study

revealed that hBCMSCs cell line may represent

a suitable in vitro model to study the mecha-

nism of breast cancer which further leads to an

identification of molecular targets for future

breast cancer targeted therapy.

Keywords: Breast Cancer Stem Cells; Breast

Cancer, BRCA2; Mesenchymal Stem Cells;

Molecular Markers

1. INTRODUCTION

A fundamental problem in breast cancer research is to

identify the cell type capable of sustaining the growth of

the neoplastic clone. It is less clear from most of the

breast cancers studies that which cells within the tumor

clone possess tumor-initiating cell function for main-

taining tumor growth. The identification of potential

breast cancer stem cells is the most important task for

the study due to the characteristics of these stem cells

which are resistant to conventional cancer therapy [1].

Pardal et al. [2003] have shown that a small subset of

cells within a tumor, termed Cancer Stem Cells (CSCs)

or tumor-initiating cells which are responsible for tumor

initiation and tumor growth progression [2]. The concept

about tumor containing heterogeneous populations of

cells was demonstrated firstly by Lapidot and colleagues

in leukemia [3]. Fidler and Kripke observed striking

heterogeneity of dissociated tumor cells with respect to

the clonogenic ability to form metastasis [4]. The exis-

tence of “cancer stem cells” or “cancer initiating cells”

has been identified in a variety of solid tumors including

gliomas, medulloblastoma, lung cancer, prostate cancer,

colon cancer and breast cancer by various investigators

[5-11]. Recent studies have suggested the existence of

stem cells in the human mammary gland similar to those

in the rodent and also shown that non-adherent mam-

mospheres are highly enriched for cells with stem and

progenitor cell properties [12,13]. The isolation and

characterization of mammary cancer stem cells also has

important implications for understanding mammary car-

cinogenesis. Significant progress has already been made

in the identification of the stem cell in mammary gland

of the mouse, though relatively little work has been car-

ried out in humans [1]. It may help to design therapies

targeted to the unique properties of the tumor stem cell

to get selective killing. There is a need of comparing

Breast cancer initiating cells phenotypes with non-breast

cancer initiating cells phenotypes. The focus of future

studies involves cell signaling pathways, molecular and

cellular markers for normal and tumorigenic cells and

drug development.

P. Potdar et al. / Stem Cell Discovery 1 (2011) 21-28

Molecular marker study is one of the important stud-

ies to characterize and establish any cell type. Recent

studies on stem cell research have identified CD105,

CD13 and CD73 as a Mesenchymal Stem Cells (MSCs)

markers [14], CD34, CD45 as a Hematopoietic Stem

Cells (HSCs) markers [15,16], Oct4, Nanog, SOX2 as a

Pluripotency and self renewal capacity markers [17]. It

has been established that there is change in expression of

molecular markers like DAPK, COX2 and LIF in can-

cerous cell types [18-20]. CD44 is a receptor for halu-

ronic acid, which has been shown to play a role in tumor

migration and metastasis [21]. CD24 has recently been

described as a negative regulator of CXCR4, a chemo-

kine receptor important in facilitating breast cancer me-

tastasis [22]. An understanding of the biology of the cells

that drive tumorogenesis has the potential to lead to new

therapeutic approaches for breast cancer.

In present study, we have mainly focused on isolation,

characterization and propagation of in vitro breast cancer

stem cells from non-metastasis human breast tumor.

Moreover, our research further confined to the isolation

of breast cancer stem cells and characterizes these cells

for their mesenchymal or hematopoietic phenotypes as

well as pluripotency, oncogenic, cytokines and chemoki-

nes markers. As our laboratory has already established

Breast cancer mutation in BRCA2 gene in Indian popu-

lation [23]. We have decided to study this mutation in

vivo tumor tissue and in vitro isolated hBCMSCs cell

line to confirm the specificity of Breast cancer tumor

cells. Overall, this study will develop in vitro model

system to understanding mechanism of breast cancer

development as well as to help in developing specific

targeted therapies for breast cancer.

2. MATERIALS AND METHODS

2.1. Collection and Processing of Human

Breast Cancer Tissue

Fresh specimen of human breast tumor was received

in sterile condition within an hour after surgery with

prier consent of patient as per the guidelines of ethical

committee of Jaslok Hospital and Research Center,

Mumbai, India and it was sent to the stem cell laboratory.

