American Journal of Plant Sciences, 2011, 2, 56-62
doi:10.4236/ajps.2011.21008 Published Online March 2011 (http://www.SciRP.org/journal/ajps)
Copyright © 2011 SciRes. AJPS
Functional Analysis for Rolling Leaf of Somaclonal
Mutants in Rice (Oryza sativa L.)
Young-Hie Park1, Hyun-Suk Lee1, Gi-Hwan Yi2, Jae-Keun Sohn1, Kyung-Min Kim1*
1School of Plant Biosciences, Kyungpook National University, Daegu, Korea; 2Department of Functional Crop, National Institute of
Crop Science, RDA, Milyang, Korea.
Email: [email protected], ghyi@rda.go.kr, {ddr3031, jhsohn, kkm}@knu.ac.kr
Received December 28th, 2010; revised February 11th, 2010; accepted February 18th, 2011.
ABSTRACT
This study was carried out to facilitate the functional analysis of rice genes. Some 297 insertion plants (1.7%) of the
entire lines with the endogenous retrotransposon Tos17 were produced. Phenotypes of these plants in the S2 generation
were observed in the field acco rding to d ifferen t leaf typ es. Rolling lea f mutants sh owed thin ner sclerenchyma tou s cells,
defective arrangement of vascular bundles, and well-formed bulliform cells as compared to the parental cultivar. Two
new copies of Tos17 were detected in the rolling leaf type. In the new leaf type, the copy number and activation of
Tos12, 15 did not appear as Ilpum. Flanking sequence tag (FST) analysis of Tos17 in the rolling leaf mutant indicated
that new copies of Tos17 were transposed on chromosomes 11 and 12. Annotated homologues of the tagging genes on
chromosome 11 were arabinoxylan rabino furanohydro lase isoenzym e AXAH-I and II. The tagg ing gene in chromoso me
12 was highly correlated with 6 kinds of genes including a transcript regu lated factor and a rough sheath 2-like protein.
This rolling leaf and flanking sequence data will stimulate the functional analysis of rice genes.
Keywords: Tissue Culture, Somaclonal Variation, Mutant, Opaque Endosperm, Tos Element
1. Introduction
Tissue culture of plants is an important means to propa-
gate genetically identical individuals asexually and to
produce transgenic plants. However, undesired genetic
and cytogenetic modifications are frequently generating
genetic variability, somaclonal variations, induced during
tissue culture. These tissue culture-induced mutations
were reported in many plant species and seemed to be
ubiquitous in plants [1,2]. Although tissue cu-
ture-induced mutations were studied extensively as a
source for plant improvement, little is known about their
molecular causes. Specifically, somatic variations are
becoming the limelight of breeders since they improve
both the individual and species of crops [3,4]. Rice is
used in genome study model of monocotyledonous plant
because of the size of its genome (~430 Mb) being rela-
tively small. Also, an international project had already
gathered the functional analysis of gene from DNA se-
quence [5]. There are various methods to analyze the
function of the gene. One method used was a genome
tilling array to a specific mutation group while handling
chemical mutation materials such as N-methyl-
N-nitrosourea (MNU) and ethyl methanesulfonate (EMS)
or radiation. This method involved inserting foreign DNA
fragments with labeled T-DNA, and using transition factor
that exist in plants such as Ac/Ds and Tos derivatives
which are a “Knock-out” or “Knock-down” of the gene
or activation [6-8]. T-DNA or Ac/Ds gene trap sys- tems
needed a lot of time and effort because it involved
breeding large-scale mutation populations through the
process of transformation to introduce a marked-gene on
a rice genome. On the other hand, retrotransposon such
as Tos can easily get a somaclonal variant through tissue
culture without processing the mutagen. This method
was widely used for the rice gene function analysis in
Japan’s NIAS (National Institute of Agrobiological Sci-
ence, http://Tos.nias.affrc.go.jp), France’s CIRAD (Cen-
tre de Coopération Internationale en Recherche Agrono-
mique pour le Développement, http://urgi.versailles. inra.
fr/OryzaTagline), and Korea’s POSTECH (Pohang Uni-
versity of Science and Technology, http://www.postech.
ac.kr/life/pfg) [1]. Meanwhile, there are about 1,000 re-
trotransposons with 32 classes in the rice genome that
existed [6] and, LTR (long terminal repeats) retrotrans-
poson with a minimum of 59 classed which composed
Functional Analysis for Rolling Leaf of Somaclonal Mutants in Rice 1 (Oryza sativa L.)
