Vol.1, No.1, 1-15 (2011)
doi:10.4236/scd.2011.11001
C
opyright © 2011 SciRes. Openly accessible at http://www.scirp.org/journal/SCD/
Stem Cell Discovery
Analysis of proteomic profiling of mouse embryonic
stem cells derived from fertilized, parthenogenetic and
androgenetic blastocysts
Xiang-Shun Cui1, Xing-Hui Shen2, Chang-Kwon Lee3, Yo ng-Kook Kang4,
Teruhiko Wakayama5, Nam-Hyung Kim1,*
1Department of Animal Science, Chungbuk National University, Cheongju, Chungbuk, Korea
2Department of Histology and Embryology, Harbin Medical University, Harbin, Heilongjiang Province, China
3Department of Physiology, Konkuk University, Chungju City, Chungbuk, Korea
4Laboratory of Development and Differentiation, Korea Research Institute of Bioscience and Biotechnology, Daejeon, South Korea
5Center for Developmental Biology, RIKEN Kobe, Kobe, Japan; [email protected]
Received January 23 2011; revised March 13 2011; accepted March 20 2011.
ABSTRACT
Embryonic stem cells (ESCs) are derived from
the inner cell mass (ICM) of preimplantation
embryos. ESCs exhibit true pluripotency, i.e.,
the ability to differentiate into cells of all three
germ layers in the developing embryo. We used
2-DE MALDI-TOF/TOF to identify differentially
expressed proteins among three types of mouse
embryonic stem cells (ESCs) derived from fer-
tilized, parthenogenetic, and androgenetic (fESC,
pESC and aESC, respectively) blastocysts. We
detected more than 800 proteins on silver-
stained gels of whole protein extracts from each
type of ESC. Of these, 52 differentially expressed
proteins were identified by the MALDI–TOF/TOF
analyzer, including 32 (fESCs vs. pESCs), 28
(fESCs vs. aESCs) and 17 (pESCs vs. aESCs)
prominent proteins with significantly higher or
lower expression relative to the comparison
cells. Among the 32 proteins from fESCs, 12
were significantly increased in expression and
20 were reduced in expression in fESCs com-
pared with pESCs. Similarly, 10 of 28 and 8 of 17
proteins were more highly expressed in fESCs
and pESCs compared with aESCs, respectively.
In contrast, 18 of 28 and 9 of 17 proteins were
reduced in expression in fESCs and pESCs
compared with aESCs, respe ctiv ely . Of the e ight
protein candidates in fESCs, four were in-
creased and four were decreased in expression
relative to both pESCs and aESCs in the 2-DE
analysis. Differential expression of these pro-
teins were confirmed by mRNA expression
analysis using real time RT-PCR. For three pro-
teins, ANXA5, CLIC1 and SRM, Western blot
analysis corroborated the expression patterns
indicated by the 2-DE results. ANXA5 and CLIC1
were increased in expression and SRM was de-
creased in expression in fESCs compared with
both pESCs and aESCs. The differentially ex-
pressed proteins identified in the present study
warrant fu rther inv estigat ion to wards the g oal of
their potential application in ESC therapy.
Keywords: Protein Profiling; Embryonic Stem Cell;
Parthenogenote; Androgenote; Fertilization
1. INTRODUCTION
The field of stem cell biology has attracted increasing
attention in recent years due to the plasticity of stem
cells and their broad potential for use in cell therapy.
Despite this focus, relatively little is known about the
mechanisms underlying the regulation and thereby the
potential for the manipulation of stem cells for clinical
applications. Embryonic stem cells (ESCs) are pluripo-
tent cells derived from the inner cell mass (ICM) of
blastocysts. ES cells can proliferate indefinitely in vitro
and can differentiate into a wide variety of cell types
both in vivo and in vitro [1,2]. Because of their excep-
tional properties, ESCs have enormous potential to be
used for developmental biology studies, drug screening,
tissue engineering and transplantation therapy.
Recently, stem cell research has begun to be applied
in clinical settings. ESCs could be especially helpful
therapeutically in that they could help to overcome im-
mune rejection problems. In particular, parthenogenetic
embryonic stem cells (pESCs) could advance the field of
regenerative medicine by avoiding the immune rejection
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. Openl y accessible at http://www.scirp.org/journal/SCD/
2
problems inherent in transplantation. pESCs are able to
differentiate into cell types from all three germ layers
and are immunologically matched with their oocyte do-
nors [3]. The other uniparental cells, androgenetic ES
Cells (aESCs), can be established from androgenotes,
which cannot develop into viable fetuses. Like pESCs,
aESCs can also be generated with a full complement of
major histocompatibility complex antigens [4]. A previ-
ous report suggested that pESCs were indistinguishable
from ESCs derived from fertilized embryos (fESCs) [5].
However, a detailed understanding of signalling path-
ways and molecular mechanisms involved in biparental
and uniparental pluripotency will be essential before
using them in ESC-based therapies.
Over the past few years, there has been a growing in-
terest in applying proteomics to the study of proteins in
ESCs [6,7]. Although previous studies have generated a
wealth of data, the molecular mechanisms that determine
the characteristics of ESCs remain largely unknown. In
general, little is known about the functional aspects of
ESC-specific proteins. Moreover, in contrast to fESCs,
no detailed comparisons of the proteins expressed in
pESCs and aESCs have been undertaken. In this study,
we used two-dimensional gel electrophoresis (2-DE) and
matrix-assisted laser desorption/ionization time-of-flight
mass spectrometry (MALDI-TOF/TOF MS) to analyze
protein patterns in mouse ESCs. This is the first report to
display the global cellular protein profiles in mono- and
bi-parentally derived ESCs, and in particular to identify
the protein signatures for multipotency in fESCs, pESCs
and aESCs.
2. MATERIALS AND METHODS
2.1. Cell Culture, Differentiation in Vitro and
Sample Preparation
Mouse ES cell lines, derived from fertilized (fESC1
and 2, line 1 and 2, respectively), parthenogenetic
(pESC1 and 2), and androgenetic (aESC1 and 2) blasto-
cysts, were kindly provided by Dr. Wakayama (Center
for Developmental Biology, RIKEN Kobe, Japan). Each
type of blastocysts were generated by fertilization, par-
thenogenetically activated by strontium chloride (SrCl2)
following cytochalasin B (CB, Sigma) treatment 6 h and
two sperm heads were injected into enucleated oocytes
for generation of androgenote embryos. Embryos were
cultured in M16 medium for 4 days. ESCs were estab-
lished based on general methods using inner cell mass
(ICM) of single blastocyst. The fESC1, pESC1 and
aESC1 cell lines were used for two-dimensional gel
electrophoresis (2-DE) analysis, and experiments were
repeated three times using passages 6, 7 and 8, respec-
tively. All ESCs were maintained on non-gelatin coated
dishes in DMEM (high glucose; Invitrogen, Carlsbad,
CA, USA) supplemented with 15% fetal calf serum, 0.1
mM b-mercaptoethanol, 1000 U/mL recombinant mouse
LIF (ESGRO; Chemicon International, Temecula, CA,
USA), 1% glutamine (Sigma, St Louis, MO, USA), 0.5%
penicillin/ streptomycin (Sigma), and 1% non-essential
amino acids (Sigma). fESCs, pESCs and aESCs were
differentiated by treatment with 1 mM retinoic acid (RA,
Sigma) for 6 days (fRA, pRA and aRA, respectively).