The tumor was cut into 2 mm pieces in sterile 1X Phos-

phate Buffer Saline (PBS) containing 1% Penstrep

(HiMedia, India) and washed 2 - 3 times. The cleaned

tissue fragments, then digested in 0.25% Trypsin-EDTA

(HiMedia, India) at 37˚C for 40 min. Tumor tissue ex-

plants were plated in 65 mm Nunc dishes which were

scratched with scarpel blade to adhere these tissue frag-

ments. The tissues pieces were fed with freshly prepared

DMEM (Dulbecco’s Modified Eagle’s Medium, HiMe-

dia, India) supplemented with 10% FBS (Fetal Bovine

Serum, Invitrogen, Carlsbad, CA), 1% Penicillin-strep-

tomycin, 1l/ml Insulin (Sigma, USA), 2 l/ml L-Gluta-

mine (HiMedia, India), 20 ng/ml EGF (Epidermal Growth

Factor, Sigma, USA) and dishes were incubated in a CO2

incubator at 37˚C with 5% CO2. Explants cultures were

observed daily under a phase contrast microscope for

outgrowth of cells from partially digested tissue frag-

ments. After 5th day many cells were seen outgrowing

from tissue, which were adhered to the bottom of the

petridish. These adhered cells were fed with fresh

growth media three times in a week. These adhered cells

started to multiply and reached confluent within 15 - 20

days. After attending confluency, the cells were passaged

using 0.25% Trypsin-EDTA and plated in new 50 mm

tissue culture flasks. The same procedure was repeated

after every confluency and cells were crypreserved at

–85˚C.

2.2. Phase Contrast Microscop y

The morphology of cultured cells was observed using

phase contrast microscope equipped with TSview soft-

ware (Tucsen Imaging, Fuzhou, PR China) for observing

and capturing the images. Cells were regularly moni-

tored and images were captured for analysis.

2.3. Cryopreservation and Revival

Semi-confluent cultures of isolated breast cancer stem

cells were trypsinized with 0.25% Trypsin-EDTA for 3 -

5 minutes, centrifuged and washed with 1X PBS. The

cell pellet was suspended slowly in ready-made cell

freezing medium (Himedia, India) and transferred into

the cryovial and store at −85˚C. For revival, vials were

thawed and freezing medium was replaced by freshly

prepared DMEM medium. These cells maintained 90%

viability after revival.

2.4. Molecular Characterization of Breast

Cancer Stem Cells

Total RNA was extracted from tumor tissue of breast

cancer patient (In vivo study) and isolated breast cancer

stem cells (In vitro study) by using Trizol Reagent (Invi-

trogen, Carlsbad, CA). RNA was transcribed to cDNA

by using Applied Biosystems High Capacity cDNA Kit.

(Applied Biosystem, USA). The molecular markers

study was carried out by RT/PCR for Mesenchymal

phenotypes (CD105, CD13, CD73), Hematopoietic

phenotypes (CD34, CD45), Pluripotency and differenti-

ating markers (Oct4, Nanog, SOX2, LIF, Keratin18 and

Actin), Oncogenic markers (c-MYC, BCL2, COX2,

DAPK, EGFR and CD44), Make Singular - Cytokine

and Chemokine (IL6, TNF, SDF1 and CXCR4) and

BRCA2 gene mutation. PCR conditions and primer se-

P. Potdar et al. / Stem Cell Discovery 3 (2011) 21-28

2323

quences were described previously by Potdar and Sutar

2010 [24] whereas, sequences and their respective PCR

conditions for other than reported genes are listed in

Table 1. The PCR products were checked for their re-

spective amplification on 2% Agarose gel electrophore-

sis and photographed under UV light.

2.5. DNA Se quencing of BRCA2 Gene

Exon 11E of BRCA2 gene was amplified by PCR us-

ing the primer combination shown in Table 1. The PCR

product was sequenced using ABI 3100 Genetic analyzer

using BigDye Terminator reaction (Applied Biosystems,

Warrington, UK). The sequenced obtained were ana-

lyzed by using Bioedit software and the mutation ob-

tained was confirmed by repeating same sample for se-

quencing. Both sense and antisense strand sequencing

were carried out to confirm this mutation reported in this

study.