Copyright © 2011 SciRes. AJPS
57
17% of the rice entire genome, but research about the
evolution or introduced time is insufficient [3]. The re-
verse transcription modulator (RTs; Reverse Transcrip-
tase) of Tos family with 20 classes caused somaclonal
variation because it was activated at the tissue culture
which were only found in the japonica variety ‘Nippon-
bare’ [9-18]. However, very little is known about the eco-
type and copy number of the rice species or kind of Tos.
Hence, japonica variety, ‘Ilpum’ was bred domestic-
cally for rice gene function analysis. S1 and S2 progeny
populations were bred from the cultured seed, and the
incidence of variant in main agronomic characteristics
was investigated. The “Rolling leaf” mutation was ana-
lyzed to search for the kind of Tos and difference of copy
number in rice, and the retrotransposon present in Tos
family.
2. Materials and Methods
2.1. Plant Materials Growing Conditions
Calli of the japonica variety, ‘Ilpum’ of Oryza sativa
were induced in germinated dehulled seeds on a Mura-
shige-Skoog solid medium [19] containing 2,4-20 di-
chlorophenoxyacetic acid at 2 mg·L-1, casein hydrolysate
(2 g·L-1), sucrose (30 g·L-1), 21 and gelrite (5 g·L-1).
De-hulled seeds were incubated for 4 weeks at 26 ± 1˚C
in permanent darkness. After incubation for 4 weeks,
calli on the selection medium with somatic embryo-like
structures were transferred to MS medium supplemented
with 30 g·L-1 sucrose, 1 mg·L-1 1-naphthaleneacetic acid,
5 mg·L-1 kinetin, and 5 g·L-1 gelrite and exposed to in-
tense light (approx. 45-5 mEm-2 s-1) at 26 ± 1˚C. After 3
weeks, the regenerated shoots were transferred to a bottle
(6 × 16 cm) containing a fresh medium. When the shoots
reached the top of the box, the plantlets were transferred
to soil.
2.2. Measurement of Agronomic Traits
Progeny populations (S1, S2) grown from the regenerated
seed-culture (S0) were planted 8 at 30 × 15 cm planting
distance on the practice field in Kyungpook National
University, and the main agronomic characters were in-
vestigated. Brown rice’s protein local, and starch content
were analyzed by NIRS (Near-Infrared Spectroscopy,
Foss 6500), and the amylose content used 3 repeated
mean values provided by colorimetry of Juliano et al. [9].
2.3. Genomic DNA Extraction, PCR, Southern,
and RT-PCR Analysis
DNA from the mutants was extracted using the CTAB
method [20-25]. Ten-microgram aliquots of DNA were
first digested with Hae III and then electrophoresed onto
a 0.8% 18 agarose gel. PCR was performed in 50
volume of [1.5 mM MgCl2, Taq DNA polymerase, and a
corresponding buffer from GibCo (Invitrogen, Carlsbad,
Calif., http://www.invitrogen.com). Primer made amino
acid sequences [8] of Tos 4 ~ Tos 20 by DNAsis 3.0 Pro-
grams (Hitachi, Japan) using GenBank’s data base con-
firmed the relationship existence of retrotransposon ele-
ments of ‘Ilpum’ (Table 1). The DNA was denatured at
93˚C for 5 min followed by 35 cycles of amplification (1
min at 93˚C; 2 min at 40˚C; 2 min at 72˚C); the final in-
cubation at 72˚C was extended to 5 min, and the reaction
was cooled and kept at 4˚C. PCR were performed in a
PTC-200 thermal cycler (MJ Research). RT-PCR (re-
verse transcriptase-PCR) was used to analyze the mutants
containing the retrotransposon elements as determined by
the PCR and Southern analysis [2]. The total RNAs that
were from the putative rice plants (leaves) using gua-
nidine thiocyanate were isolated [11].
2.4. Histology and Microscopy Observation
Fresh hand-cut sections (~20 mm) of rice leaf were fixed
in FAA solution [(10 ml Formalin, 5 ml Acetic acid (gla-
cial), 95 ml 50% Ethylalcohol), (16 to 48 h, 48˚C)] and
dehydrated through a graded ethanol series. Treated
samples were transferred into water. The sections were
microscopically examined (Automatic plant microtome,
Mt-3, NK system) and photographed. The samples were
embedded in paraffin (Fluka) and polymerized at 56~
58˚C. Sections (50 μm) were cut and dropped with filtered
paraffin, microscopically examined (Olympus, BX50),
and photographed. Area measurements of the vascular
elements were performed using an Olympus analySIS TS
Lite software.