Protein samples were prepared essentially as de-
scribed in Lee et al. [8] reports. The cultured cells were
harvested with 2-DE lysis buffer containing 8 M Urea, 2
M thiourea, 100 mM DTT, 4% CHAPS and 1 × com-
plete protease inhibitor cocktail (Roche Applied Science,
Germany). The lysates were incubated for 20 min and
centrifuged at 12 000 × g for 10 min at 10. The su-
pernatants were diluted with rehydration buffer contain-
ing 7 M Urea, 2 M thiourea, 100 mM DTT, 2% CHAPS
0.5% ampolyte (Bio-Rad) and 0.01 % bromophenol blue,
and then used as the sample to 2-DE analysis.
2.2. 2-DE, in-Gel Digestion and MAL-
DI-TOF/TOF MS
2-DE was performed as described in Lee et al. [8].
Images of silver-stained gels were digitized with a den-
sitometer (VersaDoc Imaging System 1000TM). The gels
were normalized and statistically analyzed with PDQuest
software (Version 7.1.1, Bio-Rad).
In-gel digestion and identification of the altered pro-
tein spots were performed as reported previously. [8]
Briefly, the protein spots were digested with trypsin and
desalted with ZipTip C18 (Millipore). The peptide sam-
ples were mixed with CHCA matrix solution and then
analyzed by MALDI-TOF/TOF (AB4700, Applied Bio-
systems) in the reflector mode.
Spectra were processed and analyzed with the Global
Protein Server Explorer 3.0 software (Applied Biosys-
tems). The internal MASCOR (Matrix Science, UK)
program was used for matching MS and MS/MS data
against database information. The resulting data were
surveyed against mouse databases downloaded from
both NCBI and the Swiss Prot/TrEMBL homepage.
2.3. Genomic DNA Polymerase Chain
Reaction (PCR)
Whole genomic DNA was extracted by phenol/chlo-
roform method. PCR reaction was carried out in 25 μl
volumes, containing distilled water, 2.5 μl of reaction
buffer, 200 μM of dNTPs, 2.0 units of Taq DNA poly-
merase (Promega, USA), 10 mM of each primer for Zinc
finger protein 1, Y linked (Zfy1), Zinc finger protein
X-linked (Zfx) and Ras association domain family
member 1 (Rassf1) genes (Table 1), and about 100 ng of
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. http://www.scirp.org/journal/SCD/Openly accessible at
33
total DNA. Amplification was performed following con-
ditions: an initial 2-min denaturation at 94˚C was fol-
lowed by 30 cycles of 30 s at 94˚C, 45 s at 55˚C - 60˚C,
and 60 s at 72˚C. The PCR products for 3 genes were
separated on 2.0% agarose gels containing ethidium
bromide.
2.4. Reverse Transcriptase-Polymerase
Chain Reaction (RT-PCR) and Real
Time RT-PCR
Messenger RNA was extracted with the Dynabeads
mRNA Direct Kit (Dynal Asa, Oslo, Norway), standard
cDNA synthesis was achieved by reverse transcription
of RNA using the oligo(dT) 12 - 18 primer and super-
script reverse transcriptase (Invitrogen Co., Grand Island,
NY).
For determination of pluripotency and differentiation,
mRNA expression in the ESCs and differentiated cells
were analyzed by RT-PCR using cDNA as the template,
and following primers: POU domain, class 5, transcrip-
tion factor 1 (Pou5f1, Oct4), Nanog homeobox (Nanog),
Paired box gene 6 (Pax6), Nestin (Nes) and glyceralde-
hyde-3-phosphate dehydrogenase (Gapdh, Table 1).
Table 1. Primers used in PCR.
Name Acc. No. Sequence Length (bp)PCR
Zfy1 AK076618 F : gtaggaa gaat ctttctcatgctgg
R: tttttgagtgctgatgggtgacgg 217 Genomic DNA
Zfx AL626786 F : atggtacatgtctataatcttagcatt
R: ctaccagggattaaactggttaacat 210 Genomic DNA
Rassf1 NC_000075 F : tgaaacaccttccttcgaaatg
R: cacccttttcaagcttcagagtt 420 Genomic DNA
Oct4 NM_013633 F: tgtggacctcaggttggact
R: cttctgcagggctttcatgt 221 RT
Nanog NM_028016 F: aacgatatggtggctact ct c
R: tcggttcatcatggtacagt 264 RT
Pax6 NM_013627 F: ctgcagacccatgcagatgcaaa
R: aagtcgcatctgagcttcatccg 519 RT
Nes NM_016701 F: aagctgaagctgcatttccttg
R: gtgctaagctgttttctactttt 550 RT
Gapdh NM_008084 F: aaaccrgccaagtat gat ga
R: gtggtccagggtttcttact 273 RT/Real time RT
Anxa5 NM_009673 F: gaagccctcacgactctacg
R: tatcccccaccacatcatct 179 Real time RT
Erp29 NM_026129 F: c ct gaa ga tc atggggaaga
R: ctcctccttctcagcctcct 172 Real time RT
Clic1 NM_033444 F: ctctggctcaagggagtcac
R: atatgtccagtcccgaggtg 232 Real time RT
Po protein X15267 F: tgccacactccatcatcaat
R: cgaagagaccgaatcccata 240 Real time RT
Srm NM_009272 F: gtcctacgggaagtggtgaa
R: gtcctacgggaagtggtgaa 199 Real time RT
Strap NM_011499 F: tcagtcctgatggggaactc
R: tctggaaatccgatctttgg 154 Real time RT
Sod1 AH002084 F: ccagtgcaggacctcatttt
R: ttgtttctcatggaccacca 197 Real time RT
Esrra NM_007953 F: ccaggcttctcctca c t g t c
R: gccccctcttcatctaggac 152 Real time RT
Bcl-xL L35049 F: ttcgggatggagtaaactgg
R:tggatccaaggctctaggtg 157 Real time RT
Birc5 NM_009689 F: gaatcctgcgtttgagtggt
R: aaaacactgggccaaatcag 221 Real time RT
Casp3 BC038825 F: gggcc tgttg aact gaaaaa
R: ccgtcctttgaatttctcca 242 Real time RT
Bax NM_007527 F: tgcagaggatgattgctgac
R: gatcagctcgggcactttag 183 Real time RT
F, forward; R, reverse.
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. Openl y accessible at http://www.scirp.org/journal/SCD/
4
Gapdh amplification was used as a loading control for
the sample. PCR conditions were as follows95˚C for 30
s, 55˚C - 60˚C for 30 s and 72˚C for 1 min. The PCR
products for 5 genes were separated on 2.0% agarose
gels containing ethidium bromide.
Cell lines from fESC1/2, pESC1/2, and aESC1/2 were
used for real time RT-PCR. Real-time RT-PCR was
performed using the 13 primer sets shown in Table 1
using the DNA Engine OPTICOJ 3 (MJ research, USA).
Relative gene expression was quantified using the
2-ddCt method. Gapdh mRNA, a house keeping gene,
was employed as a control.
2.5. Western Blot Analysis
Western blot analysis was performed as described
previously [9]. Briefly, ESC lysates were separated by
electrophoresis in a CriterionTM Precast Gel (Bio-Rad,
Hercules, CA), followed by transfer to a PVDF mem-
brane (iBlot TM Gel Transfer Stacks, Cat. No.
IB4010-02; Invitrogen). After blocking, the membrane
was incubated with primary anti-ANXA5 (GenWay
Biotech, Inc., CA, USA), anti-CLIC1 (Aviva Systems
Biology, CA, USA), anti-SRM (GeneTex, CA, USA),
and anti-GAPDH (Cell Signaling Technology, Danvers,
MA, USA). Then, the membrane was incubated with
HRP-linked anti-rabbit IgG (Cell Signaling Technology).
Finally, the antibody-binding bands on the membrane
were visualized using Chemiluminescence Luminol Re-
agent (Invitrogen).
