Journal of Biosciences and Medicines, 2014, 2, 58-67
Published Online March 2014 in SciRes. http://www.scirp.org/journal/jbm
http://dx.doi.org/10.4236/jbm.2014.21007
How to cite this paper: Ndawula Jr., C., et al. (2014) CHK21100delC, I157T, IVS2 +IG > A, BRCA1 and BRCA2 Mutation Anal-
ysis in JF305: A Pancreatic Cancer Cell Line. Journal of Biosciences and Medicines, 2, 58-67.
http://dx.doi.org/10.4236/jbm.2014.21007
CHK21100delC, I157T, IVS2 +IG > A, BRCA1
and BRCA2 Mutation Analysis in JF305: A
Pancreatic Cancer Cell Line
Charles Ndawula Jr.1,2 , Xueli Yang1, Xiaohai Gong1, Jian Jin1*
1Laboratory of Molecular Pharmacology, School of Pharmaceutics, Jiangnan University, Wuxi, China
2National Livestock Resources Research Institute, Tororo, Uganda
Received 10 February 2014; revised 11 March 2014; accepted 19 March 2014
Copyright © 2014 by authors and Scientific Research Publishing Inc.
This work is licensed under the Creative Commons Attribution International License (CC BY).
http://creativecommon s.org/licenses/by/ 4.0/
Abstract
JF305 is a highly prolific pancreatic cancer cell line that originated from a Chinese patient. The cell
line bears a functional HR double strand DNA repair mechanism but very responsive to PARP
treatment a phenomenon clearly suggesting presence of an anomaly in the mechanism. Brca1,
Brca2 and CHK2 proteins are very important constituents of the HR mechanism whose respective
gene coding mutations are strongly associated with several cancers and are widely exploited in
anticancer chemotherapy. In this current study, the BRCA1, BRCA2 gene mutation status in JF305
was determined together with the presence of 3 widely reported cancer linked CHK2 founder mu-
tations (1100delC, I157T, IVS2 +IG > A). CHK21100delC genotype was determined using allele
specific PCR, while the PCR-RFLP assay was used for I157T, IVS2 +IG > A analysis. PCR and direct
sequencing were used for assessing the BRCA1 and BRCA2 gene. Results revealed that JF305 is
CHK21100delC heterozygous mutant, CHK2I157T and CHK2IVS2 +IG > A wild type. Furthermore, it
was observed that JF305 lacked BRCA1 and BRCA2 gene mutations. The mutation status identifi-
cation of CHK2 and BRCA1/2 in JF305 provides a major milestone towards elucidating the proper-
ties of the cell line which subsequently promises to be an excellent model for evaluating the role of
parp inhibitors in pancreatic cancer chemotherapy most especially in the respective cancer cell
lines without BRCA1 and BRCA2 gene mutations.
Keywords
BRCA1; BRCA2; CHK21100delC; CHK2I157T; CHK2IVS2 +IG > A; Homologous Mechanism; PARP;
Brca1; Brca2
*Corresponding author.
C. Ndawula Jr. et al.
59
1. Introduction
Genetic mutations are considered to be one of the major factors contributing to cancer although it is widely
acknowledged that other factors such as environment, age, viral infections and smoking may be attributed to
cancer incidences. There are an estimated 12.7 million cancer cases worldwide every year and this is expected to
rise to 21 million by 2030 [1]. In China, 2.5 million cancer deaths are reported every year and 3.5 million new
cancer cases reported every day [2]. Pancreatic cancer is reported to cause an estimated 213,000 death world-
wide [3]. Not only is the overall pancreatic cancer prognosis poor, there is a less than 4% 5-year patient survival
rate [4] and resistance to many key chemotherapeutic agents and novel targeted therapies [5]. In search for po-
tent parp inhibitors against cancer cell lines originating from China, current research work from our laboratory
screened a panel of cells and identified JF305 to be highly sensitive to different low and high potent PARP in-
hibitors. JF305 is a pancreatic cancer cell line which was established in 1995 with a high proliferation rate of 2 -
3 days to reach confluence, a population doubling time of approximately 49.5-h and plating efficiency of 30.6%
[6]. PARP inhibitors are suggested to act by trapping PARP-1 and PARP-2 enzymes at the site of DNA damage
forming parp-protein complexes that are toxic to cell [7]. They are also reported to act by inducing the accumu-
lation of single stand breaks that become double strand breaks (DSBs) resulting in stalling of the replication
forks causing cell death unless repaired. PAPR inhibition causes failure of the single stand DNA repair mecha-
nism but does not have effect on the double strand DNA repair mechanism (DDR) [8].
Results from our preliminary studies showed RAD51 and γ-H2AXfoci formation a classical HR mechanism
response during which H2AX is only phosphorylated by ATM which is only activated during double stand DNA
damage. This confirms that parp inhibitors induce double stand breaks (DSBs) triggering HR mechanism acti-
vation. JF305 therefore bears a functional HR mechanism which raises unanswered question on why JF305
seems to be sensitive to PARP inhibitors. Against this background, it would be ideal and reasonable to speculate
that some constituents of the HR mechanism might contain genetic anomalies.
