Journal of Environmental Protection, 2011, 2, 130-141
doi:10.4236/jep.2011.22015 Published Online April 2011 (http://www.SciRP.org/journal/jep)
Copyright © 2011 SciRes. JEP
Remediation of Pb-Resistant Bacteria to Pb
Polluted Soil
Bao Chen1, Jia-nan Liu1, Zheng Wang1, Lei Dong1, Jing- hua F an2, Juan-juan Qu1
1Resource and Environmental College, Northeast Agricultural University, Harbin, China; 2University of Florida, Institute of Food
and Agricultural Sciences, Indian River Research and Education Center, Gainesville, USA.
Email: {Chenbao139, southliu, dongjiadexiaolei}@163.com, [email protected], [email protected], [email protected]
Received November 4th, 2010; revised December 17th, 2010; February 10th, 2011.
ABSTRACT
To show the remediation of Pb-resistant bacteria to Pb polluted soil, several indices including microbial counts, soil
enzyme activity, microbial community diversity and so il Pb concentration were investigated. Two Pb-resistant bacteria
were filtrated and iden tified by previou s study as Bacillus pumilus and Pseud omonas aeruginosa (GeneBank Accession
No. FJ402988 and GU017676) and inoculated to soil planted with cabbages. Soil with different Pb application rates
were incubated for a period of 0, 12, 24, 36, 48 days in greenhouse. Results indicated the count of bacteria in
1000 mg/kg Pb treated soil greatly affected by inoculating Pb-resistant bacteria, which was raised about 237% and
347% compared with contro l. Soil urease and invertase were inten sified 37.9% and 65.6% after inoculation compared
with control. Phosphatase activity was inhibited by inoculation of Bacillus pumilus. Catalase activity was intensified
about 64.2% in 24 days incubation but decrease in the following days. Microbial community diversity analyzed by po-
lymerase chain reaction- denaturing grad ient gel electro phoresis (PCR-DGGE) also proved that the samples inoculated
with Pb-resistant bacteria exhibited more bands and intensity in DGGE patterns compared with uninoculated ones. For
Pb-resistant bacteria inoculated samples, the reduction of Pb concentration in rhizospheric soil was 15 mg/kg at least
and 42 mg/kg at most, and Pseudomonas aerugino sa showed a better tolerance to high Pb con centration and stronger
remediation ability. It was conclud ed that remediation of Pb polluted so il can be promoted by the two Pb-resistant bac-
teria.
Keywords: Pb Pollution, Pb-Resistant Bacteria, Microbial Community Diversity, PCR-DGGE, Enzyme Activity
1. Introduction
Extensive mining and smelting have resulted in soil con-
tamination which poses risk to human and ecological
health. Over 20 000 000 acres of farmland in China have
been contaminated by Sn, Cr, Pb and Zn and other heavy
metals, accounting for almost one fifth of the total arable
farmland [1]. Soil quality in some farmland near a min-
ing site is getting worse and the content of heavy metal
has already exceeded the third level of Environmental
quality standard for soil in China (GB15618-1995) [2].
Crops harvested in these areas had high concentration
heavy metals and their accumulation in living tissues
throughout the food chain brought a further health prob-
lem.
Different from other organic pollutants, heavy metals
are harder to be chemically or biologically degraded.
Three methods are usually employed to remediate heavy
metal contamination in the soil: excavation-physical re-
moval of the contaminated material, stabilization-amend-
ment of the metals in the soil on site, and phytoremedia-
tion-growing plants to uptake the metals from the soil [3].
However, the application of first two methods is some-
times restricted due to technological or economical con-
strains. Bioremediation is a very efficient method for
cleaning up superficially contaminated soils [4]. It makes
use of plants and their rhizospheric microbes to degrade
or immobilize pollutants in soils [5]. Soil microbes play
significant roles in the process of bioremediation [6].
They can absorb, transform, or degrade heavy metals,
and they also can reduce the mobility and bioavailability
of contaminants reviewed by Wu Gang [5]. Microbes in
rhizospheric soil can promote plants to accumulate extra
heavy metals [7]. Possible remediation by microbes is
based on the concentration of heavy metal and property
of microbe. Bacillus sp. has been identified as a possible
candidate for metal sequestration and has been used in
commercial biosorption preparation. Besides the biosorp-
Remediation of Pb-Resistant Bacteria to Pb Polluted Soil131
tion of metals using Pseudomonas sp., Zoogloea ramigera
and Streptomyces sp., Ying Ma [8] and Mani Rajkumar
[9] reported that the inoculation of plant-growth promot-
ing bacteria can protect the plants against the inhibitory
effects of nickel and improving the uptake of heavy
metal meanwhile. Geobacillus thermodenitrificans, a
thermophilic bacteria isolated from Damodar river, was
proved by S. K. Chatterjee [10], a potential biosorption
to heavy metals by dead biomass. The same conclusion
was obtained by Claudio C.V.Cruz and Xiao-na Li et al.
[11,12].
The efficiency of bioremediation was reflected by the
increase of soil enzyme activity, the number of
rhizospheric microorganism and diversity of microbial
community. Soil enzyme activity indicating the potential
ability of soil to support biochemical processes is a sen-
sitive indicator of soil quality [13-15]. Several studies
showed the effect of heavy metal pollution on soil en-
zyme activity, microbes community and heavy metal
concentration and the changes of these indics by biore-
mediation. Khan Sardar et al. [16] showed that remedia-
tion slightly increased the enzymatic activities in all the
samples polluted with heavy metals, and the community
structure changed significantly in the Cd resistant bacte-
ria inoculated samples. Urease and invertase were proved
exhibiting more sensitivity to Pb pollution than other
enzymes [17,18]. Zhaohui Guo [19] proved that the tox-
icity of Cu in heavily contaminated soils impacted on the
quantities of specific microbial populations and had no
significant change in the microbial diversity of highly
contamination soils. Chiquan He [20] confirmed that
Zn-tolerant bacteria isolated from heavy metal-contami-
nated sludge can increase mobility of Zn in soil and en-
hance accumulation of Zn by O. violaceus.