3. RESULTS

3.1. Isolation of Human Breast Cancer

Mesenchymal Stem Cells (hBCMSCs)

from Human Non-Metastasis Breast

Cancer Tumor

The breast cancer stem cells were isolated and cul-

tured from non-metastasis breast cancer tumor is de-

scribed above. Culture dishes were regularly monitored

under phase contrast microscope for any out growth of

the breast cancer cells from breast cancer explants. Out-

growth of these cells was seen within 5 - 6 days of cul-

ture, from explant as shown in Figure 1(a). These cells

showed various morphological features from fibroblasts

like appearance to epithelial and endothelial cells like

appearance as shown in Figures 1(b)-(d). The cells

showed high rate of multiplication and observed many

mitotic cells. These cells became confluent within 20 -

25 days as shown in Figure 2(a). These cells were regu-

larly washed and fed with usual growth medium de-

scribed in material method. After confluency, cells were

passaged by trypsinisation with 0.25% PBS/Trypsin and

transferred into 50 mm culture flask. This process was

repeated several times after cell reached to confluency

and cryopreserved at different passages and kept at

–85˚C for future studies. Thus, this study has established

breast cancer stem cell line and was designated as human

Breast Cancer Mesenchymal Stem Cells (hBCMSCs) line

after confirming their phenotypes by molecular markers

described below. Presently, these cells are at passage 18

and still growing well (Figure 2(a)). It was also ob-

served that several cells developed mammosphere for-

mation and pluripotent clones as shown in Figures 2(b)

and (c).

Table 1. Shows sequences of primers used for respective molecular marker.

Primer Sequence 5’→ 3’ Annealing (℃) Size (bp)

Upstream CAACCCTACTGATGATGACG

CD 44 Downstream GGATGCCAAGATCATCAGCC 60 302

Upstream TCTCAGCAACATGTCGATGG

EGFR Downstream TCGCACTTCTTACACTTGCG 60 473

Upstream GCCTCAGACTGCATCGAC

C-MYC Downstream GTTGACCTTGGTCTGGTAGG 60 251

Upstream TTCAAATGAGATTGTGGGAAAATTGCT

COX 2 Downstream AGATCATCTCTGCCTGAGTATCTT 68 305

Upstream CATTTCCACGTCAACAGAATTG

BCL 2 Downstream AGCACAGGATTGGATATTCCAT 60 505

Upstream TGACAGTTTATCATGACCGTGTTCAG

DAPK Downstream GTGCTGGATCTCCTTCAGGAT 60 231

Upstream CGAGTGACAAGCCTGTAGCC

TNF alpha Downstream GTTGACCTTGGTCTGGTAGG 58 555

Upstream GTCTCCTCATTGAATCCAGATTGG

IL 6 Downstream AGCTCAGCTATGAACTCCTTCTC 58 328

Upstream TGATCGTCTGACTGGTGTTA

SDF1 alpha Downstream CTTAGGGGATTTGGAAGTTT 57 188

Upstream GGACCTGTGGCCAAGTTCTTAGTT

CXCR4 Downstream ACTGTAGGTGCTGAAATCAACCCA 57 273

Upstream CTGAACATAACATTAAGAAGAGC

BRCA 2

11E Downstream GTCTACCTGACCAATCGATG 60 473

P. Potdar et al. / Stem Cell Discovery 1 (2011) 21-28

(a) (b) (c) (d)

Figure 1. Shows human Breast Cancer Mesenchymal Stem Cells (hBCMSCs) derived from Breast cancer non- metastasis

tumor outgrowing from explants on 5th day of culture (a), Epithelial (b), Endothelial (c) and Fibroblast like hBCMSCs cells

(d).

(a) (b) (c)

Figure 2. Shows confluent culture of hBCMSCs cell line grown as monolayer cells (a), mammospheres formation (b) and

pluripotency clone (c).

3.2. Phase Contrast Microscop y of

hBCMSCs Cell Line

Phase contrast microscopy of hBCMSCs cell line was

shown in Figures 1(a)-(d) and Figures 2(a)-(c). There

are different cell types were seen emerging from ex-

plants confirming the heterogeneous population of breast

cancer cells associated with breast cancer development.

Figure 1(b) shown epithelial like cells emerging from

explants with epithelial sheet like structure having large

nuclei and dense cytoplasm whereas, Figure 1(c) shown

endothelial like cells, which are elongated and randomly

scatter cells with scanty cytoplasm having large nucleus

with 1 - 2 nucleoli. Figure 1(d) showed Geimsa stained

typical fibroblast like mesenchymal cells having scanty

cytoplasm, large nucleus and nucleoli with cytoplasmic

granules. Figure 2(a) showed a confluent culture with

elongated morphology. Figure 2(b) showed cells have

mammosphere formation during growth of these cells

whereas; Figure 2(c) showed formation of pluripotency

clone in growing culture.