Ideally a cell maintains its genomic integrity and stability by accurately repairing damaged DNA such that no
mutations are carried onto the daughter cells short of which may result in tumor progression. Brca1, Brca2 and
Chk2 alongside RAD51, γ-H2AX, FANCN/PALB, Chk1 and ATM constitute the Homologous recombination
repair mechanism [9] that functions together with MSH2, MLH1, MSH6, NBS1, MRE11, RAD50, BLM, and
RFC multi protein complex in double stand DNA repair [10]. Mutations in any of the genes coding for proteins
constituting the mechanism are likely to damage the HR functionality. However, BRCA1, BRCA2, ATM, and
CHK2 genes are very instrumental in the repair mechanism. Together, mutations in BRCA1 and BRCA2 ac-
count for the majority of families with hereditary susceptibility to breast and ovarian cancer [11]-[13]. BRCA
gene mutations may appear as heterozygous (one normal copy and one mutated copy) within the germ line. Ep-
idemiologic studies have shown that BRCA1 mutation carriers have a high lifetime risk of breast cancer of up to
80% [14]. Similarly BRCA2 carriers are also at an increased risk for developing ovarian cancer as well as other
solid tumors such as prostatic, pancreatic, gastric and colon cancers [15]. Breast cancer early onset 1/2 (BRCA1
and BRCA2) are human suppressor housekeeping genes that code for breast cancer susceptibility protein 1 and 2
(Brca1 and Brca2). BRCA1 and BRCA2 are located on chromosome 17 and 13 and each contains24 [16] and 27
exons [17]. Exon 11 represents 50% and 60% of the BRCA2 and BRCA1 entire genome [18]-[20] thus the larg-
est. Most BRCA1 and BRCA2 mutations are located in exon 11 though also present in other exons therefore
there is no particular hot spot. Although there is existence of several alternative strategies such as denaturing
high performance liquid chromatography (DHPLC), single-strand conformation polymorphism (SSCP), dena-
turing gradient gel electrophoresis (DGGE), heteroduplex analysis (HA), fluorescent assisted mismatch analysis
(FAMA) and the protein truncation test (PTT), direct DNA sequencing (DS) remains the gold standard for de-
tecting BRCA mutations [21].
CHK2 also known as CHEK2 is a versatile multifunctional cell cycle check point kinases that amplifies the
cells response to DNA damage by phosphorylating a number of downstream cellular substrates like Brca1,
PML, E2F1, P53, CDC25A, CDC25C [22]. CHK2 is located on chromosome 22q12.1 [23] comprising of 3 dis-
tinct domains; the SQ/TQ cluster domain (SCD), Fork-head associated domain (FHA) and the Serine/Threonine
kinase domain [22]-[24]. SCD domain is an N-terminal domain that contains the Ser/Gln/Thr-Gln classical site
for ATM phosphorylation with Thr68 as the primary target site [22] [24]. The FHA is a centrally located domain
that binds to the phosphorylated Thr68 SCD segments [24]. Serine/Threonine kinase domain is located at C ter-
minal and only active during DNA damage [24]. Three founder mutations 1100delC, I157T, and 1422delT were
C. Ndawula Jr. et al.
60
first identified in Li-Fraumeni syndrome patients [25] but 1422delT is a polymorphism in a non-processed
Psuedogene [26]. Other CHK2 mutations like S428F, IVS2 +IG > 2 and 5395delC have also been reported in
different studies [27]-[30]. CHK2110delC is characterized by deletion of a single cystein at position 1100 lo-
cated just at the beginning of exon 10 in the serine/threonine kinase domain and resulting in a frame shift muta-
tion and an introduction of a stop codon after the 380 amino acid [25]. It is also regarded as a low penetrance
breast cancer susceptible gene evident in individuals without BRCA1 and BRCA2 mutations [31]. CHK2IVS2
+IG > A mutation involves a G > A substitution in exon 2 splice site of the FHA domain resulting in a frame
shift mutation and formation of a premature termination codon in exon 3 [32] [33]. And the I157T involves
Thymine Cytosine misense mutation at the second position of codon 157 in exon FHA domain resulting in Iso-
leucine Threonine substitution [32]. CHK2 is considered as a multi-organ cancer susceptibility gene contributing
to the development of numerous cancers; including breast, colorectal, prostate, ovarian, thyroid and kidney can-
cers [34]. Both truncating and missense CHK2 gene mutations lower the kinase activity in response to DNA
damage [35] and confer an increased cancer risk [22]. Screening of most germ line mutations in DNA is con-
ducted using PCR and direct sequencing method. However, reports from CHK2 germ line mutations analysis
indicated that the genome exhibits high homology to exons 10 and 14 making mutation analysis problematic
[36]. Long-range PCR may be used to overcome the problem; however, the allele specific PCR and RFLP
methods are widely used to screen for particular established CHK2 mutations.
From the available literature, it is evident that limited or no research work has been undertaken to evaluate the
BRCA 1, BRCA2 and CHK2 mutation status in JF305. The objective of this current research work was therefore
to evaluate the BRCA1, BRCA2, CHK21100delC, I157T, and IVS2 +IG > A mutation status in JF305.
2. Materials and Methods
The JF305 was purchased from Wuxi BioHermesInc and cultured in RPMI 1640 supplemented with 10%
FBSmaintained at 37˚C and 5% CO2.