In this study, pot experiments were conducted to in-
vestigate the remediation of Pb-resistant bacteria to Pb
polluted soil. Two Pb-resistant bacteria Bacillus pumilus
and Pseudomonas aeruginosa (GeneBank accession
No.FJ402988, and GU017676) were filtrated and identi-
fied by previous study [21] based on the 16S rDNA gene
sequence analysis from soil of Pb mining district
(Heilongjiang province, China) and inoculated into soil
planted with cabbages and different levels of Pb. Objec-
tives of this work were to 1) evaluate the capability of
Pb-resistant bacteria on remediation of soil with different
Pb concentration 2) characterize the variation of enzyme
activity, microbe counts, microbial community and Pb
concentration diversity under remediation.
2. Materials and Methods
2.1. Soil Preparation
Soils used in this study were obtained from experiment
station of Northeast Agricultural University. Physico-
chemical properties of the soil were determined with
routine methods recommended by SSSA [22] and listed
in Table 1.
All pots (20 cm diameter) contained 2 kg soil with dif-
ferent concentration of Pb (0 200 400 600 800 1000 Pb
mg kg1 dry soil (Pb(NO3)2, 99% purity), which were
denoted as treatments CK, Pb200, Pb400, Pb600, Pb800
and Pb1000, respectively. Treated soils were stored for a
period of 2 weeks to establish equilibrium between the
added Pb and soils.
2.2. Plant Culture
Seeds of cabbage were from college of horticultural sci-
ence of Northeast Agricultural University. Ten seeds
were sowed in each pot and thinned to five seedlings
after emergence.
2.3. Bacteria Inoculation
Bacillus pumilus and Pseudomonas aeruginosa were
cultivated in nutrient agar medium at 30 for 48 h.
Cells were collected in the exponential phase by cen-
trifugation at 8 000 rpm for 10 min. Bacteria were diluted
with sterile water at a density of 108CFU·ml1 and inocu-
lated to the soil surface (50 ml·pot1) three times a week
after seedling emergence. Non-inoculation pots were
made as control. All pot experiments were conducted
under greenhouse conditions with constant sterile water
(content 60%) and temperature (20- 30).
2.4. Sample Collection
Soils were sampled at 0, 12, 24, 36, 48 days after inocu-
lation. Soil samples for microbial community analysis
were stored at 4. Samples for enzyme activity and Pb
concentration analysis were sieved, air-dried and ground
into powder by agate mortar.
Table 1. Main physicochemical properties of initial soils.
Properties Initial soil
pH [H2O] 6.85 ± 0.15
Silt [%] 31.7 ± 0.36
Clay [%] 39.63 ± 0.53
Sand [%] 29.8 ± 0.22
Bulik density [g·cm–3] 1.15 ± 0.27
SOM [g·kg–1] 4.48 ± 0.64
Cultivable bacteria population [g–1 fresh
soil] (5.9 ± 0.42) × 108
Cultivable fungi population [g–1 fresh soil] (6.0 ± 0.39) × 105
Cultivable actinomycetes population [g–1
fresh soil] (2.1 ± 0.26) × 106
Copyright © 2011 SciRes. JEP
Remediation of Pb-Resistant Bacteria to Pb Polluted Soil
132
2.5. Total Microbial Amounts and Soil Enzyme
Activity
2.5.1. Total Microbial Amounts
The amounts of cultivable microbe including bacteria,
fungi and actinomyces were determined by plate count-
ing method. One gram of each sample was weighed and
added to 9 ml of filter-sterilized saline. Soil suspensions
were diluted and plated on bacteria, fungi and actinomy-
ces selective medium. The number of microbial colony
was counted after 3 to 7 days incubation at 28.
2.5.2. Soi l Enzyme Activity
Soil enzyme activity is the direct expression of the soil
community to metabolic requirements and available nu-
trient, and it related to enzyme sources and substrate
specificity [23].
Phosphatase activity was determined according to
Songyin Guan [24]. Phenol was used as substrate and the
intensity of red color of the filtrate was determined using
a UV-Visspectrophotometer (Beijing Purkinje General
Instrument Co., Ltd. TU-1810) at wavelength of 510 nm,
and the results were expressed as mg P2O5 produced 100
g1 dry soil in 2h. Urease activity was measured accord-
ing to the indophenols blue colorimetric method de-
scribed as Songyin Guan [24], and expressed as μg
NH4-H g1 soil (dry weight basis) h1 at 37. Catalase
activity was measured by titration method [25] and ex-
pressed as ml (0.02 mol/L KMnO4) g1·h1. Anthrone
colorimetry was used to determine soil invertase activity
according to Songyin Guan’s method [24], and expressed
as mg glucose produced by 10 g dry soil in 72 h. All the
enzyme assays were performed with the dry soil samples
in triplicates. The substrate was added to blanks after the
reaction stopped before filtration of the soil suspensions.
2.6. PCR-DGGE
For PCR amplification of 16S rDNA, total soil DNA was
extracted with modified method described by Zhou et al.
(1996) [26]. DNA extraction was further purified using
DNA purification kit (TIANGEN DNA gel extraction kit)
to remove the humic substance according to the instruc-
tion manual. The quality of soil DNA was assessed by
1.0% agarose gel electrophoresis stained with ethidium
bromide. All DNA samples were stored at –80 until
use.
The relationships between microbial community di-
versity and heavy metals were assessed by PCR-DGGE
analysis. Bacterial primers F357GC: 5“-CGCCCGCCG
CGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCCCT
ACGGGAGGCAGCAG-3” and R518: 5-“ATT ACCGC
GGCTGCT GG-3” were used in this study [27]. This set
of primers amplified a 236 base-pair DNA segment. The
PCR reaction mixture consisted of 10 ng DNA template,
2 μL 10 mM primers, 5 μL 10 × buffer, 0.5 μL TaqDNA
polymersase (Takara) in a total volume of 50 μL. PCR
amplification (94 for 4min, 30 cycles of denaturation
at 94 for 45 s; annealing at 65 for 45 s; extension at
72 for 30 s; and a final extension at 72 for 10 min)
of the V3-region of 16S rDNA was performed in a Ep-
pendorf Mastercycler (Eppendorf biotech company,
Germany). 5 µL PCR products were analyzed by elec-
trophoresis on 1.0% agarose gels stained with ethidium
bromide. For DGGE analysis, 1-mm-thick polyacryla-
mide gels (8% acrylamide-bisacrylamide; Bio-Rad) were
prepared and electrophoresed. The DGGE conditions
were 30% - 60% urea gradient, 200 V for 15 min, fol-
lowed by 150 V for 6 h. The gels were stained with
SybrR Green I (1:5 000 in 0.5 TAE; FMC BioProducts,
Rockland, ME, USA).