2.6. Statistical Analysis
The general linear model (GLM) procedure in the
SAS program [10] was applied to analyze data from all
experiments. Significant differences were determined
using Tukey’s multiple range test [11] and P < 0.05 was
considered statistically significant.
3. RESULTS
3.1. Sex Diagnosis and Characterization of
ESC and Differentiated Cell Lines
ESC lines which were established from Dr. Waka-
yama were well characterized for their pluripotency and
differentiation potential including karyotypping [12,13]
and chimera formation [14]. To determine accuracy of
genotype diagnosis of ESCs, PCR amplification of
Zfy1/Zfx were employed. Genes common to X and Y
chromosomes (ZFY/ZFX, zinc finger protein) can am-
plify by a single primer pair. As shown in Figure 1 (a),
both fESCs and aESCs contain both X and Y chromo-
somes, whereas pESCs only shows X chromosome, the
same to the adult somatic female cells (fm) that were
used as a positive control. Rassf1 was used as a genomic
DNA positive control, expressed all samples except for
negative control, no template group.
(a)
(b)
(c)
(d)
Figure 1. (a), Representative PCR sexing reactions. PCR
products were gene rated from embry onic stem cells (ESCs)
or adult somatic cells (ASCs). Characterization of pluripo-
tency (b) neuroprogenitors (c) and differentiated state 6
days after retinoic acid treatment (d) by RT-PCR. fES:
fertilized embryonic stem cells; aES: androgenetic embry-
onic stem cells; pES: parthenogene tic embryonic stem cells;
fm: adult female cells; m: adult male cells; -: no template.
fRA, aRA and pRA: fESC, aESC and pESC were differen-
tiated by retinoic acid, respectively. Adult somatic cells
(ASCs) from fm (female) and m (male) were used as posi-
tive control in (A); Rassf1 was used as genomic DNA posi-
tive control and no DNA template (-) was used as a negative
control in (a); NIH3T3 cell was used as a negative control
in (b); Gapdh was used as a positive control in (b), (c) and
(d).
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. Openl y accessible at http://www.scirp.org/journal/SCD/
55
Embryonic stem cells and ESC-derived neuroecto-
dermal spheres (NESs) were shown to have characteris-
tics typical of pluripotency and neuroprogenitors. RT-
PCR results showed that ESC marker genes Oct4 and
Nanog were expressed in ESC lines but did not express
in control (NIH3T3) cell line (Figure 1 (b)). An the oth-
er hand, neural stem cell marker genes such as Nes and
Pax6 were expressed at markedly increased levels in the
NESs compared with the ESCs (Figure 1 (c)). In con-
trast, Oct4 and Nanog were not expressed in fRA, pRA
and aRA cells which were treated with retinoic acid for 6
days, and all of them were shown with differentiated
state (Figure 1 (d)).
3.2. Comparative Proteomics in fESCs,
pESCs and aESCs
To identify differentially expressed proteins between
fESCs vs. pESCs, fESCs vs. aESCs, and pESCs vs.
aESCs, proteins were separated using the 2-DE tech-
nique, and experiments were repeated three times for
each ESC type, using different passages. Separated pro-
teins were visualized with silver staining and analyzed
with PDQuest software. Figures 2(a), 3(a) and 4(a )
show typical 2-DE gels of total ESC proteins for the
three groups. In total, more than 800 proteins may be
seen in each gel, with isoelectric pH values of pH 3–10
and molecular weights (MW) of 14 - 180 kDa. The
MALDI–TOF/TOF analyzer identified 52 differentially
expressed proteins among the three types of ESCs, with
gels placed side-by-side for ease of comparison between
groups (Figure 2(b), 3(b) and 4(b)). We identified 32
(fESCs vs. pESCs, Table 2), 28 (fESCs vs. aESCs, Ta-
ble 3), and 17 (pESCs vs. aESCs, Table 4) prominent
proteins in each comparison. Tables 2-4 list these pro-
teins, highlight representative peptide sequences and
sequence coverage, note the theoretical and experimental
isoelectric point (pI) and MW values, and provide acces-
sion numbers from both the Swiss-Prot and NCBI data-
bases.
(a)
(b)
Figure 2. Comparative analysis of protein expression patterns between fESCs and pESC s. (a) Silver-stained 2-DE gel of fESC
and pESC proteins. (b) Enlargement of 2-DE gel images of upregulated or downregulated proteins in fESCs and pESCs. The
statistical data were obtained from 2-DE gels in three independent experiments (P < 0.05). Arrows indicate altered proteins in
fESCs and pESCs. White bars, fESCs; blac k bar s, pESCs.
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. Openl y accessible at http://www.scirp.org/journal/SCD/
6
Table 2. Identification of differentially expressed proteins between fESCs and pESCs.
Protein pI/MW (kDa)
Spot
No.
Fold
Change
(pES/fES)
Protein Name Peptide Sequence SC
(%) Theoretical Experimental
Accession
No.
/Database
High-expression protein spots (relative to fESCs), (12)
1053 –51.53 Unnamed protein product DSNNLCLHFNPR 115.19/11.6 5.20/11.8 52890/NC
P48538/SP
1233 –22.05 Annexin A5 GTVTDFPGFDGR VLTEIIASR
GAGTDDHTLIR 104.83/35.7 4.80/35.4 6753060/NC
P48036/SP
2143 –4.61 Chloride intracellular channel 1 YLSNAYAR EEFASTCPDDEEIE-
LAYEQVAR 125.09/26.9 5.30/30.1
15617203/NC
Q9Z1Q5/SP
3102 –1.63 Prohibitin ILFRPVASQLPR 45.57 /29.8 5.70/29.5 6679299/NC
3134 –6.73
Endoplasmic reticulum protein
ERp29 precursor FDTQYPYGEK ILDQGEDFPASEMAR95.90/28.8 6.10.27.3 19526463/NC
P57759/SP
3233 –17.31 Annexin A3 LTFDEYR NTPAFLAER GAGT-
DEFTLNR 85.33/36.3 5.70/38.8 7304887/NC
O35639/SP
4311 –3.49 Oat protein KTEQGPPSSEYIFER
VLPMNTGVEAGETACK 76.19/48.3 6.20/48.0
14198116/NC
P29758/SP
5231 –2.97
Acidic ribosomal
phosphoprotein P0
GHLENNPALEK AGAIAP-
CEVTVPAQNTGLGPEK 105.91/34.1 6.40/37.5 6671569 /NC
P14869/SP
6124 –1.80 B-cell stimulating factor 3 LGAETLPR 38.70/25.2 7.50/29.0 9910314/NC
Q9QZM3/SP
6229 –3.76 Steroid hormone receptor ERR1 LVLSSLPK 16.84/49.2 7.30//40.5 O08580/SP
7024 –4.64
Trafficking protein particle
complex 5 VLDALVAR 49.69/20.7 8.20/19.3 29165850/NC
7314 –1.77
Branched-chain amino acid