2.1. DNA and mRNA Isolation
Prior to DNA or RNA extraction, JF305 cells were cultured to confluence but the cells cultured for mRNA ex-
traction were supplemented with 100 µg/mL cycloheximide for at least 6 hours. Genomic DNA and mRNA
were extracted using the General AllGen kit (Cwbiotech cat cw2298) and the mRNA Isolation kit (Roche cat
11741985). Extracted mRNA was then transcribed into cDNA using the TaKaRa Reverse Transcriptase M-
MLV (RNase H-) kit (cat No. 2641). All kits were used according to the manufacturers instructions and sam-
ples stored at 20˚C.
2.2. CHK21100delC Mutation Analysis
CHK21100delC mutation genotyping and zygosity were determined using the allele specific PCR method as
previously described [37]. Two sets of reaction mixtures were prepared both containing a common forward pri-
mer Chk210F 5-GCAAAGACATGAATCTGTAAAGTC-3, a different allele specific reverse primer; Chk210
WildR: 5-AAATCTTGGAGTGCCCAAAATCAG 3 (specific for wild type allele), Chk210mutR:
5-AAATCTTGGAGTGCCCAAAATAAT-3(specific for mutant allele), the SLC30A9F:
5GTCAAAGCCACCAGTTACAGT-3 and SLC30A9R: 5-TTCCCCACCACTTACTGAC-3 primers target-
ing exon 8 solute carrier family 30 member 9 (SLC30A9) gene as the internal control. Wild type allele specific
PCR amplification was performed using the following conditions; 95˚C for 5 minutes, [95˚C for 20 seconds,
60˚C for 20 seconds 72˚C for 20 seconds] 40 cycles and final extension 72˚C for 5 minutes [38]. Mutant allele
specific PCR amplification conditions were; 94˚C for 3 minutes, [94˚C for 30 seconds, 50˚C for 30 seconds,
70˚C for 30 seconds] 35 cycles and final extension 72˚C for 7 minutes. All PCR products were separated us-
ing 2% agarose gold view stained gel and visualized under UV light.
To determine the zygosity, successfully amplified products were subsequently analyzed using the same com-
mon forward primer, altering the allele specific reverse primer and maintaining the same internal control gene
specific primers. PCR reactions were performed using a C100 touch thermal cycler in a 20 µL reaction mixture
containing 1 × Taq master mix (CWBIO cat cw0582), 250 ng genomic DNA, 0.2 µM forward and reverse pri-
mers.
C. Ndawula Jr. et al.
61
2.3. CHK2I157T Mutation Analysis
CHK2I157T genotyping was determined using PCR-RFLP as previously described [39]. The 155bp region
prone to the ThymineCytosine mutation (amino acid 430) was amplified using specific primers Chk2157F:
5-ACCCATGTATCTAGGAGAGCTG-3 and Chk2157R: 5-CCACTGTGATCTTCTATGTCTGCA-3. The
PCR was conducted in a 20 µL reaction mixture containing 1 × Taq master mix (CWBIO cat cw0582), 250 ng
genomic DNA, 0.2 µM forward and reverse primers using a C100 touch thermal cycler. The following PCR
conditions were used; 94˚C for 3 min, [94˚C 30 s, 56˚C for 40 s, 72˚C for 40 s] 30 cycles final extension 72˚C
for 5 min [38]. The amplified PCR products were separated using 2% agarose gold view stained gel and visual-
ized under UV light. Subsequently, they were digested overnight using 5 units of PstI (New England Biolabs)
restriction enzyme, targeting the site introduced by the reverse primer in case of Thymine-Cytosine mutation
and the digestion was confirmed using agarose electrophoresis.
2.4. CHK2IVS2 +IG > A Mutation Analysis
We amplified the 491 G > A residual fragment mutation site using the PCR-RFLP assay as previously described
[41] using Chk2IVSF: 5-ATTTATGAGCAATTTTTAAACG-3 and Chk2IVSR: 5-
TCCAGTAACCATAAGATAATAATATTAC-3 primers. The PCR constituted of a 20 µL reaction mixture
containing 1 × Taq master mix (CWBIO cat cw0582), 250 ng genomic DNA, 0.2 µM forward and reverse pri-
mers. Amplification was conducted at 95˚C for 5 min, [94˚C for 60 s, 53˚C for 60 s, 72˚C for 60 s] 35 cycles and
a final extension at 72˚C for 7 min [38] using a C100 touch thermal cycler. The amplified products were con-
firmed using 2% gold view stained gel and then digested over night at 37˚C using 5 units of Hpy188III (New
England Biolabs) restriction enzyme.
2.5. BRCA1/2 Gene Amplification
BRCA 1 and BRCA2 genes were amplified using a series of primers (Table 1) overlapping the entire gene seg-
ments (Figures 1(a) and (b)). Amplification of exon 11 in both genes was conducted using genomic DNA tem-
plate while cDNA template was used for all other segments. We used a 20 µLPCR reaction volume composed of
1U prime stare max DNA polymerase (TaKaRabioinccat R045aA), 250ng genomic or cDNA, 0.2 µM reverse
and forward primers. All PCR reaction were conducted at 98˚C for 1 min, [98˚C 10 s, varying annealing tem-
peratures (Table 1) 72˚C for 25 s] 35 cycles and final extension 72˚C for 5 min using aC100 touch thermal cy-
cler. All amplified products were separated using a 1% gold view stained gel, visualized under UV light, puri-
fied and submitted to Sangon Biotech (Shanghai) Co Ltd for sequencing. The generated sequences were assem-
bled and analyzed using DNAMAN 5.0 software.