2.7. Determination of Pb Concentration
For the total metal analysis, 0.5 g of air dry soil was first
treated with 5 ml HCl in a tefolon beaker with low-tem-
perature heating. 5 ml HNO3, 4 ml of HF and 2 ml of
HClO4 were added and heated with medium temperature
when about 2 to 3 ml HCl was left. After about 1 h, the
thick white smoke and the black organ material were
removed, wash the Teflon beaker (include the lid) with
distilled water to make up the volume to 50 ml. Data
were obtained when the wash liquid was measured by
atomic absorption spectrophotometer (Shimadzu atomic
absorption spectrophotometer AA-6300C).
2.8. Statistical Analysis
Values of Pb concentration, enzyme activity and cultiva-
ble microbe amounts were expressed as means and com-
pared statistically by Tukey’s t-test at the 5% level with
SPSS 13.0 (SPSS FOR Windows, Version 13.0, USA).
Quantity One image analysis software 4.6.2 (Bio-Rad)
was used to analyze band migration distance and inten-
sity within each lane of PCR-DGGE fingerprinting. PCA
analysis was conducted by SPSS 13.0 to determine the
distribution of microorganisms and differences between
different treatments. To analyze the effects of the differ-
ent treatment on the bacterial communities, the Shannon
index was used and calculated from DGGE band data as
follows:
1
ln
s
ii
i
H
pp

,
where S is the richness or total number of bands, pi is the
proportion of the total intensity accounted for by the ith
band and ln is the natural logarithm.
3. Results and Discussion
3.1. Numbers of Cultivable Microbe
Soil microbes are the most important component of soil
Copyright © 2011 SciRes. JEP
Remediation of Pb-Resistant Bacteria to Pb Polluted Soil
Copyright © 2011 SciRes. JEP
133
ecosystem, they play a key role in material cycles and
energy flow in soil. The microbial community construc-
tion and quantity often vary with the soil environment
changes, such as soil contamination, flood and drought.
In this study, the numbers of soil bacteria, fungi and
actinomyces changed significantly with different con-
centration of Pb treatment. From Figure 1, the bacteria
counts were decreased 19.67% (from 5.64 × 108 to 4.53 ×
108) when Pb concentration increased from 0 mg/kg to
600 mg/kg. When Pb concentration was increased from
600 mg/kg to 1000mg/kg, bacterial counts decreased
54.95% (from 4.53 × 108 to 1.43 × 108) and showed a
significant difference from control (p < 0.01) by
ANOVA analysis. During the incubation, total numbers
of bacteria, fungi and actinomyces decreased from 5.64 ×
108, 6.83 × 106 and 2.43 × 106 to 1.43 × 108, 5.17 × 106
and 1.75 × 106, respectively. The numbers of fungi and
actinomyces changed less than that of bacterial but still
significant (p < 0.05). The terminal counts of total mi-
crobes were significantly affected by high Pb concentra-
tion, which meant that high Pb concentration had a det-
rimental effect on microbial activity and function. After
the inoculation of Pb-resistant bacteria, the counts of
bacteria and fungi increased about 290% and 40% than
that of control when Pb concentration increased to 200
mg/kg and the decreasing trend was weakened with the
increase of Pb concentration. Actinomyces increased
28.4% and 40.7% when Pb concentration increased to
400 mg/kg and decreased to initial level when Pb con-
centration increased to 1000 mg/kg (showed in Figure
1).
Numbers of soil microbes were also altered with dif-
ferent incubation time at 1000mg/kg Pb concentration
(Showed in Figure 2). The number of bacteria decreased
in 24 days and increased faintly later, and it was 17% to
290% higher in Pb-resistant bacteria incubated soil than
in control all the time. It is probably because the inhibi-
tion of growth by heavy metal toxicity at first, and re-
covery when bacteria adapt to the polluted environment.
Fungi counts decreased sharply (12% and 45.3%) in first
24 days during the incubation, but it was decreased by
22.7% and 42.1% compared with control later. The ac-
tinomyces count was not affected significantly (p > 0.05)
by inoculation of Pb-resistant bacteria, while a higher level
of number could be found during the whole incubation.
Figure 1. Numbers of bacteria, fungi and actinomyce te s under different Pb concentrations.
Remediation of Pb-Resistant Bacteria to Pb Polluted Soil
134
Figure 2. Numbers of bacteria, fungi and actinomycetes at different incubation time under 1000 mg Pb /kg fresh soil.
In this study, soil microbial numbers showed a de-
creasing trend resulted from increasing level of Pb, but it
was weaken by inoculating Pb-resistant bacteria, which
indicated two resistant bacteria can remediate the heavy
metal contamination and recover the activity of microbe.
Remediation by microbes may be effective on the recov-
ery of bacterial activity at low concentration of Pb
(showed in Figure 1 and Figure 2). The inconsistent
relationship between total microbes counts and different
management practices may be the consequence of large-
scale heterogeneity within samples taken across the ex-
periment in the same test-site, due to an irregular distri-
bution of microbial population sizes in the soil. However,
this approximate trend still proved the effect by differ-
ently processed samples. Moreover, from the two graphs,
the increasing range of bacteria was 1.89 × 108 and 3.43
× 108 respectively, much more than the initial inoculated
number of bacteria (1 × 108). Compared with control,
Pb-resistant bacteria can decrease microbe quantity in
contaminated soil by releasing the toxic effect on micro-
organism through some unclear mechanisms.