3.3. Molecular Marker Analysis of Human

Breast Cancer Tumor and hBCMSCs

Cell Line

The present study was undertaken to find out molecu-

lar characterization of human breast cancer tumor (in

vivo) and hBCMSCs cell line (in vitro) to confirmed

specific phenotypes of these cells by using specific set of

stem cell markers such as mesenchymal stem cell mark-

ers, hematopoetic stem cell markers, pluripotency mark-

ers, oncogenic markers, cytokines and chemokines mar-

kers.

3.4. Selection of Positive Controls

RNA from CML, Normal blood cells and SCAT cell

line developed in our laboratory (24) were use as posi-

tive control for (CD105, CD45, CD34), (SOX2, Oct4,

Nanog, LIF, Keratin18, and DAPK) and (CD13, CD73,

COX2 and IL-6) respectively [24]. K562 cells were use

for positive control for c-MYC gene. Amplified PCR

products were sequenced for confirmation of required

P. Potdar et al. / Stem Cell Discovery 3 (2011) 21-28

2525

gene sequences using specific primers. The sequences

obtained for each gene were confirmed from NCBI da-

tabase using BLAST software [data not shown] and

shown 100% match for these specific genes reported

here. On the basis of this, positive controls were selected

for this study.

3.4.1. Mesenchymal and Hema topoietic Markers

in Human Breast Tumor Cells and

hBCMSCs Cell Line

Mesenchymal and hematopoietic markers expression

in human breast tumor cells and hBCMSC cells is shown

in Figure 3. It was showed that tumor cells did not ex-

press CD105, CD13 and CD73 genes whereas, hBC-

MSCs cell line showed higher expression of all three

genes, thus confirming their mesenchymal stem cell

phenotypes. These cells also mildly expressed CD34 but

showed negative expression of CD45 gene indicating

that hBCMSCs cells may have hematopoetic phenotypes.

Both these genes were not expressed in tumor tissue.

3.4.2. Pluripotency Markers in Human Breast

Tumor Cells and hBCMSCs Cell Line

We have studied expression of Oct4, Nanog, SOX2,

LIF and Keratin18 genes as markers for pluripotency

and differentiation in tumor cells and in hBCMSCs cell

line respectively as shown in Figure 4. We have observed

that Oct 4, Nanog and SOX2 were expressed at in vivo

cells whereas, in hBCMSCs cell line Oct 4, Nanog were

mildly expressed and SOX2 was shown to be down reg-

ulated (Figure 4) indicate that SOX2 plays some role in

pathogenesis of Breast cancer and needs further investi-

gation. Differentiation markers LIF and keratin18 were

expressed equally in vivo and in vitro cells (Figure 4).

Figure 3. Shows expression of mes-

enchymal and hematopoietic stem

cell markers in Breast cancer tumor

tissue (in vivo) and in hBCMSCs cell

line (in vitro).

Figure 4. Shows expression of pluri-

potency stem cell markers in Breast

cancer tumor tissue (in vivo) and in

hBCMSCs cell line (in vitro).