3. Results
3.1. CHK2 Mutation Analysis
CHK21100delC wild type and Mutant allele specific PCR gel analysis indicated the presence of 309, 184 and
309, 183 bp bands (Figures 2(a) and 3(a)). Subsequent wild and mutant type CHK21100delCzygosity allele
specific PCR gel analysis also indicated the presence of 309, 183 and 309, 184 bp bands (Figures 2(b) and 3(b)).
The presence of 309 bp band confirms the amplification of the SLC30A9 gene used as the internal control while
the 184 and 183bp products indicates presence of wild and mutant alleles. Zyogisty allele specific PCR clearly
demonstrated that JF305 carries a heterozygous CHK21100delC mutation. CHK2110delcPCR-RFLP analysis
also indicated the presence of the mutation in question (data not shown). The positive CHK21100delC mutant
samples were sequenced and the generated data was aligned against CHK2 gene bank sequencies (NCBI Refer-
ence Sequence: NG_008150.1).
CHK2I157T and CHK2IVS2 +IG > A PCR-RFLP analysis showed amplification of a 155 and 491 bp prod-
ucts which persisted after the restriction digestion reaction (Figures 4 and 5).
Absence of the 136 and 19 bp bands after the PstI restriction digestion reaction of CHK2I157TPCR products
indicates that there was no Threonine Isoleucine substitution a consequence of thymine cytosine misense muta-
tion at 157 position [32] hence no formation of PstI restriction site. The persistence of a 155 bp band after RFLP
reveals that JF305 lacks the CHK2I15T mutation. Similarly the absence of 297 and 197 bp bands after Hpy188III
C. Ndawula Jr. et al.
62
Table 1. BRCA1/2 primers, the respective product sizes and annealing temperatures with all forward primers (F) containing
a T7 promoter: ggatcctaatacgactcactataggaacagaccaccatg and translational start codon underlined. All BRCA1 and BRCA2
segments correspond to gene access number U14680.1 and U43746.1.
No
Exon BRCA1
Primer sequence 5-3
Product size bp
Source
1
2-10:
F1: gatttatctgctcttcgcgt (123-142)
R1:gttggggaggcttgccttct (1538-1519)
1454
[39]
2
11
F2: gctgcttgtgaattttctgag (789-809)
R2:gcctgcagtgatattaactgtctg (2903-2880)
1591
[40]
3
11
F3: agcagaatggtcaagtgatgaat (1854-1873)
R3: GCCCACTTCATTAGTACTG (3397-3379)
1681
[40]
4
11
F4: tcatctcagttcagaggcaa (2982-3001
R4: agtttgaatccatgctttgc (4212-4193)
1268
[40]
5
12-24
F5: gaagtagttcagactgttaa (3462-3481)
R6: tcagtagtggctgtgggggatc (5711-5690)
2287
[39]
6
BRCA2 1-10
F6: cctattggatccaaagaga (232-250)
R6: ggttcttcagaatcattctgtg (2192-2171)
1998
7
11
F7: ggtttattgcattcttctgtg (2137-2157)
R8: ttctttaatctgagtgtttc (4374-4355)
1837
[20]
8
11
F9: cattcttctgtgaaaagaagctg (2146-2168)
R9: tggtttgaattaaaatcctgc (3530-3510)
1422
[40]
9
11
F10:ccaagctacatattgcagaag (3625-3645)
R10: ctcgttgttttccttaatta (5865-58460)
2378
[20]
10
11
F11: gatcagaaaccagaagaattgc (4579-4600)
R11: ttgggatattaaatgttctggagta (6354-6330)
1813
[40]
11
12-18
F12accaggcaagtcttttccaaa (6247-6268)
R12: agatgatgtcttctccatcc (8736-8717)
2527
[20]
12
19-27
F13: gattatacatatttcgcaatgaaag (8738-8762)
R13:ggtttgaaattatattccag (10560-10541)
1860
(a)
(b)
Figure 1. (a) Diagrammatic representation of BRCA1 coding sequences indicating the overlap-
ping segments that were amplified using the primer sequences indicated in Table 1; (b) Dia-
grammatic representation of BRCA2 coding sequences indicating the overlapping segments that
were amplified using the primer sequences indicated in Table 1.
M 1 2 3 4 5 6
M 1 2 3 4 5 6 7 8 9 10 11
(a) (b)
Figure 2. CHK21100delC mutation allele specific PCR. M; DM2000 DNA marker, (2a) Lanes
1 - 6 are 309 and 183 bp PCR bands obtained using mutation specific, common forward,
SLC30A9 forward and reverse primers showing the presence of mutant allele and. (2b) Lanes 5
- 7 and 9 - 11 are 184 and 309 bp bands obtained from the subsequent PCR reaction using wild
type specific, common forward, SLC30A9 forward and reverse primers showing the presence
of wild type allele and SLC30A9 internal control gene. Summary; CHK21100delC heterozy-
gous mutation confirmed present in JF305. (a) Mut AS-PCR; (b) Mut Zygosity AS-PCR.