3.2. Enzyme Activities
Soil environment has a significant impact on soil enzyme
activities. In this study, urease activity increased rapidly
over time, which illustrated that Pb pollution didn’t have
a detrimental effect on the activity of urease and inocula-
tion of Pb-resistant bacteria can intensify its activity. Soil
phosphatase activity decreased in first 24 days and in-
creased to initial level after 36 days. The opposite trend
could be found in catalase activity, which increased in
the first 24 days and decreased in later 24 days. The ef-
fect of heavy metals on soil enzyme activities may be
due to the sudden exposure to polluted environment in
the first few days, thus resulted in a shortly decrease of
enzyme activities. Later on, when microbes adapted to
the polluted environment, the enzyme activity tended to
recover. Soil invertase activity also exhibited the same
pattern, the activity greatly decreased from 51.63 mg/5
g·24 h to 31.17 mg/5 g·24 h in first 24 days, and in-
creased to 48.88 mg/5 g·24 h later.
As a whole, soil enzyme activities showed a signifi-
cant difference (p < 0.05) between the inoculated treat-
ment and control based on ANVOA analysis, which
demonstrated that Pb-resistant bacterial inoculation in
soil may raise soil urease and invertase activity. The very
significance of urease activity was showed between in-
oculated and uninoculated samples (p < 0.01). The
Copyright © 2011 SciRes. JEP
Remediation of Pb-Resistant Bacteria to Pb Polluted Soil135
maximum increase of soil urease activity was up to 204%,
which is about 70% higher than that of control. Invertase
activity also showed an increasing difference between
inoculated and uninoculated soils, in Table 2, there was
no difference in first 12 days, while a difference (p <
0.05) and a significant difference (p < 0.01) showed in 36
days and 48 days incubation respectively. Similar with
urease activity, the average increasing rate of invertase
activity was up to 119% by inoculating the Pb-resistant
bacteria and decreasing rate was 95% in control samples.
As to catalase activity, 9.6% and 7.4% increasing were
detected in two different treatments compared with initial
soil, while 3.3% and 5.1% decreasing were detected
compared with control after 48 days incubation (Table 2).
Phosphatase activity of all treatments were inhibited by
Pb pollution in first 24 days, and recovered to initial level
after 48 days incubation, so it was deduced phosphatase
was not affected by inoculation during the incubation.
Soil enzymes play an essential role in catalyzing reac-
tions necessary for organic matter decomposition, nutri-
ent cycling, energy transfer, environmental quality and
crop productivity [28]. Soil enzyme activities are greatly
affected by organic matter content in the soil and often
used as indices of soil fertility and soil pollution [29].
According to the studies conducted by Tyler (1974) [30]
and Kízílkaya et al. (2004) [31], soil enzyme activities
diminished with increasing concentrations of available
heavy metals.
Urease activity rose immediately after Pb treatment,
which has proved by many previous researches. Youn-
Joo An et al. [32] proved the increase of urease acitivty
in soil was up to 168% when antimony treatment was at
800 mg/kg. However, Caravaca et al. (2005) [33] re-
ported that plant type mediated the urease activity and
soil microbial community structure. In this study, the
similar result with Youn-Joo An [32] was obtained and
the urease activity of inoculated samples reached a
higher level than uninoculated control reflected in Table
2, which proved a promoting function of Pb-resistant
bacteria.
Invertase activity is another important index of Pb
contamination in soil. Although some previous research
has documented that there was no significant effect on
the samples processed with different Pb concentration
over time [34], but a significant effect was proved in this
study. It may be affected by different types of soil, pH,
incubation environment and so on [35-37].
Soil phosphatases are important in soil P cycling, in-
volving in mineralization of organic P and releasing
phosphate for plants [32,33]. In this study, it was not
greatly affected by different treatment. Catalase is an
intracellular enzyme involved in microbial oxidoreduc-
tase metabolism [38]. A slightly rise of catalase activity
was measured in inoculated samples after 48 days incu-
bation.
Table 2. Change of soil enzyme activities in different incubation time.
Sample time [days]
Enzyme activity Sample processing
[1 g/kg (Pb(NO3)2)] 0 12 24 36 48
Control 9.77 ± 0.1310.72 ± 0.19A11.33 ± 0.49A 12.74 ± 0.45A 13.17 ± 0.62A
Bacillus pumilus inoculated9.77 ± 0.1311.67 ± 0.25B12.87 ± 0.23B 17.81 ± 0.46B 18.16 ± 0.34B
Urease activity
(mg NH3-N produced/(g·24h)
dry soil)
Pseudomonsa inculated 9.77 ± 0.1312.97 ± 0.18B13.06 ± 0.31B 19.06 ± 0.22B 21.72 ± 1.45B
Control 1.31 ± 0.071.04 ± 0.07a1.10 ± 0.03a 1.15 ± 0.04a 1.23 ± 0.03a
Bacillus pumilus inoculated1.31 ± 0.071.12 ± 0.04a1.16 ± 0.03a 1.27 ± 0.04b 1.29 ± 0.02ab
Phosphatase activity
(mg P2O5 produced/(g·2h)
dry soil)
Pseudomonsa inculated 1.31 ± 0.071.13 ± 0.03a1.16 ± 0.04a 1.26 ± 0.04b 1.33 ± 0.04b
Control 51.63 ± 0.2140.24 ± 1.57a31.17 ± 1.29Aa 45.17 ± 3.36a 48.88 ± 2.11A
Bacillus pumilus inoculated51.63 ± 0.2142.78 ± 2.18a33.67 ± 2.11ABb 51.44 ± 1.82b 61.44 ± 2.66B
Invertase activity
(mg reducing sugar
produced/(5g·24h) dry soil)
Pseudomonsa inculated 51.63 ± 0.2142.33 ± 1.89a37.33 ± 0.77Bb 52.45 ± 2.24b 61.17 ± 2.01B
Control 1.87 ± 0.412.64 ± 0.07a3.62 ± 0.12Aa 2.63 ± 0.08a 2.12 ± 0.06a
Bacillus pumilus inoculated1.87 ± 0.412.48 ± 0.46a3.07 ± 0.10Bb 2.31 ± 0.18b 2.05 ± 0.06a
Catalase activity
(ml 0.1 N KMnO1 consumed
by 1 g dry soil in 20 min)
Pseudomonsa inculated 1.87 ± 0.412.67 ± 0.20a3.00 ± 0.16Bb 2.6 ± 0.10a 2.01 ± 0.12a
Data in the table are Mean ± SE, n = 3; lowercase letters represent the significant difference at p < 0.05, capital letters represent the significant difference at p <
0.01.