aminotransferase
AGWGPPR LGGNYGPTVAVQR
TWGEFR 77.60/39.7 8.00/41.7 3298579/NC
O35855/SP
Low-expression protein spots (relative to fESCs), (20)
1133 +1.80
Ran-specific GTPase-activating
protein FASENDLPEWK 55.15/23.5 5.30/27.3 P34022/SP
1325 +2.11
Serine/threonine kinase receptor
associated protein FSPDGELYASGSEDGTLR 54.99/38.4 5.20/42.6
6755682/NC
Q9Z1Z2/SP
1332 +1.64 Galactokinase 1 GYALLIDCR LAVLITNSNVR
HSLGSSEYPVR 75.17/42.2 5.20/43.8
16741595/NC
Q9R0N0/SP
2103 +2.48 Ubiquitin thiolesterase PGP9.5 LGVAGQWR NEAIQAAHDSVA-
QEGQCR 115.12/24.7 5.30/25.2 92934/NC
Q9R0P9/SP
2213 +1.80 Spermidine synthase YQDILVFR VLIIGGGDGGVLR
AAFVLPEFTR 105.31/33.9 5.40/35.7 6678131/NC
Q9R0N0/SP
2342 +1.77
SGT1, suppressor of G2 allele
of SKP1
ALEQNPDDAQYYCQR
SLELNPNNCTALLR 85.32/38.1 5.40/43.0
23956176/NC
Q9CX34/SP
3009 +14.57 Stathmin 1 ASGQAFELILSPR 85.76/17.2 5.90/17.5 9789995/NC
P54227/SP
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. Openl y accessible at http://www.scirp.org/journal/SCD/
77
3334 +3.43 Steroid hormone receptor ERR1 LVLSSLPK 16.84/49.2 6.00/41.8 131224731/NC
4009 +2.16 DJ-1 protein VTVAGLAGKDPVQCSR
MMNGSHYSYSESR 156.32/19.9 6.20/22.5
16924002/NC
Q99LX0/SP
4011 +3.36 Cu/Zn-superoxide dismutase KHGGPADEER VISLSGEHSIIGR 146.23/15.9 6.20/16.0 201006 /NC
P08228/SP
4128 +1.73 Heat shock protein 27 LFDQAFGVPR AV-
TQSAEITIPVTFEAR 136.12/22.8 6.30/24.6 204665/NC
P14602/SP
4222 +8.40 Estrogen-related receptor alpha LV LVLSSLPK 15.77/45.0 6.30/33.2
6679693/NC
O08580/SP
5106 +2.89
Acyl-protein thioesterase 1 (Lyso-
phospholipase I) ASFSQGPINSANR 56.14/24.6 6.40/23.3 P97823/SP
5212 +3.50 Uridine phosphorylase 1 FVCVGGSSSR EYPNICAGTDR
MLYHAR CSNITIIR 116.12/34.0 6.50/33.3 6678515/NC
P52624/SP
6011 +1.60
Similar to basic transcription factor
3 VQASLAANTFTITGHAETK 347.85/19.4 7.60/18.5 51762066/NC
6106 +3.87 GTP-binding nuclear protein Ran FNVWDTAGQEK NVPNWHR VCE-
NIPIVLCGNK SIVFHR 177.01/24.4 7.00/24.5 P62827/SP
6128 +1.82
Glutathione S-transferase,
alpha 4
EKEESYDLILSR FLQPGSQR
KPPPDGPYVEVVR 146.77/25.5 7.10/23.3 6754082/NC
P24472/SP
6223 +2.67
L-lactate dehydrogenase
chain M
VIGSGCNLDSAR SLNPELGTDAD-
KEQWK SADTLWGIQK 117.62/36.4 7.50/37.6 65923/NC
P06151/SP
8011 +3.16
Proteasome (prosome, macropain)
subunit, beta type 5
RGPGLYYVDSEGNR GPGLY-
YVDSEGNR RAIYQATYR AIYQATYR
DAYSGGAVNLYHVR
146.52/28.5 8.50/21.3 6755204/NC
O55234/SP
8021 +413.80 Hypothetical protein VGPMLSPR 49.69/21.0 8.50/19.6
51767674/NC
Q7TQH0/SP
pES/fES: pESCs/fESCs.
Table 3. Identification of differentially expressed proteins between fESCs and aESC.
Protein pI/MW (kDa)
Spot
No.
Fold
Change
(aES/fES)
Protein Name Peptide Sequence SC
(%) Theoretical Experimental
Accession No.
/Database
High-expression protein spots (relative to fESCs), (10)
1053 –37.68 Unnamed protein DSNNLCLHFNPR 115.19/11.6 5.20/11.8 52890/NC
P48538/SP
1233 –3.23 Annexin A5 GTVTDFPGFDGR VLTEIIASR
GAGTDDHTLIR 104.83/35.7 4.80/35.4 6753060/NC
P48036/SP
2143 –3.51
Chloride intracellular
channel 1
YLSNAYAR
EEFASTCPDDEEIELAYEQVAR 125.09/26.9 5.30/30.1
15617203/NC
Q9Z1Q5/SP
3134 –13.01
Endoplasmic reticulum
protein ERp29 precursor
FDTQYPYGEK
ILDQGEDFPASEMAR 9 5.90/28.8 6.10.27.3 19526463/NC
P57759/SP
3233 –5.48 Annexin A3 LTFDEYR NTPAFLAER
GAGTDEFTLNR 8 5.33/36.3 5.70/38.8 7304887/NC
O35639/SP
3307 –1.61 Calponin 3, acidic RFDEGK CASQAGMTAYGTR GAS-
QAGMLAPGTR GMSVYGLGR 125.46/36.4 5.80/41.6
55391513/NC
Q9DAW9/SP
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. Openl y accessible at http://www.scirp.org/journal/SCD/
8
3312 –1.50 Unnamed protein APIQWEER CSDFTEEICR 4 6.27/39.6 5.90/41.4 26339056/NC
4311 –2.16 Oat protein KTEQGPPSSEYIFER
VLPMNTGVEAGETACK 7 6.19/48.3 6.20/48.0 14198116/NC
P29758/SP
5231 –5.55
Acidic ribosomal
phosphoprotein P0
GHLENNPALEK AGAIAP-
CEVTVPAQNTGLGPEK 105.91/34.1 6.40/37.5 6671569/NC
P14869/SP
5309 –1.94
Heterogeneous nuclear
ribonucleoprotein A/B EVYQQQQYGSGGR 4 7.68/30.8 6.50/43.6 Q99020/SP
Low-expression protein spots (relative to fESCs) (18)
1109 +2.97 14-3-3 protein gamma LAEQAER NVTELNEPLSNEER
MKGDYYR 114.80/28.3 4.80/28.1 3065929/NC
P68510/SP
1325 +1.89
Serine/threonine kinase
receptor-associated protein FSPDGELYASGSEDGTLR 5 4.99/38.4 5.20/42.6
6755682/NC
Q9Z1Z2/SP
1331 +2.05
B-cell stimulating factor-3
precursor (BSF-3) (Novel
neurotrophin-1) (NNT-1)
LGAETLPR 3 8.70/25.2 5.20/42.0 Q9QZM3/SP
2213 +1.76 Spermidine synthase YQDILVFR VLIIGGGDGGVLR
AAFVLPEFTR 105.31/33.9 5.40/35.7 6678131/NC
Q9R0N0/SP
2221 +1.83
Similar to hypothetical
protein MGC36907 NKYEDEINKR 3 5.42/36.2 5.50/36.3 34868312/NC
2317 +2.17
Ubiquitin-like 1 activating
enzyme E1A VDQICHR 2 5.24/38.5 5.40/43.7 Q9R1T2/SP
4009 +2.15 DJ-1 protein VTVAGLAGKDPVQCSR
MMNGSHYSYSESR 156.32/19.9 6.20/22.5
16924002/NC
Q99LX0/SP
4011 +2.47
Cu/Zn-superoxide
dismutase KHGGPADEER VISLSGEHSIIGR 146.23/15.9 6.20/16.0 201006/NC
P08228/SP
4222 +5.09
Estrogen-related
receptor alpha LV LVLSSLPK 1 5.77/45.0 6.30/33.2 6679693/NC
O08580/SP
4305 +1.76 eIF3-p44 CPYKDTLGPMQK
CPYKDTLGPMQK 3 6.08/35.3 6.10/47.8 4097873/NC
Q9Z1D1/SP
5212 +3.03
Uridine
phosphorylase 1
FVCVGGSSSR EYPNICAGTDR
MLYHAR CSNITIIR 116.12/34.0 6.50/33.3 6678515/NC
P52624/SP
6011 +1.56
Similar to basic
transcription factor 3 VQASLAANTFTITGHAETK 347.85/19.4 7.60/18.5 51762066/NC
6106 +1.95
GTP-binding nuclear
protein Ran
FNVWDTAGQEK NVPNWHR VCE-
NIPIVLCGNK SIVFHR 177.01/24.4 7.00/24.5 P62827/SP
6128 +1.88
Glutathione S-transferase,
alpha 4
EKEESYDLILSR FLQPGSQR
KPPPDGPYVEVVR 146.77/25.5 7.10/23.3 6754082/NC
P24472/SP
7011 +3.06
Thymidylate kinase;
TMK YAFSGVAFTGAK GEFGLER 8 9.16/25.5 8.00/22.8 1836042/NC
P97930/SP
7023 +1.63
Component C5 of
proteasome LSEGFSIHTR DVFISAAER 8 8.29/24.6 8.20/23.1 1165123/NC
O09061/SP
8011 +2.74
Proteasome (prosome,
macropain) subunit,
beta type 5
RGPGLYYVDSEGNR GPGLY-
YVDSEGNR RAIYQATYR AIY-
QATYR DAYSGGAVNLYHVR
146.52/28.5 8.50/21.3 6755204/NC
O55234/SP
8021 +562.88 Hypothetical protein VGPMLSPR 4 9.69/21.0 8.50/19.6
51767674/NC
Q7TQH0/SP
aES/fES: aESCs/fESCs.