3.4.3. Oncogenic Markers in Human Breast

Tumor Cells and hBCMSCs Cell Line

As hBCMSCs cell line was derived from non-metas-

tasis tumor cells, we thought of studying oncogenic

markers expression in these cells. We studied c-MYC,

COX2, BCL2, CD44, EGFR, and DAPK genes in tumor

as well as hBCMSCs cells as shown in Figure 5. It was

observed that c-MYC, EGFR, CD44, DAPK and BCL2

genes were expressed in hBCMSCs cell line whereas

only BCL2 and COX2 genes were expressed by tumor

tissue (Figure 5). Within these expressions, CD44 was

shown to be highly expressed in hBCMSCs cell line

confirming, the presence of initiating breast cancer tu-

mor cells. Expression of DAPK in tumor cells and

hBCMSCs cell line also confirmed their premalignant

status, as DAPK, a tumor suppressor gene expressed in

normal and initiated cells (Figure 5). These results were

further confirmed by studying chemokine receptor

CXCR4 expression in tumor and hBCMSCs cells. It was

also observed that CXCR4 gene was prominently ex-

pressed in tumor but mildly expressed in hBCMSCs cell

line indicating that the hBCMSCs cells isolated from

tumor were not metastatic but they are breast cancer

initiated cells. We also observed expression of SDF1 in

tumor and hBCMSCs cell line (Figure 6(b)). As cyto-

kines play very important role in mammary carcino-

genesis, we have studied expression of IL6 and TNF in

tumor and hBCMSCs cell line (Figure 6(a)). We ob-

served that TNF was expressed prominently in tumor

but shown mild expression in hBCMSCs cell line. Simi-

larly tumor tissue cells expressed mild expression of IL6

whereas, hBCMSCs cells showed significantly higher

expression of IL6 indicating specific role of IL6 in

breast carcinogenesis as reported by various investigator

[25].

P. Potdar et al. / Stem Cell Discovery 1 (2011) 21-28

3.4.4. Expression of BRCA2 Gene Mutation in

Human Breast Tumor Cells and hBCMSCs

Cell Line

As our laboratory has established a founder mutation

in BRCA2 gene in Indian breast cancer patients [23], we

thought of evaluated this BRCA2 mutation in tumor

tissue as well as in hBCMSCs cell line by DNA se-

quencing (Figure 6(c)). We did find the mutation at exon

11E of BRCA 2 gene in tumor as well as hBCMSCs

cells indicating the cells isolated from tumor cells have

similar characteristic, as it appeared in vivo. Thus, we

can conclude that the cell line isolated from non-metas-

tasis breast cancer tumor is none other than Initiated

breast cancer stem cells causing tumor in humans.

Figure 5. Shows expression of oncogenic

cell markers in Breast cancer tumor tis-

sue (in vivo) and in hBCMSCs cell line

(in vitro).

(a)

(b)

(c)

Figure 6. (a) Shows expression of cytokine markers in

Breast cancer tumor tissue (in vivo) and in hBCMSCs cell

line (in vitro); (b) shows expression of chemokine markers

in Breast cancer tumor tissue (in vivo) and in hBCMSCs

cell line (in vitro); (c) shows electropherograms of exon 11E

of BRCA2 gene mutation (A3624G) observed in tumor

tissue as well as in hBCMSCs cell line.

4. DISCUSSION

Breast cancer is a complex disease, with multiple ge-

netic and environmental factors involved in its aetiology.

Recent advances in stem cell research have demon-

strated that the cancers originally develop from normal

cells, which gain the ability to proliferate aberrantly and

eventually turn malignant [1]. These malignant cells

have been defined as cancer stem cells. These cells have

exclusive ability to self-renewal and to differentiate into

the heterogeneous lineages of cancer cells that comprise

the tumor [1]. Two of major challenges in breast cancer

studies are 1) Isolation of Breast cancer stem cells from

breast tumor tissue and 2) identify breast cancer stem

cells using specific stem cell markers. The technology

for isolating Breast cancer stem cells from breast tumor

has been shown that CD24low/− CD44+ are a define popu-

lation of cells of potential breast cancer stem cells [5]. In

present study, we have examined non-metastasis breast

tumor for the presence of Breast cancer stem cells and

characterized them using molecular markers. We are the

first to isolate human breast cancer mesenchymal stem

cells from non-metastasis breast tumor. We have desig-

nated this cell line as human Breast Cancer Mesenchy-

mal Stem Cells (hBCMSCs), which is presently at pas-

sage 18. Recent studies have suggested the existence of

stem cells in the human mammary gland and shown

non-adherent mammospheres secretary cancer stem cells

with progenitor cell properties [12,13]. In our study, we

have observed similar phenomenon of formation of

mammospheres by hBCMSCs cells indicating clearly

that the cells isolated from non- metastatic tumor are

Breast cancer initiated stem cells.

Mesenchymal characteristic of these cells were con-

firmed by examination of CD105, CD13 and CD73

markers, which are putative markers for Mesenchymal

Stem Cells [14]. These cells also expressed hematopoi-

P. Potdar et al. / Stem Cell Discovery 3 (2011) 21-28

2727

etic marker represented partial phenotype of hematopoi-

etic stem cells [15]. Shi et al. (2006) have shown that

transcription factors Oct-3/4, Nanog and SOX2 maintain

the expression of Pluripotent factors at a steady state [26]

whereas; Wilson et al. (1988) have shown that the LIF

maintains the developmental potential of embryonic

stem cells, which can be regarded as a pluripotency

marker [20]. In present study Breast cancer tumor cells

and hBCMSCs cells expressed Oct4, Nanog and LIF

showing their pluripotency. Expression of keratin 18 in

tumor cells and hBCMCSs cell line confirmed the

epithelial origin of these cells [27].