Copyright © 2011 SciRes. JEP
Remediation of Pb-Resistant Bacteria to Pb Polluted Soil
136
Soil enzymes play an essential role in catalyzing reac-
tions necessary for organic matter decomposition, nutri-
ent cycling, energy transfer, environmental quality and
crop productivity [28]. Soil enzyme activities are greatly
affected by organic matter content in the soil and often
used as indices of soil fertility and soil pollution [29].
According to the studies conducted by Tyler (1974) [30]
and Kízílkaya et al. (2004) [31], soil enzyme activities
diminished with increasing concentrations of available
heavy metals.
Urease activity rose immediately after Pb treatment,
which has proved by many previous researches. Youn-
Joo An et al. [32] proved the increase of urease acitivty
in soil was up to 168% when antimony treatment was at
800mg/kg. However, Caravaca et al. (2005) [33] re-
ported that plant type mediated the urease activity and
soil microbial community structure. In this study, the
similar result with Youn-Joo An [32] was obtained and
the urease activity of inoculated samples reached a
higher level than uninoculated control reflected in Table
2, which proved a promoting function of Pb-resistant
bacteria.
Invertase activity is another important index of Pb
contamination in soil. Although some previous research
has documented that there was no significant effect on
the samples processed with different Pb concentration
over time [34], but a significant effect was proved in this
study. It may be affected by different types of soil, pH,
incubation environment and so on [35-37].
Soil phosphatases are important in soil P cycling, in-
volving in mineralization of organic P and releasing
phosphate for plants [32,33]. In this study, it was not
greatly affected by different treatment. Catalase is an
intracellular enzyme involved in microbial oxidoreduc-
tase metabolism [38]. A slightly rise of catalase activity
was measured in inoculated samples after 48 days incu-
bation.
3.3. Pb Concentration
The decrease of Pb concentration in rhizospheric soil is
an important indicator of remediation by the Pb-resistant
bacteria.
From Figure 3, the remediation to Pb contaminated
soils promoted by Pb-resistant bacteria varied with dif-
ferent Pb concentration treatment. On one hand, the Pb
concentration in rhizospheric soil inoculated with
Figure 3. Pb concentration at different incubation time.
Copyright © 2011 SciRes. JEP
Remediation of Pb-Resistant Bacteria to Pb Polluted Soil137
Pb-resistant bacteria was significantly lower than those in
uninoculation ones, and with the increasing of heavy
metal concentration, the curves of different incubation
time with the same Pb treatment got closer over time,
which meant the remediation of Pb-resistant bacteria was
inhibited by high heavy metal concentration. The termi-
nal Pb concentration differences were 34.8, 46.2, 39,
34.1, 8.6 mg/kg and 28.1, 33.13, 40.1, 48.9, 22.1 mg/kg
between control and the two Pb-resistant bacteria (Bacil-
lus pumilus and Pseudomonas aeruginosa respectively)
inoculated samples after 48 days incubation when Pb
treatments were 200 mg/kg, 400 mg/kg, 600 mg/kg, 800
mg/kg and 1000 mg/kg. From the above data, on one
hand, remediation of inoculated samples was inhibited at
a Pb concentration of 1000 mg/kg, which only 8.6 mg/kg
and 22.13 mg/kg Pb was decreased. On the other hand,
Bacillus pumilus exhibited more power of remediation
when Pb concentration was less than 800 mg/kg, while
Pseudomonas aeruginosa performed well when Pb con-
centration was less than 1000 mg/kg. The best Pb con-
centration for soil remediation by Bacillus pumilus was
400 mg/kg at which about 46.2 mg/kg Pb was decreased,
while 48.9 mg/kg was decreased at Pb concentration of
800 mg/kg by Pseudom onas aeruginosa.
Both the Pb-resistant bacterial strains showed a reme-
diation to Pb-contamination soil. According to Weibin
Lu et al. (2006) [39], it may be resulted from a reversible
process of adsorption and desorption. But only part
heavy metal can be removed from soil by this process as
earlier studies. The most feasible remediation is to com-
bine microremediation with phytoremediation, as re-
viewed by Gang Wu [5], which can get over the disad-
vantages of microremediation. In this study, it was in-
ferred that these two strains may have the ability to en-
hance remediation through promoting adsorption of
heavy metal by plants and heavy metal resistant bacteria,
same with Jiang’s (2008) result [7]. We also found that
Pb concentration of the uninoculated samples showed a
decreasing trend, it may be resulted from the loss of pre-
treatment and sampling.
3.4. Analysis of DGGE Patterns
From the result of plate counting, we deduced that bacte-
ria was affected mostly by Pb pollution, so PCR-DGGE
analysis of bacterial community structure was conducted
based on bacterial 16S rDNA gene sequence in the fol-
lowing study. Individual banding patterns from different
treatment were showed in Figure 4 and Figure 5.
An obvious regular pattern could be found in Figure 4,
The DGGE profiles displayed a Pb concentration ladder
from low to high (CK (control, 0 mg/kg), L(low concen-
tration, 400 mg/kg) and H (high concentration, 1 000
mg/kg)) and four sampling times of each concentration.
The numbers of bands decreased with Pb concentration
increasing, and the intensity of bands faded obviously
with the increase of Pb concentration over time. Only 5
bands in lane 12 were detected while more than 10 bands
were detected in lane 4 and 8 by other treatments when
Pb concentration is 1000 mg/kg, which proved that high
concentration could impact on microbial community di-
versity and Pb was the main factor influencing bacteria
diversity by changing species composition and richness.
The PCR-DGGE patterns provided the evidence that
DGGE patterns varied with different levels of Pb con-
tamination and high dose of Pb caused a greater change
in soil bacterial diversity. Similar as this study, Khan
Sardar (2007) [18] proved that high concentration of
heavy metal can decline soil community structure and
quantity.
(a) (b)
Figure 4. DGGE profiles of V3 region of the 16S rDNA gene amplified by PCR from soil DNA in different incubation time (ck:
0 mg/kg, L: 400 mg/kg, H: 1000 mg/kg; lane 1, 2, 3, 4 means incubation time as 12, 24, 36, 48 days respectively); A: DGGE
patterns; B: Comparison of DGGE patterns using Quantity One 4.6.2 software.