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. Openl y accessible at http://www.scirp.org/journal/SCD/
99
Table 4. Summary of differentially expressed proteins betwee n pESCs and aE SCs.
Protein pI/MW (kDa)
Spot
No.
Fold
Change
(aES/pES)
Protein Name Peptide Sequence SC
(%) Theoretical Experimental
Accession No.
/Database
High-expression protein spots (relative to pESCs), (8)
3009 –2.13 Stathmin 1 ASGQAFELILSPR 8 5.76/17.2 5.90/17.5 9789995/NC
P54227/SP
3112 –2.00 Heat shock protein beta 1 LFDQAFGVPR
AVTQSAEITIPVTFEAR 126.45/22.8 5.90/25.2 7305173/NC
P14602/SP
3334 –2.27 Steroid hormone receptor
ERR1 LVLSSLPK 1 6.84/49.2 6.00/41.8 131224731/NC
4222 –1.65 Estrogen related
receptor alpha LVLSSLPK 1 5.77/45.0 6.30/33.2 6679693/NC
O08580/SP
5231 –2.38 Acidic ribosomal
phosphoprotein P0
GHLENNPALEK
AGAIAPCEVTVPAQNTGLGPEK 105.91/34.1 6.40/37.5 6671569/NC
P14869/SP
6106 –1.98 GTP-binding nuclear
protein Ran
FNVWDTAGQEK NVPNWHR
VCENIPIVLCGNK SIVFHR 177.01/24.4 7.00/24.5 P62827/SP
6223 –1.90 L-lactate dehydrogenase
chain M
VIGSGCNLDSAR
SLNPELGTDADKEQWK SADTLWGIQK 117.62/36.4 7.50/37.6 65923/NC
P06151/SP
8021 –1.90 Hypothetical protein VGPMLSPR 4 9.69/21.0 8.50/19.6 51767674/NC
Q7TQH0/SP
Low-expression protein spots (relative to pESCs), (9)
1233 +4.88 Annexin A5 GTVTDFPGFDGR VLTEIIASR
GAGTDDHTLIR 104.83/35.7 4.80/35.4 6753060/NC
P48036/SP
4311 +1.62 Oat protein KTEQGPPSSEYIFER
VLPMNTGVEAGETACK 7 6.19/48.3 6.20/48.0 14198116/NC
P29758/SP
6124 +2.00
B-cell stimulating
factor 3 LGAETLPR 3 8.70/25.2 7.50/29.0 9910314/NC
Q9QZM3/SP
6126 +1.52 Unnamed protein FNVWDTAGQEKNVPNWHR
VCENIPIVLCGNK SIVFHR 177.01/24.3 7.60/23.7 12846283/NC
P62827/SP
7011 +1.59
Thymidylate kinase;
TMK YAFSGVAFTGAK GEFGLER 8 9.16/25.5 8.00/22.8 1836042/NC
P97930/SP
7024 +1.87
Trafficking protein
particle complex 5 VLDALVAR 4 9.69/20.7 8.20/19.3 29165850/NC
7314 +1.59
Branched-chain amino
acid aminotransferase
AGWGPPR LGGNYGPTVAVQR
TWGEFR 7 7.60/39.7 8.00/41.7 3298579/NC
O35855/SP
8107 +1.63 Unnamed protein FDPENPQTLR 5 9.36/18.2 8.50/23.6 12845642/NC
8212 +1.65
Heterogeneous nuclear
ribonucleoprotein A2/B1
EKEQFRK NYYEQWGK
GGNFGFGDSR GGNFGFGDSR
NMGGPYGGGNYGPGGSGGSGGYGGR
198.67/35.9 8.70/35.6 3329498/NC
O88569/SP
aES/pES: aESCs/pESCs.
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. http://www.scirp.org/journal/SCD/
10
3.3. Identification of Proteins in fESCs,
pESCs and aESCs
Table 2 lists the majority of the protein spots dis-
playing different protein expression in fESCs and pESCs.
There are 32 spots with significant differences in
post-intensities between fESCs and pESCs (Figure 2
(b)). Among these 32, 12 were expressed at significantly
higher levels and 20 were expressed at significantly
lower levels in fESCs than in pESCs. The identities of
the 32 proteins were determined by comparing the re-
corded masses of fingerprint peptides with the theoreti-
cal peptide masses derived from known mouse peptides
in the protein database.
Similarly, Table 3 and 4 show proteins that were dif-
ferentially displayed between fESCs vs. aESCs and
pESCs vs. aESCs, respectively. Individual protein spots
for these groups are shown in Figure 3(b) and Figure
4(b). Ten out of the 28 proteins differentially expressed
in fESCs vs. aESCs were decreased in fESCs as com-
pared with pESCs, and 8 out of the 17 proteins differen-
tially expressed in pESCs vs. aESCs were decreased in
pESCs as compared with aESCs. In contrast, 18 and 9
proteins were increased in expression for fESCs vs.
aESCs and pESCs vs. aESCs, respectively.
(a)
(b)
Figure 3. Comparative analysis of protein expression patterns betwee n fESCs and aESCs. (a) Silver-stained 2-DE gel of fESC
and aESC proteins. (b) Enlargement of 2-DE gel images of upregulated or downregulated proteins in fESCs and aESCs. The
statistical data were obtained from 2-DE gels in three independent experiments (P < 0.05). Arrows indicate altered proteins in
fESCs and aESCs. White bars, fESCs; black bars, aESCs.
Openly accessible at
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. Openl y accessible at http://www.scirp.org/journal/SCD/
1111
(a)
(b)
Figure 4. Comparative analysis of protein expression patterns between pESCs and aESCs. (a) Silver-stained 2-DE gel of
pESC and aESC proteins. (b) Enlargement of 2-DE gel images of upregulated or downregulated proteins in pESCs and
aESCs. The statistical data were obtained from 2-DE gels in three independent experiments (P < 0.05). Arrows indicate al-
tered proteins in pESCs and aESCs. White bars, pESCs; black bars, aESCs.