After establishment of breast cancer stem cell line, it

was very essential to know whether, the cell line pos-

sesses normal or malignant phenotypes so we have util-

ized oncogenic markers such as CD44, EGFR, c-MYC,

DAPK, COX2, BCL2, and SOX2 to study the malig-

nancy nature. Oncogenes overexpression is a common

phenomenon in the development and progression of

many human cancers hence it provide potential target for

cancer gene therapy [28]. Breast cancer cells were het-

erogeneous with respect to expression of a variety of cell

surface markers including CD44 and CD24. CD44 is a

complex transmembrane glycoprotein whose expression

is associated with drug resistance and metastatic pro-

gression in malignancy [21]. In present study, we have

shown that significant expression of CD44 in hBCMSCs

cell line and mild expression in tumor cells indicating

that the cells isolated from heterogeneous population of

tumor cells are breast cancer initiated cells. Studies have

shown that oncogenes c-MYC, COX2, EGFR and

DAPK plays important role in development of breast

cancer whereas, their overexpression or loss of expres-

sion is useful to study correlation with invasive potential

and metastasis in aggressive tumors and neoplastic tis-

sues[18,19,29,30]. Similarly expression of BCL2 and

SOX2 may be associated with metastasis, proliferation

and tumorigenesis of breast cancer cells [31,32]. Here in

the present study, there was significant expression of

c-MYC and EGFR in hBCMSCs cell line whereas, in

vivo study of tumor cells showed mild expression of

COX2 and down regulation of DAP Kinase gene sug-

gesting that the hBCMSCs cell lines contains initiated

breast cancer stem cells which may became transformed

to metastatic cancer cells when triggered by endogenous

factors.

Cytokines, such as IL-6 and Tumor Necrosis Factor

(TNFα), have an important role in regulating estrogen

synthesis and shown in vitro expression by aggressive

mesenchymal/basal-like breast cancer cell lines, tissues

and xenograft which promote malignant features in

breast cancer cells [25,33]. In present study, we found

low expression of IL6 in tumor cells whereas, signifi-

cantly high expression in hBCMSCs cell line which con-

firmed with the finding of other investigators [25,33].

Chemokine receptor CXCR4 showed significant high

expression in many solid tumors and also involved in

cell migration and invasion, as well as in angiogenesis

[34]. In present study, hBCMSCs cell line showed low

expression of CXCR4 indicating non-metastatic nature

of hBCMSCs cells isolated from tumor cells, which

showed significant high expression of CXCR4 gene.

We further thought of confirming cancer-initiated

cells by studying gene mutation in BRCA2 gene. Our

laboratory recently reported a specific founder mutation

in Exon 11E of BRCA2 gene in Indian population as an

early prognostic marker for Breast cancer [23]. In the

present study, we have sequenced DNA samples of

breast cancer tumor tissue and hBCMSCs cell line. Our

study showed that this founder mutation was at in vivo

and in vitro level indicating that the cells isolated from

non-metastasis breast cancer tumor are noting but Breast

cancer initiated cells which are responsible for develop-

ment of breast cancer.

Overall, this study establishes a technology for de-

velopment of breast cancer stem cell lines from

non-metastasis breast cancer tumor and represents an in

vitro model to understand the mechanism of Breast car-

cinogenesis. The identification of specific molecular

markers in these cells allows us to plan targeted thera-

pies for breast cancer.

5. ACKNOWLEDGEMENTS

We acknowledged with thanks the management of Jaslok Hospital

and Research Center, Mumbai, India for sanctioning and supporting

financial assistance for this stem cell research project No. 491. We are

also thankful to Dr. A. R. Khan, OT Manager for supplying us Breast

cancer Tumor tissues and Mrs. Naina Rane for technical help for this

study.

REFERENCES

[1] Smith, G.H. and Chepko, G. (2001) Mammary epithelial

stem cells. Microscopy Research and Technique, 15,

190-203.

[2] Pardal, R., Clarke, M.F. and Morrison, S.J. (2003) Ap-

plying the principles of stem-cell biology to cancer. Na-

ture Reviews Cancer, 3, 895-902.