Copyright © 2011 SciRes. JEP
Remediation of Pb-Resistant Bacteria to Pb Polluted Soil
138
(a) (b)
Figure 5. DGGE profiles of V3 region of the 16S rDNA gene amplified by PCR from DNA extracts with different treatments.
CK: Control; B: Bacillus pumilus inoculated; P: Pseudomonas aeruginosa inoculated; 1, 2, 3, 4: incubation time as 12, 24, 36,
48 days respectively; A: DGGE patterns; B: Comparison of the DGGE patterns using Quantity One 4.6.2 software.
DGGE profiles were analyzed by Quantity One soft-
ware (Figure 5) and Shannon-Wiener index was calcu-
lated to measure the size and importance of bacterial
community (Table 3). Shannon-Wiener index showed
the diversity of Pb-resistant bacteria treated samples were
more abundant than control, which proved that inocula-
tion of Pb-resistant bacteria could raise the diversity of
soil bacteria. Similar conclusion can be obtained from
DGGE profiles (Figure 5), although the PCR-DGGE
patterns showed numerous bands were common to all
treatments, there were also changes in band presence and
the band number of Pb-resistant bacteria treated samples
were about 5 to 10 bands more than control. So inocula-
tion of Pb-resistant bacteria can complicate soil bacteria
community structure, especially after 24 days incubation.
For a further conclusion of the relation among differ-
ent treatments, cluster analysis was conducted by Quan-
tity One software with UPGMA method (Figure 6). The
dendrogram showed that at each sampling time molecu-
lar patterns of Pb-resistant bacteria inoculated soils could
be well discriminated from patterns of control soils. It
was obvious that two clusters were divided, one cluster
represented control including sample 2, 3 and 4, and the
other represented Pb-resistant bacteria treated samples
including two subsets B and C (Figure 6). In one word,
all treatments were well divided by cluster method, and
the Pb-resistant inoculated samples showed the least
similarity to control (60%), which confirmed that the
addition of Pb-resistant bacteria had a negative impact on
the microbial community structure of heavy metals con-
taminated soil. Otherwise, the first lane was shown much
similar with subsets B, it was concluded that the bacteria
community structure in Pb-resistant bacteria inoculated
soils had a better recovery to initial soil.
Table 3. Shannon’s diversity index (H) of different treat-
ments based on PCR-DGGE analysis.
Treatment Shannon’s diversity
Index (H)
CK 1.3744 ± 0.1409a
Bacillus pumilus 1.6654 ± 0.1177b
Pseudomonas aeruginosa 1.6381 ± 0.1371b
Data in the table are Mean ± SE, n = 3; different letters represent the sig-
nificant difference at p < 0.05.
Figure 6. Cluster analysis (UPGMA, Dice coefficient of
similarity) generated by PCR-DGGE profile.
Copyright © 2011 SciRes. JEP
Remediation of Pb-Resistant Bacteria to Pb Polluted Soil139
Principal component analysis for the DGGE patterns
showed that the first, second and third principal compo-
nents explained 54.48%, 12.88% and 9.47% of the vari-
ance respectively, and the three principal components
explained 76.83% of the total variance. Since the third
component only explained less than 10% variance and it
was hard to investigate by the 3D load diagram, the first
two components were extracted and formed a new load
diagram (Figure 7). It can be seen clearly that the sig-
nificant difference between the control and treatment
samples. The control group (CK2, CK3, CK4) was dis-
tributed on the positive part of the first principal compo-
nent (PCA2), while other treatments were distributed on
the negative part of PCA2, and the treatments with Ba-
cillus pumilus and Pseudomonas aeruginosa were clus-
tered together. Effect of the Pb-resistant bacteria inocu-
lated samples on bacterial community structure showed
in DGGE profiles (Figure 5, B1-B4, P1-P4) appeared
similar patterns to each other, which proved that these
two bacteria had a positive impact on microbe commu-
nity structure in Pb contaminated soil. From the cluster
analysis and principle component analysis, the same
conclusion was drawn.
4. Conclusions
In this study, we illustrated remediation of two Pb-resis-
tant bacteria, Bacillus pumilus and Pseudomonas
aeruginosa, through four aspects such as culturable mi-
crobes, soil enzyme activity, heavy metal concentration
and microbial community diversity in Pb polluted soil.
Results indicated the quantity of culturable bacteria,
fungi, actinomyces from the soil samples that were de-
creased from 1% - 93%, 12% - 25% and 16% - 33% re-
spectively with the increasing of metal concentration. The
count of three microbes after inoculation were 5% - 137%,
Figure 7. Principal Component Analysis of DGGE patterns
data with different treatments.
6% - 23% and 12% - 28% increasing with Bacillus
pumilus inoculated, 14% - 246%, 13% - 44% and 7% -
35% increasing with Pseudomonas aeruginosa inocu-
lated. Soil enzymes like urease, invertase and catalase
were intensified by 37.9%, 65.6% and 9.6% after inocu-
lating Pb-resistant bacteria compared with control. And
phosphatase activity showed no difference with initial
soil and higher than uninoculated soils. For Pb-resistant
bacteria inoculated samples, the reduction of Pb concen-
tration in rhizospheric soil was 15 mg/kg at least and 42
mg/kg at most, and Pseudomonas aeruginosa showed a
better tolerance to high Pb concentration and strongher
remediation ability. DGGE patterns showed that inocula-
tion of Pb-resistant bacteria can intensify soil bacteria
community diversity. In conclusion, both Pb-resistant
bacteria showed a remediation to Pb polluted soil.
5. Acknowledgements
This work is supported by Innovative Research Team
Foundation of Northeast Agriculture University
(CXT003-1-1).
REFERENCES
[1] X. L. Wang and X. Q. Ma, “Advance in the Research of
Phytoremediation in Heavy Metal Contaminated Soils,”
Subtrop Agricultural Research, Vol. 4, No. 1, February
2008, pp. 44-49.
[2] X. F. Miao, et al, “Fertility Characteristics and Ecological
Restoration Potential Analysis for Metal Contaminated
Soils from Vicinity of Typical Mining and Smelting Ar-
eas in Hunan Province,” Vol. 33, No. 7, May 2010, pp.