C. Ndawula Jr. et al.
63
M 1 2 3 4 5 6
M 1 2 3 4 5 6
(a) (b)
Figure 3. CHK21100delC wild allele specific PCR. M; DM2000 DNA marker, (3a) Lanes 1 - 6 are 309 and
184 bp bands obtained using wild type specific, common forward, SLC30A9 forward and reverse primers
showing the presence of mutant allele and. (3b) Lanes 1 - 6 are 183 and 309 bp products from subsequent
PCR reaction obtained using mutation allele specific, common forward, SLC30A9 forward and reverse pri-
mers showing the presence of mutant allele and SLC30A9 internal control gene. Summary; CHK21100delC
heterozygous mutation confirmed present in JF305. (a) Wild AS-PCR; (b) Wild zygosity AS-PCR.
M 1 2 3 M 4 5 6
I157T PCR RFLP
Figure 4. Gel captions of CHK2 mutation
analysis; Lanes 1 - 3 and 4 - 6 are 155 bp PCR
and RFLP products indicating successful am-
plification and no PstI restriction digestion.
CHK2I157T mutation confirmed absent in
JF305.
M 1 2 3 M 4 5 6
IVS2 +IG > A PCR RFLP
Figure 5. Lanes 1 - 3 and 4 - 6 are 491 bp
PCR bands and RFLP products indicating suc-
cessful amplification and no Hpy188III restric-
tion digestion. CHK2IVS2 +IG > A mutation
confirmed absent in JF305.
C. Ndawula Jr. et al.
64
M C 1 2 3 4 5 M C 6 7 8 9 10 11 12
BRCA1PCRBRCA2PCR
Figure 6. Gel caption of BRCA1 and BRCA2PCR amplification: M; DM2000plus marker, C; negative con-
trol, lanes 1 - 5 and 6 - 12 are respective BRCA1 and BRCA2PCR products obtained using primers stated in
Table 1.
restriction digestion indicated the absence of the corresponding restriction site which is due to lack of G > A
substitution [32]. The persistence of 491 bp band confirms that JF305 lacks IVS2 +IG > A mutation.
3.2. BRCA1 and BRCA 2 Analysis
PCR gel electrophoresis analysis showed the amplification of different BRCA1 and BRCA2 segments (Figure 6)
Alignment of generated gene sequences against U14680.1 and U43746.1 confirmed the absence of BRCA1 and
BRCA2 mutations. This clearly indicated that JF305 is proficient in both BRCA1 and BRCA1and lack muta-
tions.
4. Discussions
The BRCA gene was analyzed and three reported CHK2 were characterized in this study. Furthermore, we
demonstrated that JF305 carries a CHK21100delC mutation one of the two mutations identified in Li-Fraumeni
syndrome patients and no BRCA1 or BRCA2 mutations (26). This phenomenon is yet to be reported in JF305
and other pancreatic cancer cell lines but has been widely associated with increased risk of breast cancer.
CHK21100delC confers low penetrance susceptibility to breast cancer in non carriers of BRCA1 and BRCA2
[31]. CHK21100delC is classified by nucleotide deletion and frame shift at C terminal kinase domain resulting
in loss of kinase activity compromising the downstream targets of activated CHK2. Findings from our prelimi-
nary studies revealed impaired expression of phosphoryatedCHK2 and reduced expression levels of total CHK2
(data not shown) which also strongly indicates the presence of CHK2 mutation [35].
On the other hand BRCA is the most extensively studied gene due to its significance in increased risk for
cancer. In an effort to improve on the accuracy, both BRCA1 and BRCA2 gene amplification is obtained using a
nested pcr (2 sets of primers) [20] [39] [40]. However in this study, we successfully amplified both BRCA genes
using a single set of primers and prime star DNA polymerase. This approach simplifies BRCA gene amplifica-
tion making the process quick and less costly. Since the pcr products also contain the T7 promoter, they may di-
rectly be applied in the protein truncation test (PTT) for further analysis.
The findings in this studyhave demonstrated that the CHK21100delC confers low penetrance susceptibility to
pancreatic cancer in non carriers of BRCA1 and BRCA2 mutations. There is need for further epidemiological
C. Ndawula Jr. et al.
65
evaluation considering that this phenomenon has only been unraveled in JF305 unlike other pancreatic cancer
cell lines.
5. Conclusion
Our study findings have shown that JF305 is CHK21100delC heterozygous mutant, CHK2I157T and CHK2IVS2
+IG > A wild type. Our findings have also revealed that JF305 lacks BRCA1 and BRCA2 gene mutations. It can
therefore be concluded that the mutation status establishment of CHK2 and BRCA1/2 in JF305 provides a major
milestone towards elucidating the properties of the cell line which subsequently promises to be an excellent
model for evaluating the role of parp inhibitors in pancreatic cancer chemotherapy most especially in the respec-
tive cancer cell lines without BRCA1 and BRCA2 gene mutations.