2.5. Amplification of Sequences Flanking
Transposed Tos l7
Sequences flanking the transposed Tos 17 (target-site
sequences) were amplified by an adaptor-PCR. Target-
site sequences were amplified using the rice total DNA,
respectively, as described [24] except that the total DNA
was digested with Hae III. Two sets of primers were used
for the two-step PCR: adaptor primer-1, GCGTAATAC-
GACTCACTATAGCAATTAACC and Tos l7 primer-1,
TGCTCTCCACTATGTGCCCTCCGAGCTA were used
for the first PCR; the adaptor primer-2, GACTCACTA-
TAGCAATTAAC and To s 17 primer-2, ACAAGTCG-
CTGATTTCTTCAC were used for the second reaction.
PCR was performed in a PTC-200 thermal cycler (MJ
Research) and conducted as follows: first, the denature-
tion step at 95˚C for 5 minutes, 20 cycles of 30 seconds
at 94˚C and 1 minutes at 72˚C, followed by a final elon-
gation step at 72˚C for 10 minutes; second the PCR was
conducted with 5ul of the first PCR product under the
following conditions: denaturation step at 94˚C for 5 min,
Functional Analysis for Rolling Leaf of Somaclonal Mutants in Rice 1 (Oryza sativa L.)
Copyright © 2011 SciRes. AJPS
58
Table 1. The primer sequence of Tos families for PCR.
Primer sequence
Tos families
Forward (5' 3') Reverse (3' 5')
Tos 4 ACATTTTTACATggAgAgCTTgAg ATTCTACATCCTCATCagTAC
Tos 5 ATATgCATCTCCTgATgCAgACTA CAAgCACAAAATAACTCCCTC
Tos 6 gCACACTATgATTTAgAgTTgCAT AgTgTTCCTgTCCTggATTgC
Tos 7 gACAgATATAAAgCTAgATTggTT AgTTTCTCAgTTggTgACAgA
Tos 8 gCTATgTTACAAgCgAggACATAC CTTTTgCAACTAAgCgAgCTT
Tos 9 gCTTACTCAgCTTCgCAAgCTCgA AgTCTTgCCTTgTgCCTAATT
Tos 10 gCAAAATCCTAATggAAAggTggA AgTTATgTCAggTCgTgTAtg
Tos 11 gCTAgTAgTgATgTCAgTCTACTg gTTgTgAgTgTACATTACTgC
Tos 12 gCATTTTTACATggggAgTTAggA gAAgATAATCTgAAATgTgCA
Tos 13 gCgTTTTTgCATggAgAgCTTgAg ACTgAgCAgCTgACAACTTAA
Tos 14 TACATTgTATACCTCgTggATgAC TAAgCACAAgATCACCCCTTC
Tos 15 gACggTACTATTgAAAAgTACAag AgTTgATTCCTAgCAATTCTC
Tos 16 CTCAACCTCATAATggACgTgATA CATggTTTgTATCTCATgAgC
Tos 17 gCTTTTCTTCATggTgATCTTCAT gAgTAACAACAAAgTAcgACC
Tos 18 gCATTTTTACATggggAgTTAgAA AgTCAggACgAgAACATACCA
Tos 19 gTTACTTCTTgggAATTgAggTTT ggATCATTAgCAATCTgTAtg
Tos 20 ACAgTTTgCCCTCAgAACATgTTC AgTCTTCACATCTAACTgCTC
40 cycles of 30 seconds at 94˚C, 30 seconds at 60˚C, and
1 minute at 72˚C, followed by a final elongation step at
72˚C for 10min. Amplified products were loaded on a
1% agarose gel. The PCR products were purified by Hi-
Yield™ Gel/PCR DNA Extraction Kit (RBC) and se-
quenced by ABI3730XL (using Tos 17 primer-2).
2.6. Sequence Analysis and Database Search
Handling of primary sequences and multiple sequence
alignment were carried out using the DNAsis 3.0 soft-
ware (Hitachi, Japan). Computer-based amino acid simi-
larity searches of the Protein Identification Research,
Genome annotation DB (Gramene, http://www.gramene.
org/) and NCBI (http://www.ncbi.nlm.nih.gov/) were
carried out with the FST (Flanking Sequence Tag).