115-119.
[3] A. R. A. Usman and H. M. Mohamed, “Effect of Micro-
bial iNoculation and EDTA on the Uptake and Transloca-
tion of Heavy Metal by Corn and Sunflower,” Chemos-
phere, Vol. 76, August 2009, pp. 893-899.
doi:10.1016/j.chemosphere.2009.05.025
[4] E. Plion-smits, “Phytoremediation,” Annual Review of
Plant Physiology, May 2005, pp. 15-39.
[5] G. Wu, H.-B. Kang, X.-Y. Zhang, H.-B. Shao, L.-Y. Chu
and C.-J. Ruan, “A Critical Review on the Bio-Removal
of Hazardous Heavy Metals from Contaminated Soils:
Issues, Progress, Eco-Environmental Concerns and Op-
portunities,” Journal of Hazardous Materials, Vol. 174,
No. 1-3, February 2010, pp. 1-8.
doi:10.1016/j.jhazmat.2009.09.113
[6] X. F. Sheng, J.-J. Xia, C.-Y. Jiang, L.-Y. He and M. Qian,
“Characterization of Heavy Metal-Resistant Endophytic
Bacteria from Rape (Brassica napus) Roots and Their
Potential in Promoting the Growth and Pb Accumulation
of Rape,” Environmental Pollution, Vol. 156, No. 3, De-
cember 2008, pp. 1164-1170.
[7] C. Y. Jiang, X.-F. Sheng, M. Qian and Q.-Y. Wang, “Iso-
lation and Characterization of a Heavy Metal-Resistant
Burkholderia sp. from Heavy Metal-Contaminated Paddy
Copyright © 2011 SciRes. JEP
Remediation of Pb-Resistant Bacteria to Pb Polluted Soil
140
Field Soil and Its Potential in Promoting Plant Growth
and Heavy Metal Accumulation in Metal-Polluted Soil,”
Chemosphere, Vol. 72, No. 2, May 2008, pp. 157-164.
doi:10.1016/j.chemosphere.2008.02.006
[8] Y. Ma, M. Rajkumar and H. Freitas, “Improvement of
Plant Growth and Nickel Uptake by Nickel Resistant-
Plant-Growth Promoting Bacteria,” Journal of Hazardous
Materials, Vol. 166, No. 2-3, July 2009, pp. 1154-1161.
doi:10.1016/j.jhazmat.2008.12.018
[9] M. Rajkumar and H. Freitas, “Effects of iNoculation of
Plant-Growth Promoting Bacteria on Ni Uptake by Indian
mustard,” Bioresource TechNology, Vol. 99, No. 9, June
2008, pp. 3491-3498. doi:10.1016/j.biortech.2007.07.046
[10] S. K. Chatterjee, I. Bhattacharjee and C. Chandra, “Bio-
sorption of Heavy Metals from Industrial Waste Water by
Geobacillus Thermodenitrificans,” Journal of Hazardous
Materials, Vol. 175, No. 1-3, March 2010, pp. 117-125.
doi:10.1016/j.jhazmat.2009.09.136
[11] C. C. V. Cruz and A. C. A. da Costa, “Kinetic Modeling
and Equilibrium Studies during Cadmium Biosorption by
Dead Sargassum sp. Biomass,” Bioresource TechNology,
Vol. 91, No. 3, February 2004, pp. 249-257.
doi:10.1016/S0960-8524(03)00194-9
[12] X. N. Li, Q.-Y. Xu, G.-M. Han, “Equilibrium and Kinetic
Studies of Copper () Removal by Three Species of
Dead Fungal Biomasses,” Journal of Hazardous Materi-
als, Vol. 165, No. 1-3, October 2008, pp. 469-474.
[13] M. Brzezinska, Z. Stepniewska and W. Stepniewski,
“Soil Oxygen Status and Dehydrogenase Activity,” Soil
Biology and Biochemistry, Vol. 30, No. 13, November
1998, pp. 1783-1790.
doi:10.1016/S0038-0717(98)00043-1
[14] D. C. Naseby and J. M. Lynch, “Rhizosphere Soil En-
zymes as Indicators of Perturbations Caused by Enzyme
Substrate Addition and iNoculation of a Genetically
Modified Strain of Pseudomonas Fluorescens on Wheat
Seed,” Soil Biology and Biochemistry, Vol. 29, No. 9-10,
September 1997, pp. 1353-1362.
doi:10.1016/S0038-0717(97)00061-8
[15] B. Brohon, C. Delolme and R. Gourdon, “Complementar-
ity of Bioassays and Microbial Activity Measurements for
the Evaluation of Hydrocarbon-Contaminated Soils Qual-
ity,” Soil Biology and Biochemistry, Vol. 33, No. 7-8,
June 2001, pp. 883-891.
doi:10.1016/S0038-0717(00)00234-0
[16] I. Mijangos, R. Perez, I. Albizu and C. Garbisu, “Effects
of Fertilization and Tillage on Soil Biological Parame-
ters,” Enzyme and Microbial TechNology, Vol. 40, No. 1,
December 2006, pp. 100-106.
doi:10.1016/j.enzmictec.2005.10.043
[17] O. N. Belyaeva, R. J. Haynes and O. A. Birukova, “Bar-
ley Yield and Soil Microbial and Enzyme Activities as
Affected by Contamination of Two Soils with Pb, zinc or
Copper,” Biology and Fertility of Soils, Vol. 41, No. 2,
2007, pp. 85-94.
[18] S. Khan, Q. Cao, H. A. E.-L., Y. Xia and J. Z. He, “Soil
Enzymatic Activities and Microbial Community Structure
with Different Application Rates of Cd and Pb,” Journal
of Environmental Sciences, Vol. 19, No. 7, 2007, pp.
834-840. doi:10.1016/S1001-0742(07)60139-9
[19] Z. H. Guo, M. Megharaj, M. Beer, H. Ming, M. M. Rah-
man, W. H. Wu and R. Naidu, “Heavy Metal Impact on
Bacterial Biomass Based on DNA Analyses and Uptake
by Wild Plants in the Abandoned Copper Mine Soils,”
Bioresource TechNology, Vol. 100, No. 17, September
2009, pp. 3831-3836.
doi:10.1016/j.biortech.2009.02.043
[20] C. Q. He, G. E. Tan, X. Liang, W. Du, Y. L. Chen, G. Y.