Acknowledgments
The authors gratefully acknowledge the support for this research work by China National Science Grant and
hereby declare no conflict of interest in regards to this work.
We are also indebted to Dr. Amadou Issoufou for his input in manuscript editing and to Livestock Resources
Research Institute for their support in this research undertaking and for accepting the first author undertook his
postgraduate training in China.
References
[1] Fund WCR. http://wwwwcrf-ukorg/research/cancer_statistics/world_cancer_statistics
[2] Chinas Cancer Crisis. http://wwwchinaorgcn/2013-04/16/content_28556502htm
[3] Parkin, D.M., Bray, F., Ferlay, J. and Pisani, P. (2001) Estimating the World Cancer Burden: Globocan 2000. Interna-
tional Journal of Cancer, 94, 153-156. http://dx.doi.org/10.1002/ijc.1440
[4] Jemal, A., Siegel, R., Xu, J. and Ward, E. (2010) Cancer Statistics. A Cancer Journal for Clinicians, 60, 277-300.
http://dx.doi.org/10.3322/caac.20073
[5] Matthaios, D., Zarogoulidis, P., Balgouranidou, I., Chatzaki, E. and Kakolyris, S. (2011) Molecular Pathogenesis of
Pancreatic Cancer and Clinical Perspectives. Oncology, 81, 259-272. http://dx.doi.org/10.1159/000334449
[6] Li, X., Wang, H. and Jiang, Y. (1995) Establishment of a Human Pancreatic Adenocarcinoma Cell Line (Jf305) with
p53 Expression. Chinese Journal of Cancer Research, 7, 251-254. http://dx.doi.org/10.1007/BF02672786
[7] Murai, J. , Huang, S.Y., Dar, B.B., Renaud, A., Zhang, Y., Doroshow, J.H. , Ji, J., Takeda, S. and Pommier, Y. (2012)
Trapping of PAPR1 and PARP2 by Clinical Parp Inhibitors. Cancer Research, 72, 5588-5599.
http://dx.doi.org/10.1158/0008-5472.CAN-12-2753
[8] Georges, N., Nicole, G.I., Marie, F., Frederique, M.C. and Vicent, F. (2003) Poly (ADP-Ribose) Polymerase (Parp-1)
Is Not Involved in DNA Double Strand Break Recovery. BMC Cell Biology, 4, 7.
http://dx.doi.org/10.1186/1471-2121-4-7
[9] Wang, X.Z. and Weaver, D.T. (2011) The Ups and Downs of DNA Repair Biomarkers for PARP Inhibitor Therapies.
American Journal of Cancer Research, 1, 301-327.
[10] Henderson, B.R. (2012) The BRCA1 Breast Cancer Suppressor: Regulation of Transport, Dynamics, and Function at
Multiple Subcellular Locations. Scientifica, Article ID 796808. http://dx.doi.org/10.6064/2012/796808
[11] Hall, J.M, Lee, M.K., Newman, B., Morrow, J.E., Anderson, L.A., Huey, B. and King, M.C. (1990) Linkage of Early-
Onset Familial Breast Cancer to Chromosome 17q21. Science, 250, 1684-1689.
http://dx.doi.org/10.1126/science.2270482
[12] Hofmann, W. and Schlag, P.M. (2000) BRCA1 and BRCA2Breast Cancer Susceptibility Genes. Journal of Cancer
Research and Clinical Oncology, 126, 487-496. http://dx.doi.org/10.1007/s004320000140
[13] Carter, R.F. (2001) BRCA1, BRCA2 and Breast Cancer: A Concise Clinical Review. Clinical Investigation Medicine,
24, 147-157.
[14] Satagopan, J.M., Offit, K., Foulkes, W., Robson, M.E., Wacholder, S., Eng, C.M., Karp, S.E. and Begg, C.B. (2001)
The Lifetime Risks of Breast Cancer in Ashkenazi Jewish Carriers of BRCA1 and BRCA2 Mutations. Cancer Epide-
Miology, Biomarkers &Prevention, 10, 467-473.
[15] Peto, J., Collins, N., Barfoot, R. , Seal, S., Warren, W., Rahman, N., Easton, D.F., Evans. C., Deacon, J. and Stratton,
M.R. (1999) Prevalence of BRCA1 and BRCA2 Gene Mutations in Patients with Early-Onset Breast Cancer. Journal
of National Cancer Institute, 91, 943-949. http://dx.doi.org/10.1093/jnci/91.11.943
C. Ndawula Jr. et al.
66
[16] http://www.ncbi.nlm.nih.gov/nuccore/U14680.1
[17] http://www.ncbi.nlm.nih.gov/nuccore/U43746.1
[18] Smith, T.M., Szabo, L.M., Jerome, C. I., McEuen, N., Taylor, M., Hood, M.L. and King, M.C. (1996) Complete Ge-
nomic Sequence and Analysis of 117 kb of Human DNA Containing the Gene BRCA1. Genome Research, 6, 1029-
1049. http://dx.doi.org/10.1101/gr.6.11.1029
[19] Wooster, R., Neuhausen,S.L., Mangion, J., Quirk, Y., Ford, D., Collins, N., Nguyen, K., Seal, S., Tran, T., Averill, D.,
et al. (1994) Localization of a Breast Cancer Susceptibility Gene, BRCA2, to Chromosome 13q12-13. Science, 265,
2088-2090. http://dx.doi.org/10.1126/science.8091231
[20] Garvin, A.M., Attenhofer-Haner, M. and Scott, R.J. (1997) BRCA1 and BRCA2 Mutation Analysis in 86 Early Onset
Breast/Ovarian Cancer Patients. Journal of Medical Genetics, 34, 990-995. http://dx.doi.org/10.1136/jmg.34.12.990
[21] Christine, S., Jean-Paul, M., Claire, J.R., François, E., Dominique, S.L., Brigitte, B.P. and Hagay, S. (2002) Testing for
BRCA1 Mutations: A Cost-Effectiveness Analysis. European Journal of Human Genetics, 10, 599-606.