[3] Lapidot, T., Sirard, C., Vormoor, J., Murdoch, B., Hoang,

T., Caceres-Cortes, J., Minden, M., Paterson, B., Caligi-

uri, M.A. and Dick, J.E. (1994) A cell initiating human

acute myeloid leukemia after transplantation into SCID

mice. Nature, 367, 645-648.

[4] Fidler, I.J. and Kripke, M.L. (1997) Metastasis results

from preexisting variant cells within a malignant tumor.

Science, 197, 893-895.

[5] Al-Hajj, M., Wicha, M.S., Benito-Hernandez, A., Morri-

son, S.J. and Clarke, M.F. (2003) Prospective identifica-

tion of tumorigenic breast cancer cells. Proceedings of

P. Potdar et al. / Stem Cell Discovery 1 (2011) 21-28

the National Academy of Sciences, 100, 3983-3988.

[6] Bonnet, D. and Dick, J.E. (1997) Human acute myeloid

leukemia is organized as a hierarchy that originates from

a primitive hematopoietic cell. Nature Medicine, 3,

730-737.

[7] Collins, A.T., Berry, P.A., Hyde, C., Stower, M.J. and

Maitland, N.J. (2005) Prospective Identification of tu-

morigenic prostate cancer stem cells. Cancer Research,

65, 10946-10951.

[8] Hemmati, H.D., Nakano, I., Lazareff, J.A., Master-

man-Smith, M., Geschwind, D.H., Bronner-Fraser M.

and Komblurn, H.I. (2003) Cancerous stem cells can

arise from pediatric brain tumors. Proceedings of the Na-

tional Academy of Sciences, 100, 15178-15183.

[9] Kim, C.F., Jackson, E.L., Woolfenden, A.E., Lawrence,

S., Babar, I., Vogel, S., Crowley, D., Bronson, R.T. and

Jacks, T. (2005) Identification of bronchioalveolar stem

cells in normal lung and lung cancer. Cell, 121, 823-835.

[10] O’Brien, C.A., Pollett, A., Gallinger, S. and Dick, J.E.

(2007) A human colon cancer cell capable of initiating

tumor growth in immunodeficient mice. Nature, 445,

106-110.

[11] Potdar, P.D. and Subedi, R.P. (2011) Defining Molecular

Phenotypes of Mesenchymal and hematopoietic Stem

Cells derived from Peripheral blood of Acute Lympho-

cytic Leukemia patients for regenerative stem cell ther-

apy. Journal of Stem cells & Regenerative Medicine, 7,

29-40.

[12] Grimshaw, M.J., Cooper, L., Papazisis, K., Coleman, J.A.,

Bohnenkamp, H.R., Chiapero-Stanke, L., Taylor-Papa-

dimitriou, J. and Burchell, J.M. (2008) Mammosphere-

culture of metastatic breast cancer cells enriches for tu-

morigenic breast cancer cells. Breast Cancer Research,

10, 52.

[13] Wicha, M., Liu, S. and Dontu, G. (2006) Cancer stem

cells: an old idea – a paradigm shift. Cancer Research,

66, 1883-1890.

[14] Barry, F.P., Boynton, R.E., Haynesworth, S., Murphy,

J.M. and Zaia, J. (1999) The monoclonal antibody SH-2,

raised against human mesenchymal stem cells, recog-

nizes an epitope on endoglin (CD105). Biochemical and

Biophysical Resear ch Comm un i c a t io n s, 265, 134-139.

[15] Healy, L., May, G., Gale, K., Grosvel, F., Greaves, M.

and Enver, T. (1995) The stem cell antigen CD34 func-

tions as a regulator of hemopoietic cell adhesion. Pro-

ceedings of the National Academy of Sciences, 92,

12240-12244.

[16] Ogata, K., Satoh, C., Tachibana, M., Hyodo, H., Tamura,

H., Dan, K., Kimura, T., Sonoda, Y. and Tsuji, T. (2005)

Identification and hematopoietic potential of CD45-

clonal cells with very immature phenotypes (CD45-

Cd34-Cd38-Lin-) in patients with myelodysplastic syn-

dromes. Stem Cell, 23, 619-630.

[17] Olamura-Nakanishi, S., Saito, M., Niwa, H. and Isshil-

cawa, F. (2005) Oct-3/4 and Sox2 regulate Oct-3/4 gene

in embryonic stem cells. Journal of Biological Chemistry,

22, 5307-5317.