Zhi and Y. Zhu, “Effect of Zn-Tolerant Bacterial Strains
on Growth and Zn Accumulation in Orychophragmus
violaceus,” Applied Soil Ecology, Vol. 44, No.1, January
2010, pp. 1-5. doi:10.1016/j.apsoil.2009.07.003
[21] G. M. Ren and J. J. Qu, “Isolation and Biosorption Char-
acteristics of Pb Resistant Bacterium,” Journal of North-
east Agricultural University, Vol. 41, No. 2, February
2010, pp. 55-59.
[22] D. L. Sparks, “Methods of Soil Analysis: Chemical
Methods,” The Soil Science Society of America Book
Series, SSSA, Madison, 1996, WI.
[23] B. A. Caldwell, “Enzyme Activities as a Component of
Soil Biodiversity: A Review,” Pedobiologia, Vol. 49, No.
6, November 2005, pp. 637-644.
doi:10.1016/j.pedobi.2005.06.003
[24] S. Y. Guan, “Soil Enzyme Activities and Research Meth-
ods,” China Agriculture Press, Beijing, 1986.
[25] L. L. Zhou and Z. M Zhang, “The Determination Method
of Soil Enzyme,” Chinese Journal of Soil Science, Vol.
11, No. 5, 1980, pp. 37-38.
[26] J. Z. Zhou, A. B. Mary and J. M. Tiedje, “DNA Recovery
from Soils of Diversity Composition,” Applied and Envi-
ronmental Microbiology, Vol. 62, No. 2, February 1996,
pp. 316-322.
[27] L. Ovreas, L. Forney, F. L. Daae and V. Torsvik, “Dis-
tribution of Bacterioplankton in Meriomictic Lake
Saelenvannet, as Determined by Denaturing Gradient
Gel Electrophoresis of PCR-Amplified Gene Fragments
Coding for 16S rRNA,” Applied and Environmental
Microbiology, Vol. 163, No. 9, September 1997, pp.
3367-3373.
[28] R. P. Dick, “Soil Enzyme Activities as Indicators of Soil
Quality,” In: J. W. Doran, D. C. Coleman, D. F. Bezdicek,
B. A. Stewart, Eds., “Defining Soil Quality for a Sus-
tainable Environment,” American Society of AgroNomy,
Madison, WI, 1994, pp. 107-124.
[29] R. P. Dick and M. A. Tabatabai, “Potential Uses of Soil
Enzymes,” In: Jr., F. B. Metting, Ed., “Soil Microbial
Ecology,” Applications in Agricultural and Environ-
mental Management, Marcel Dekker, New York, 1992,
pp. 95-127.
[30] G. Tyler, “Heavy Metal Pollution and Soil Enzymatic
Activity,” Plant and Soil, Vol. 41, 1974, pp. 303-311.
doi:10.1007/BF00017258
[31] K. R, BayraklíB, “Effects of N-Enriched Sewage Sludge
on Soil Enzyme Activities,” Applied Soil Ecology, Vol.
30, No. 3, November 2005, pp. 192-202.
Copyright © 2011 SciRes. JEP
Remediation of Pb-Resistant Bacteria to Pb Polluted Soil
Copyright © 2011 SciRes. JEP
141
[32] Y.-J. An. and M. Kim, “Effect of Antimony on the Mi-
crobial Growth and the Activities of Soil Enzymes,”
Chemosphere, Vol. 74, No. 5, February 2009, pp.
654-659. doi:10.1016/j.chemosphere.2008.10.023
[33] F. Caravaca, M. M. Aiguacil, P. Torres and A. Roldan,
“Plant Type Mediates Rhizospheric Microbial Activities
and Soil Aggregation in a Semiarid Mediterranean Salt
Marsh,” Geoderma, Vol. 124, No. 3-4, February 2005, pp.
375-382. doi:10.1016/j.geoderma.2004.05.010
[34] R. Y. Yang, J. J. Tang, X. Chen and S. J. Hu, “Effects of
Coexisting Plant Species on Soil Microbes and Soil En-
zymes in Metal Pb Contaminated Soils,” Applied Soil
Ecology, Vol. 37, No. 3, November 2007, pp. 240-246.
doi:10.1016/j.apsoil.2007.07.004
[35] Z. X. Yang, S.-Q. Liu, D.-W. Zheng and S.-D. Feng,
“Effects of Cadium, Zinc and Pb on Soil Enzyme Activi-
ties,” Journal of Environmental Sciences, Vol. 18, No. 6,
2006, pp. 1135-1141.
doi:10.1016/S1001-0742(06)60051-X
[36] M. B. HiNojosa, J. A. Carreira, R. G.-Ruía-Ruíz and R. P.
Dick, “Soil Moisture Pre-Treatment Effects on Enzyme
Activities as Indicators of Heavy Metal-Contaminated
and Reclaimed Soils,” Soil Biology & Biochemistry, Vol.
36, No. 10, October 2004, pp. 1559-1568.
[37] C. B. Zhang, J. Wang and W. L. Liu, “Effects of Plant
Diversity on Nutrient Retention and Enzyme Activities in
a Full-Scale Constructed Wetland,” Bioresource Tech-
Nology, Vol. 101, No. 6, March 2010, pp. 1686-1692.
doi:10.1016/j.biortech.2009.10.001
[38] J. C. García-Gil, C. Plaza and P. Soler-Rovira, “Long-
Term Effects of Municipal Solid Waste Compost Appli-
cation on Soil Enzyme Activities and Microbial Bio-
mass,” Soil biology and soil biochemistry, Vol. 32, No.
13, 2000, pp. 1907-1913.
[39] W. B. Lu and J. J. Shi, “Biosorption of Pb, Copper and
Cadmium by an Indigenous Isolate Enterobacter sp. J1
Possessing High Heavy-Metal Resistance,” Journal of
Hazardous Materials, Vol. 134, No. 1-3, June 2006, pp.
80-86.
doi:10.1016/j.jhazmat.2005.10.036