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. http://www.scirp.org/journal/SCD/
12
3.4. mRNA and Protein Expression
To investigate the changes in gene expression at the
mRNA level, some proteins identified by MS were veri-
fied by real time RT-PCR to detect mRNA transcription
(Figure 5 (a)-(c)). First, transcription levels were deter-
mined for eight protein candidates displaying differential
expression in 2-DE. Four of these exhibited increased
expression (Figure 5 (a)) and the other four exhibited
reduced expression (Figure 5 (b)) in fESCs compared
with both pESCs and aESCs. Additionally, apoptosis
related four genes that were not identified by MS were
also analyzed: Bcl-xL, Baculoviral IAP repeat-containing
5 (Birc5, Survivin ), Caspase 3 (Casp3) and BCL2-asso-
ciated X protein (Bax, Figure 5 (c)). As seen in Figure 5,
analyses of Annexin A5 (Anxa5), Chloride intracellular
channel 1 (Clic1) and Spermidine synthase (Srm) mRNA
(Figure 5 (a) & (b)) showed the same expression pat-
terns as the 2-DE results, i.e., the mRNA expression of
Anxa5 and Clic1 was higher in fESCs than in pESCs and
aESCs, and, SRM was low expressed in the fESCs
compared with pESCS and aESCs. In addition, we con-
firmed ANXA5, CLIC1 and SRM protein expression by
Western blot analysis, and these expression patterns
were in agreement with the mRNA analyses (Figure 5
(b)). Endoplasmic reticulum protein ERp29 precursor
(Erp29) and Cu/Zn-superoxide dismutase (Sod1) were
increased and reduced in expression, respectively, in
fESCs compared with pESCs, though no differences
were observed between fESCs and aESCs. For three
other candidates, Acidic ribosomal phosphoprotein P0
(Po protein), Serine/threonine kinase receptor associated
protein (Strap) and Estrogen-related receptor alpha (Es-
rra), no differences were observed among the three
types of ESCs (Figure 5 (a) & (b)). For the apoptosis
related genes, the anti-apoptotic gene Bcl-xL was highly
expressed in the fESCs compared with the pESCs and
aESCs; in contrast, the pro-apoptotic gene Bax was
higher in the pESCs and aESCs than in the fESCs (Fig-
ure 5 (c)).
(a)
(b)
(c)
4. DISCUSSION (d)
Figure 5. Relative mRNA expression levels of differentially
expressed protein candidates with high (A) or low (B) ex-
pression levels in fESCs compared with both pESCs and
aESCs in 2-DE analysis. Apoptosis-related genes (C) were
analyzed by real time RT-PCR. Gapdh mRNA expression
was used as an internal standard and its mRNA level in
fESCs was designated as one-fold (baseline). Black bars,
fESCs; white bars, pESCs; grey bars, aESCs. Statistically
significant differences are indicated: *, P < 0.05; **, P <
0.01. Values are means ±SEM for two independent cell
lines. (D), Protein expre ssion in fESCs (fES), pESCs (pES),
and aESCs (aES). GAPDH protein expression was used as
the control.
Embryonic stem cells derived from fertilized, andro-
genetic and parthenogenetic blastocyst (fESCs, aESCs
and pESCS, respectively) were established and well-
characterized by Dr. Wakayama. All ESC lines estab-
lished in Dr. Wakayama’s laboratory were shown posi-
tive for ESC-specific markers, and negative for differen-
tiation markers [14-16]. We further performed for pluri-
potency/differentiation and sex analysis using RT- PCR
or genomic DNA PCR. fESCs, aESCs and pESCs which
were used to microarray were shown positive for
ESC-specific marker genes such as Oct4 and Nanog, and
Openly accessible at
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. Openl y accessible at http://www.scirp.org/journal/SCD/
1313
negative for differentiated cell markers, Pax6 and Nes.
Sex diagnosis results showed that both fESCs and aESCs
contained both X and Y chromosomes.
Several transcription factors are essential for ES cell
pluripotency. Octamer-binding protein 3 or 4 (Oct3/4,
Oct4), a POU family member, is one such factor. Oct4 is
downregulated in response to differentiation, and its
upregulation induces differentiation. Therefore, a critical
amount of Oct4 is required to sustain stem-cell
self-renewal [17]. Also, Nanog, a homeodomain protein,
was found to be capable of maintaining ES cell
self-renewal, independent of the LIF/STAT3 pathway
[18,19]. In the present study, Oct4 and Nanog were ex-
pressed in the fESCs, pESCs, and aESCs. The data par-
tially suggested that pluripotency of pESCs and aESCs
did not differ from that of fESCs. This supports evidence
from a previous study [5], in which chimeras produced
from pESCs generated by diploid blastocysts developed
well postnatally, with no growth retardation, and the age
of the chimeras did not affect the proportions of tissues
contributed by pESCs. Furthermore, pESCs have the
capacity to differentiate into all tissue types in the body;
Surprisingly, even in organisms as complex as mice,
pESCs can support full-term development, resulting in a
pESC-derived newborn [5]. aESCs also exhibit a sur-
prising ability to differentiate. Dinger et al. [20] ob-
served widespread contributions from aESCs in fetal
chimeric mice and reported that their neural differentia-
tion potential, in terms of self-renewal properties of
neural stem cells, did not differ from that of normal bi-
parental fESCs [20]. In addition, aESCs are able to dif-
ferentiate into various cell types of all three embryonic
germ layers [21]. Together, homozygous ESCs, or at
least pESCs, are indistinguishable from fESCs with re-
spect to tissue/organ contribution. Reliable derivation of
pluripotent pESCs or aESCs is a critical step towards the
feasibility of female or male patient-specific ES cell
therapy in regenerative medicine.
One of the proteins highly expressed in fESCs was
identified as ANNEXIN A5 (ANXA5, spot no. 1233), a
35 kD plasma protein. The membrane-binding capacity
of ANXA5 has multiple functions, including the modu-
lation of signalling events, a function as a Ca-channel,
involvement in calcification processes, and a function as
a receptor for viruses [22]. ANXA5 can also interfere
with calcium and phospholipid signalling pathways [23].
Of note, ANXA5 mRNA and protein have been shown
to be expressed in the zebrafish oocyte [24]. It is possi-
ble that the expression level of Anex5 is higher in fESCs
than in pESCs and aESCs, and that this may be related to
fertilization and calcium oscillation upon sperm penetra-
tion into the oocyte. As seen in a previous report [25],
after sperm capacitation, Anex5 binding sites were found
mainly in the post-acrosomal region of the sperm head
plasma membrane. After induction of the acrosome re-
action, the Anex5 binding sites were found almost only
in the acrosomal region and with higher numbers of
binding sites in the equatorial area.
Spot no. 2143 was also highly expressed in fESCs
compared with pESCs and aESCs. This protein spot was
identified as CLIC1. CLIC1, also known as NCC27, is a
member of the Clic family of chloride channels, which
can function as chloride channels in vitro [26,27]. These
proteins have significant structural homology with glu-
tathione-S-transferase [28]. In somatic cells, the expres-
sion of CLIC1 is localized mainly in the nuclear and
vesiculo-cytoplasmic membranes. Furthermore, vesiculo-
cytoplasmic CLIC1 colocalizes with mitochondria, and
CLIC1 may play a role in the regulation of osteoblastic
differentiation from mesenchymal progenitors [29].
CLIC1 protein is expressed in Xenopus oocytes in com-
bination with the cystic fibrosis transmembrane conduc-
tance regulator (CFTR) [30]. To date, no study has re-
ported any function associated with CLIC1 in ESCs or
embryos. However, one study did report that CLIC1
might play important roles in gallbladder carcinoma me-
tastasis, including in cell motility and invasion [31]. It
would be considering that CLIC1 may be associated
with lower efficiency in derivation of pESC line than
fESC line [5]. During ICM outgrowth, MAPK signalling
is noticeably reduced in parthenogenetic blastocysts
compared with fertilized blastocysts. Though no similar
study has been done for aESCs, as uniparental ESCs,
aESCs may undergo intracellular processes more similar
to those of pESCs than to those of fESCs. CLIC1, highly
expressed in fESCs compared with pESCs and aESCs, is
required further observation of its function during pre-
implantation embryogenesis and ESC generation in both
uniparental and biparental chromosomes.