[18] Prescott, S.M. and Fitzpatrick, F.A. (2000) Cyclooxy-

genase-2 and carcinogenesis. Biochimica et Biophysica

Acta, 1470, M69-M78.

[19] Katzenellenbogen, R.A., Baylin, S.B. and Herman, J.G.

(1999) Hypermethylation of the DAP-Kinase CpG island

is a common alteration in B-cell malignancies. Blood, 93,

4347-4353.

[20] William, R.L., Hilton, D.J., Pease, S., Willson, T.A.,

Stewart, C.L., Gearing, D.P., Wagner, E.F., Metcalf, D.,

Nicola, N.A. and Gough, N.M. (1988) Myeloid leukae-

mia inhibitory factor maintains the developmental poten-

tial of embryonic stem cells. Nature, 336, 684-687.

[21] Draffin, J.E., McFarlane, S., Hill, A., Johnston, P.G. and

Waugh, D.J. (2004) CD44 potentiates the adherence of

metastatic prostate and breast cancer cells to bone mar-

row endothelial cells. Cancer Research, 64, 5702-5711.

[22] Schabeth, H., Runz, S., Joumaa, S. and Altevogt, P. (2006)

CD24 affects CXCR4 function in pre-β lymphocytes and

breast carcinoma cells. Journal of Cell Science, 119,

314-325.

[23] Potdar, P.D. and Bisht, S. L. (2009) Identification and

screening for novel mutations in exon 10 and exon 11 of

BRCA 1 and BRCA 2 genes in hereditary and sporadic

breast cancer patients in Indian population- concept for

biomarkers for early detection. Annals of Oncology, 20,

51.

[24] Potdar, P.D. and Sutar, J. P. (2010) Establishment and

molecular characterization of mesenchymal stem cell

lines derived from human visceral & subcutaneous adi-

pose tissues. Journal of Stem cells & Regenerative Medi-

cine, 6, 1-10.

[25] Knupfer, H. and Preiss, R. (2007) Significance of inter-

leukin-6 (IL-6) in breast cancer. Breast Cancer Res Treat,

102, 129-35.

[26] Shi, W., Wang, H., PanYijie, G., Yunqian, G., Pei, G.,

(2006) Regulation of the Pluripotency Marker Rex-1 by

NANOG and SOX2. Journal of Biological Chemistry,

281, 23319-23325.

[27] Ku, N., et al. (1997) Mutation of human keratin 18 in

association with cryptogenic cirrhosis. Journal of Clini-

cal Investigation, 99, 19-23.

[28] Malumbres, M. and Barbacid, M. (2001) To cycle or not

to cycle: a critical decision in cancer. Nature Reviews

Cancer, 1, 222-231.

[29] Nesbit, C.E., Tersak, J.M. and Prochownik, E.V. (1999)

MYC oncogenes and human neoplastic disease. Onco-

gene, 18, 3004-3016.

[30] Bhargava, R., Gerald, W.L., Li, A.R., Pan, Q., Lal, P.,

Ladanyi, M. and Chen, B. (2005) EGFR gene amplifica-

tion in breast cancer: Correlation with epidermal growth

factor receptor mRNA and protein expression and HER-2

status and absence of EGFR-activating mutations. Mod-

ern Pathology, 18, 1027-1033.

[31] Swellam, M., Ismail, M., Eissa, S., Hamdy, M. and Mok-

htar, N. (2004) Emerging role of P53, Bcl-2 and telom-

erase activity in egyptian breast cancer patients. IUBMB

Life, 56, 483-490.

[32] Chen, Y., Shi, L., Zhang, L., Li, R., Liang, J., Yu, W., Sun,

L., Yang, X., Wang, Y., Zhang, Y. and Shang, Y. (2008)

The molecular mechanism governing the oncogenic po-

tential of SOX2 in breast cancer. The Journal of Bio-

logical Chemistry, 283, 17969-17978.

[33] Charafe-Jauffret, E., et al., (2006) Gene expression pro-

filing of breast cell lines identifies potential new basal

markers. Oncogene, 25, 2273-2284.

[34] Smith, M.C.P., Luker, K.E., Garbow, J.R., et al., (2004)

CXCR4 regulates growth of both primary and metastatic

breast cancer. Cancer Research, 64, 8604-8612.