http://dx.doi.org/10.1038/sj.ejhg.5200854
[22] Antoni, L., Sodha, N. , Collins, I. and Garrett, M.D. (2007) CHK2 Kinase: Cancer Susceptibility and Cancer Therapy
Two Sides of the Same Coin? Nature Review Cancer, 7, 925-936. http://dx.doi.org/10.1038/nrc2251
[23] Bayram, S., Akkız, H. and Topaktaş, M. (2013) CHK2 1100delC, IVS2+1G>A and I157T Mutations Are Not Present
in Hepatocellular Cancer Cases from a Turkish Population. Gene, 512, 232-236.
http://dx.doi.org/10.1016/j.gene.2012.10.045
[24] Ahn, J., Urist, M. and Prives, C. (2004) The Chk2 Protein Kinase. DNA Repair (Amst.), 3, 1039-1047.
http://dx.doi.org/10.1016/j.dnarep.2004.03.033
[25] Bell, D.W., Varley, J.M., Szydlo, T.E., Kang, D.H., Wahrer, D.C., Shannon, K.E., Lubratovich, M.S., Verselis, J., Is-
selbacher, K.J., Fraumeni, J.F., Birch, J.M., Li, F.P., Garber, J.E. and Haber, D.A. (1999) Heterozygous Germ Line
hCHK2 Mutations in Li-Fraumeni Syndrome. Science, 286, 2528-2531.
http://dx.doi.org/10.1126/science.286.5449.2528
[26] Sodha, N., Williams, R., Mangion, J., Bullock, S.L., Yuille, M.R. and Eeles, R.A. (2000) Screening hCHK2 for Muta-
tions. Science, 289, 359.
[27] Shaag, A., Walsh, T., Renbaum, P., Kirchhoff, T., Nafa, K., Shiovitz, S., Mandell, J.B., Welcsh, P., Lee, M.K., Ellis,
N., Offit, K., Levy-Lahad, E. and King, M.C. (2005) Functional and Genomic Approaches Reveal an Ancient CHEK2
Allele Associated with Breast Cancer in the Ashkenazi Jewish Population. Human Molecular Genetics, 14, 555-563.
http://dx.doi.org/10.1093/hmg/ddi052
[28] Cybulski, C., Gorski, B., Huzarski, T., Masojc, B., Mierzejewski, M., bniak, T., et al. (2004) CHEK2 Is a Multior-
gan Cancer Susceptibility Gene. The American Journal of Human Genetics, 75, 1131-1135.
http://dx.doi.org/10.1086/426403
[29] Cybulski, C., Huzarski, T., Górski, B., Masojć, B., Mierzejewski, M., Debniak, T., Gliniewicz, B., Matyjasik, J., Zło-
wocka, E., Kurzawski, G. , Sikorski, A., Posmyk, M., Szwiec, M., Czajka, R., Narod, S.A. and Lubiński, J. (2004) A
Novel Founder CHEK2 Mutation Is Associated with Increased Prostate Cancer Risk. Cancer Research, 64, 2677-2679.
http://dx.doi.org/10.1158/0008-5472.CAN-04-0341
[30] Cybulski, C., Wokołorczyk, D., Huzarski, T., Byrski, T., Gronwald, J., Górski, B., Debniak, T., Masojć, B., Jakubowska,
A., Gliniewicz, B., Sikorski, A., Stawicka, M., Godlewski, D., Kwias, Z., Antczak, A., Krajka, K., Lauer, W., Sos-
nowski, M., Sikorska-Radek, P., Bar, B., Klijer, R., Zdrojowy, R., Małkiewicz, B., Borkowski, A., Borkowski, T., Szwiec,
M., Narod, S.A. and Lubiński, J. (2006) A Large Germline Deletion in the Chek2 Kinase Gene Is Associated with an
Increased Risk of Prostate Cancer. Journal of Medical Genetics, 43, 863-866.