In the present study, the expression level of sper-
midine synthase (SRMspot no. 2213) was higher in
pESCs and aESCs than in fESCs. Spermidine synthase,
an aminopropyltransferase, catalyzes the biosynthesis of
polyamine spermidine from putrescine. Spermidine syn-
thase and spermine synthase are important contributors
to ion channel regulation, transcription, translation, and
enzyme activities. Previously, we identified several
genes that were differentially expressed in blasto-
cyst-stage porcine parthenotes. One of these, SRM, was
highly expressed only in the blastocysts of porcine par-
thenotes [31]. Another previous study showed upregula-
tion of SRM mRNA following the addition of exogenous
polyamines [32]. Furthermore, this upregulation was
influenced by apoptosis and apoptotic-related gene ex-
pression. Higher expression of SRM in pESCs and
aESCs could be related to the relatively low overall
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. Openl y accessible at http://www.scirp.org/journal/SCD/
14
quality and high levels of apoptosis in pESCs and aESCs
compared with fESCs. In the present study, significantly
higher expression level of Casp3 and lower expression
level of Bcl-xL in pESCs and aESCs vs. fESCs provided
strong evidence in support of this idea, although no dif-
ferentially expressed protein spot was identified by MS.
Previous reports have indicated that polyamines were
essential for normal cell growth [33] and required for
apoptosis with Caspase activation [34]. Spermidine
synthase gene is also essential for survival of Arabidop-
sis [35]. In plant cells, spermidine acts as a signalling
regulator in stress signalling pathways, leading to a
build-up of stress tolerance mechanisms under stress
conditions [36]. Apoptosis occurs during the normal
development of mammalian embryos because it helps to
remove unnecessary cells, an important developmental
process [37]. In pESCs and aESCs, SRM may act as a
Caspase activator for cells which are needed to undergo
apoptosis.
This study describes analyses of the expressed pro-
teins in fESCs as compared with pESCs and aESCs. This
information contributes to our understanding of the in-
tracellular processes in uniparental- or biparental-de-
rived homozygous or heterozygous ESCs, and should
serve to provide insight into the functional capabilities of
these distinct cell types. Although we believe that the
proteins identified in this study are important for ESC
therapy in the clinical setting, we should also point out
that the actual function of these proteins in these types of
stem cells, especially during differentiation, is at present
unknown. Studying each protein individually, using gain
of function, loss of function, and dominant-negative
mutants, may reveal how and when these molecules
contribute to the self-renewal and differentiation of
ESCs.
In conclusion, two protein candidates, ANXA5 and
CLIC1, were more highly expressed in fESCs compared
with pESCs and aESCs. In contrast, SRM was more
highly expressed in pESCs and aESCs than in fESCs.
Further study of these protein candidates is needed to
identify and clarify their functions, including functions
related to the avoidance of immune rejection problems
during ESC therapy, the maintenance of pluripotency,
and the properties of ESC differentiation.
5. ACKNOWLEDGEMENTS
This work is supported by grant No. 20100301-061-224-001-50-00
from the Biogreen 21 program, RDA, Republic of Korea.
REFERENCES
[1] Evans, M.J. and Kaufman, M.H. (1981) Establishment in
culture of pluripotential cells from mouse embryos. Nature,
292, 154-156. doi:10.1038/292154a0
[2] Thomson, J.A., Itskovitz-Eldor J., Shapiro S.S., Waknitz,
M.A., Swiergiel, J.J., Marshall, V.S. and Jones, J.M. (1998)
Embryonic stem cell lines derived from human blastocysts.
Science, 282, 1145-1147.
doi:10.1126/science.282.5391.1145
[3] Allen, N.D., Barton, S.C., Hilton, K., Norris, M.L. and Sura-
ni, M.A. (1994) A functional analysis of imprinting in
parthenogenetic embryonic stem cells. Development, 120,
1473-1482.
[4] Eckardt, S, Leu, N.A., Bradley, H.L., Kato, H., Bunting, K.D.
and McLaughlin, K.J. (2007) Hematopoietic reconstitution
with androgenetic and gynogenetic stem cells. Genes De-
veplment, 21, 409-419. doi:10.1101/gad.1524207
[5] Li, C., Chen, Z., Liu, Z., Huang, J., Zhang, W., Zhou, L.,
Keefe, D.L. and Liu, L. (2009) Correlation of expression
and methylation of imprinted genes with pluripotency of
parthenogenetic embryonic stem cells. Human Molecular
Genetics, 18, 2177- 2187. doi:10.1093/hmg/ddp150
[6] Baharvand, H., Fathi, A., Gourabi, H., Mollamohammadi, S.
and Salekdeh, G.H. (2008) Identification of mouse embry-
onic stem cell-associated proteins. Journal of Proteome Re-
search, 7, 412-423. doi:10.1021/pr700560t
[7] Intoh, A., Kurisaki, A., Yamanaka, Y., Hirano, H., Fukuda,
H., Sugino, H. and Asashima, M. (2009) Proteomic analysis
of membrane proteins expressed specifically in pluripotent
murine embryonic stem cells. Proteomics, 9, 126-137.
doi:10.1002/pmic.200800496
[8] Lee, C.K., Kim, H.J., Lee, Y.R., So, H.H., Park, H.J., Won,
K.J., Park, T., Lee, K.Y., Lee, H.M. and Kim, B. (2007)
Analysis of peroxiredoxin decreasing oxidative stress in hy-
pertensive aortic smooth muscle. Biochimica at Biophysica
Acta, 1774, 848-855.
[9] Zhang, D.X., Cui, X.S. and Kim, N.H. (2009) Involvement
of polyadenylation status on maternal gene expression dur-
ing in vitro maturation of porcine oocytes. Molecular Re-
pr odu ction D evelopment, 76, 881-889.
doi:10.1002/mrd.21056
[10] Cary. Statisitics. (1985) SAS User's Gudie Version 5, NC, SAS.
[11] Torrie, RGDSa, J.H. (1980) Principles and Procedures of
Statistics. New Y ork, McGraw Hill Book Companies.
[12] Hikichi, T., Wakayama, S., Mizutani, E., Takashima, Y.,
Kishigami, S., Van Thuan, N., Ohta, H., Thuy Bui, H., Ni-
shikawa, S. and Wakayama, T. (2007) Differentiation poten-
tial of parthenogenetic embryonic stem cells is improved by
nuclear transfer. Stem Cells, 25, 46-53.
doi:10.1634/stemcells.2006-0439
[13] Hikichi, T., Ohta, H., Wakayama, S. and Wakayama, T.
(2010) Functional full-term placentas formed from parthe-
nogenetic embryos using serial nuclear transfer. Develop-
ment, 137, 2841-2847. doi:10.1242/dev.051375
[14] Wakayama, S., Ohta, H., Kishigami, S., Thuan, N.V., Hiki-
chi, T., Mizutani, E., Miyake, M. and Wakayama, T. (2005)
Establishment of male and female nuclear transfer embry-
onic stem cell lines from different mouse strains and tissues.
Biology of Reproduction, 72, 932-936.
doi:10.1095/biolreprod.104.035105
[15] Wakayama, T., Tabar, V., Rodriguez, I., Perry, A.C., Studer,
L. and Mombaerts, P. (2001) Differentiation of embryonic
stem cell lines generated from adult somatic cells by nuclear
transfer. Science, 292, 740-743.
doi:10.1126/science.1059399
X. S. Cui et al. / Stem Cell Discovery 1 (2011) 1-15
Copyright © 2011 SciRes. http://www.scirp.org/journal/SCD/Openly accessible at
1515
[16] Wakayama, S., Jakt, M.L., Suzuki, M., Araki, R., Hikichi, T.,
Kishigami, S., Ohta, H., Van Thuan, N., Mizutani, E., Sa-
kaide, Y., Senda, S., Tanaka, S., Okada, M., Miyake, M.,
Abe, M., Nishikawa, S., Shiota, K. and Wakayama, T. (2006)
Equivalency of nuclear transfer-derived embryonic stem
cells to those derived from fertilized mouse blastocysts. Stem
Cells, 24, 2023-2033.
doi:10.1634/stemcells.2005-0537
[17] Niwa, H., Miyazaki, J. and Smith, A.G. (2000) Quantitative
expression of Oct-3/4 defines differentiation, dedifferentia-
tion or self-renewal of ES cells. Nature Genetics, 24,
372-376. doi:10.1038/74199
[18] Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami,
M., Takahashi, K., Maruyama M, Maeda M and Yamanaka
S. (2003) The homeoprotein Nanog is required for mainte-
nance of pluripotency in mouse epiblast and ES cells. Cell,
113, 631-642. doi:10.1016/S0092-8674(03)00393-3
[19] Kashyap, V., Rezende, N.C., Scotland, K.B., Shaffer, S.M.,
Persson, J.L., Gudas, L.J. and Mongan, N.P. (2009) Regula-
tion of stem cell pluripotency and differentiation involves a
mutual regulatory circuit of the NANOG, OCT4, and SOX2
pluripotency transcription factors with polycomb repressive
complexes and stem cell microRNAs. Stem Cells Develop-
ment, 18, 1093-1108. doi:10.1089/scd.2009.0113
[20] Dinger, T.C., Eckardt, S., Choi, S.W., Camarero, G., Kuro-
saka, S., Hornich, V., McLaughlin, K.J. and Muller, A.M.
(2008) Androgenetic embryonic stem cells form neural pro-
genitor cells in vivo and in vitr o. Stem Cells, 26, 1474-1483.
doi:10.1634/stemcells.2007-0877
[21] Teramura, T., Onodera, Y., Murakami, H., Ito, S., Mihara, T.,
Takehara, T., Kato, H., Mitani,T., Anzai, M., Matsumoto, K.,
Saeki, K., Fukuda, K., Sagawa, N. and Osoi, Y. (2009)
Mouse androgenetic embryonic stem cells differentiated to
multiple cell lineages in three embryonic germ layers in vitro.
Journal of Reproduction and Developm ent, 55, 283-292.
doi:10.1262/jrd.20146
[22] Dedman BASaJR. Annexins. Biometals (1998) 11, 399-404.
doi:10.1023/A:1009205925714
[23] Russo-Marie, F. and Annexin, V. (1999) Phospholipid me-
tabolism. Clinical Chemistry and Laboratory Medicine, 37,
287-291. doi:10.1515/CCLM.1999.050
[24] Ozerova, S.G. and Minin, A.A. (2008) A study of proteins of
annexin group in early fish development. IV. Identification
of calcium-binding proteins in zebrafish egg by mass spec-
trometry. Ontogenez, 39, 222-226.
[25] Avalos-Rodriguez, A., Ortiz-Muniz, A.R., Ortega-Camarillo,
C., Vergara-Onofre, M., Rosado-Garcia, A. and Ro-
sales-Torres, A.M. (2004) Fluorometric study of rabbit
sperm head membrane phospholipid asymmetry during ca-
pacitation and acrosome reaction using Annexin-V FITC.
Ar ch ives of An thology , 50, 273-285.
doi:10.1080/01485010490448741
[26] Cromer, B.A., Morton, C.J., Board, P.G. and Parker, M.W.
(2002) From glutathione transferase to pore in a CLIC. Eu-
r opean Biop hysics Journal, 31, 356-364.
doi:10.1007/s00249-002-0219-1
[27] Ashley, R.H. (2003) Challenging accepted ion channel bi-
ology: P64 and the CLIC family of putative intracellular an-
ion channel proteins (Review). Molecular Membrane Biol-
ogy, 20, 1-11. doi:10.1080/09687680210042746
[28] Harrop, S.J., DeMaere, M.Z., Fairlie, W.D., Reztsova, T.,
Valenzuela, S.M., Mazzanti, M., Tonini, R., Qiu, M.R., Jan-
kova, L., Warton, K., Bauskin, A.R., Wu, W.M., Pankhurst,
S., Campbell, T.J., Breit, S.N. and Curmi, P.M. (2001) Crys-
tal structure of a soluble form of the intracellular chloride
ion channel CLIC1 (NCC27) at 1.4-A resolution. The J our-
nal of Biologic al Chem istry, 276, 44993-45000.
doi:10.1074/jbc.M107804200
[29] Yang, J.Y., Jung, J.Y., Cho, S.W., Choi, H.J., Kim, S.W.,
Kim, S.Y, Kim, H.J., Jang, C.H., Lee, M.G., Han, J. and Shin,
C.S. (2009) Chloride intracellular channel 1 regulates os-
teoblast differentiation. Bone, 45, 1175-1185.
doi:10.1016/j.bone.2009.08.012
[30] Edwards, J.C. (2006) The CLIC1 chloride channel is regu-
lated by the cystic fibrosis transmembrane conductance reg-
ulator when expressed in Xenopus oocytes. Journal of
Membrane Biology, 213, 39-46.
doi:10.1007/s00232-006-0059-5
[31] Lee, H.Y., Cui, X.S., Lee, K.A. and Kim, N.H. (2006) An-
nealing control primer system identifies differentially ex-
pressed genes in blastocyst-stage porcine parthenotes. Zy-
gote, 14 , 71-80. doi:10.1017/S0967199406003571
[32] Cui, X.S. and Kim, N.H. (2005) Polyamines inhibit apop-
tosis in porcine parthenotes developing in vitro. Molecular
Repr odu ction and Development , 70, 471-477.
doi:10.1002/mrd.20228
[33] Pegg, A.E. (1988) Polyamine metabolism and its importance
in neoplastic growth and a target for chemotherapy. Cancer
Research, 48, 759-774.
[34] Stefanelli C, P.C., Tantini, B., Fattori, M., Stanic, I., Mack-
intosh, C.A., Flamigni, F., Guarnieri, C., Caldarera, C.M.
and Pegg, A.E. (2001) Effect of polyamine depletion on
caspase activation: A study with spermine synthase-deficient
cells. Biochemical Journal, 355, 199-206.
doi:10.1042/0264-6021:3550199
[35] Imai, A., Matsuyama, T., Hanzawa, Y., Akiyama, T., Tama-
oki, M., Saji, H., Shirano, Y., Kato, T., Hayashi, H., Shibata,
D., Tabata, S., Komeda, Y. and Takahashi, T. (2004) Sper-
midine synthase genes are essential for survival of Arabi-
dopsis. Plant Physiology, 135, 1565-1573.
doi:10.1104/pp.104.041699
[36] Kasukabe, Y., He, L., Nada, K., Misawa, S., Ihara, I. and
Tachibana, S. (2004) Overexpression of spermidine synthase
enhances tolerance to multiple environmental stresses and
up-regulates the expression of various stress-regulated genes
in transgenic Arabidopsis thaliana. Plant Cell Physiology, 45,
712-722. doi:10.1093/pcp/pch083
[37] Hardy, K. (1997) Cell death in the mammalian blastocyst.
Molecular Huma n Reproduction, 3, 919-925.
doi:10.1093/molehr/3.10.919