http://dx.doi.org/10.1136/jmg.2006.044974
[31] Meijers-Heijboer, H., Van den, A., Klijn, M., Wasielewski, J., de Snoo., A., Oldenburg, R., Hollestelle, A., Houben,
M., Crepin, E., van Veghel-Plandsoen, M., Elstrodt, F., van Duijn, C. , Bartels, C., Meijers, C., Schutte, M., McGuffog,
L., Thompson, D., Easton, D., Sodha, N., Seal, S., Barfoot, R., Mangion, J., Chang-Claude, J., Eccles, D., Eeles, R.,
Evans, D.G., Houlston, R., Murday, V., Narod, S., Peretz, T., Peto, J., Phelan, C., Zhang, H.X., Szabo, C. , Devilee, P.,
Goldgar, D., Futreal, P.A., Nathanson, K.L., Weber, B., Rahman, N. and Stratton, M.R. (2002) Low-Penetrance Sus-
ceptibility to Breast Cancer Due to CHEK2(*)1100delC in Noncarriers of BRCA1 or BRCA2 Mutations. Nature Ge-
netics, 31, 55-59. http://dx.doi.org/10.1038/ng879
[32] Dong, X.Y., Wang, L., Ken, T., Wang, X.S., Julie, M., Cunningham, M., McDonnell, S.K., Chiping, Q., Angela, F.,
Marks, S., Susan, L.S., Peterson, B.J., Smith, D.I., Cheville, J.C., Blute, M.L., Jacobsen, S.J., Schaid, D.J., Tindall, D.J.,
Thibodeau, S.N. and Liu, W. (2003) Mutations in CHEK2 Associated with Prostate Cancer Risk. The American Jour-
nal of Human Genetics, 72, 270-280. http://dx.doi.org/10.1086/346094
[33] Kleibl, Z., Havranek, O., Novotny, J., Kleiblova, P., Soucek, P. and Pohlreich, P. (2008) Analysis of CHEK2 FHA
C. Ndawula Jr. et al.
67
Domain in Czech Patients with Sporadic Breast Cancer Revealed Distinct Rare Genetic Alterations. Breast Cancer
Research and Treatment, 112, 159-164. http://dx.doi.org/10.1007/s10549-007-9838-7
[34] Cybulski, C., Górski, B., Huzarski, T., Masojć, B., Mierzejewski, M., Dębniak, T., Teodorczyk, U., Byrski, T., Gron-
wald, J., Matyjasik, J., Złowocka, E., Lenner, M., Grabowska, E., Nej, K., Castaneda, J., Mędrek, K., Szymańska, A.,
Szymańska, J., Kurzawski, G., Suchy, J., Oszurek, O., Witek, A., Narod, S.A. and Lubiński, J. (2004) CHEK2 Is a
Multiorgan Cancer Susceptibility Gene. The American Journal of Human Genetics, 75, 1131-1135.
http://dx.doi.org/10.1086/426403
[35] Matsuoka, S., Nakagawa, T., Masuda, A., Haruki, N., Elledge, S.J. and Takahashi, T. (2001) Reduced Expression and
Impaired Kinase Activity of a Chk2 Mutant Identified in Human Lung Cancer. Cancer Research, 61, 5362-5365.
[36] Sodha, N., Richard, S.H., Richard, W., Martin, A.Y., John, M. and Rosalind, A.E. (2002) A Robust Method for De-
tecting CHK2/RAD53 Mutations in Genomic DNA. Humanmutation, 19, 173-177.
http://dx.doi.org/10.1002/humu.10031
[37] Djureinovic, T., Lindblom, A., Dalén, J., Dedorson, S., Edler, D. , Hjern, F., Holm, J., Lenander, C., Lindforss, U.,
Lundqvist, N., Olivecrona, H., Olsson, L., Påhlman, L., Rutegård, J., Smedh, K., Törnqvist, A., Eiberg, H. and Bis-
gaard, M.L. (2006) The CHEK2 1100delC Variant in Swedish Colorectal Cancer. Anticancer Research, 26, 4885-
4888.
[38] Bayram, S., Akkız, H. and Topaktaş, M. (2013) CHK2 1100delC, IVS2+1G>A and I157T Mutations Are Not Present
in Hepatocellular Cancer Cases from a Turkish Population. Gene, 512, 232-236.
http://dx.doi.org/10.1016/j.gene.2012.10.045
[39] Garvin, A.M. (1998) A Complete Protein Truncation Test for BRCA1 and BRCA2. European Journal of Human Ge-
netics, 6, 226-234. http://dx.doi.org/10.1038/sj.ejhg.5200172
[40] Ottini, L., DAmico, C., Noviello, C., Lauro, S., Lalle, M., Fornarini, G., Colantuoni, O.A., Pizzi, C., Cortesi, E., Car-
lini, S., Guadagni, F., Bianco, A.R., Frati, L., Contegiacomo, A. and Mariani-Costantini, R. (2000) BRCA1 and
BRCA2 Mutations in Central and Southern Italian Patients. Breast Cancer Reserch, 22, 307-310.
http://dx.doi.org/10.1186/bcr72
[41] Cybulski, C., Górski, B., Huzarski, T., Masojć, B., Mierzejewski, M., Dębniak, T., Teodorczyk, U., Byrski, T., Gron-
wald, J., Matyjasik, J., Złowocka, E., Lenner, M., Grabowska, E., Nej, K., Castaneda, J., Mędrek, K., Szymańska, A.,
Szymańska, J., Kurzawski, G., Suchy, J., Oszurek, O., Witek, A., Narod, S.A. and Lubiński, J. ( 2004) CHEK2 Is a
Multiorgan Cancer Susceptibility Gene. The American Journal of Human Genetics, 75, 1131-1135.
http://dx.doi.org/10.1086/426403