3. Results
There were 4 lines (1.3%) among the entire 297 lines that
showed evidence of “rolling 19 leaf” mutant that oc-
curred at the progeny (S1) using the brown rice culture of
japonica type ‘Ilpum’. Compared with the “rolling leaf”
mutant mutant, the donor plant ‘’Ilpum’, showed normal
leaf with equal small veins, protoplasm formations, and
conductive tissue of right and left in the midrib (Figure
1). The mutant had no equal arrangement of midrib and
small veins. Because the bulliform cell was well-develo-
ped, it ranged extensively, and the conductive tissue of
the midrib was thick. Also, the sclerenchyma was thin
(Figures 1(c) & (d)).
Though the mutant “rolling leaf” plant high and the
panicle number was less than the donor plant (Table 2),
it was believed that the growth change with morphologi-
cal characteristicsof leaf was secondary. These agro-
nomic characteristics should be studied further to under-
stand deeply the mechanism of such leaves.
The retrotransposon’s activation known as one of the
main causes of the conversion that occurred in tissue
culture of rice, specifically for the 17 set oligonucleotide
primers from conserved domain of Tos 4 ~ 20 reported in
the ‘Nipponbare’ were analyzed 13 (Table 1). The PCR
that the primers used for 3 classes (Tos 12, 15, 17) of the
Tos 14 element was amplified in the ‘Ilpum’ of the mu-
tants (Figure 2(a)). Tos element’s that appeared in the
‘Ilpum’ were different from the ‘Nipponbare’ [8]. These
differences were believed to be from a genotype differ-
ence caused by the cultivar which was used in PCR am-
Functional Analysis for Rolling Leaf of Somaclonal Mutants in Rice 1 (Oryza sativa L.)
Copyright © 2011 SciRes. AJPS
59
Figure 1. Histological differences between, ‘Ilpum’ and a mutant with rolling leaf. A: Agronomic traits of the mu-
tants with rolling leaves. B: Young leaf of, ‘Ilpum’ and the mutant. C: The defective sclerenchymatous cells on the
abaxial side of, ‘Ilpum’ and the mutant. D: Organization of megascopic leaf. 1: upper epidermis, 2: adaxial scler-
enchyma, 3: mesophyll cells, 4: vascular bundle sheath, 5: mestome sheath, 6: 11 xylem, 7: phloem, 8: lower epi-
dermis, 9: bulliform cell.
plification. The studied activation and copy numbers
confirmed that Tos elements were present in ‘Ilpum’
(Figure 2(b) and (c)). There were Tos 12 and Tos 15 in
19 positions such as the donor plant, and Tos 17 was ob-
served in 2 polymorphic bands in #15, #16 mutants,
“rolling leaf”, respectively. These results could confirm
in the Southern analysis by the Tos 17 probe, and was
activated in the S2 progeny using the RT-PCR.
Interrelation analysis of the “rolling leaf” mutant and
Tos 17 activations achieved the FST (Flanking Sequence
Tag) analysis in the Genome annotation DB (Gramene,
http://www.gramene.org/; NCBI, http://www.ncbi.nlm.nih.
gov/) using a construed 1 sequence (Tables 3 and 4). Tos
17 was situated in chromosome 11 and 12 in the donor 2
plant, ‘Ilpum’ (Table 3 and Figure 3).
The homology gene had about 12 kinds in the area that
Tos 17 had been inserted into 1 (Table 4). They were
Table 2. Agronomic traits of the mutants with rolling leaves.
Lines No. of
lines
Culm length
(cm)
Panicle length
(cm)
No. of
tillers
Rolling leaf4 81.3 ± 6.8 21.5 ± 2.4 5.9 ± 1.1
Ilpum(Ck) - 72.0 ± 4.2 21.1 ± 1.2 14.5 ± 2.4
Functional Analysis for Rolling Leaf of Somaclonal Mutants in Rice 1 (Oryza sativa L.)
Copyright © 2011 SciRes. AJPS
60
Figure 2. Detection of retrotransposon elements in the mu-
tants and a donor cultivar ‘Ilpum’ using genomic DNA
analysis. A: Detection of retrotransposon Tos 17 primer by
PCR. m; size marker (λ/HindIII). c; ‘Ilpum’. #15~#17; mu-
tants. B: DNA gel blot analysis by S1 progeny and RT-PCR
by S2 progeny of the mutants, ‘rolling leaf’. C: The second
PCR products derived from PCR amplification between the
first PCR products and adaptor primer-1 in somaclonal
mutants and a donor cultivar ‘Ilpum’. v; The bands were
isolated from agarose gel, and sequenced (pass). ; The
bands were isolated from agarose gel, and sequenced (fail).
c; Ilpum, #15~16; mutants of rolling leaf.
arabinoxylan arabinofuranohydrolase isoenzyme AXAH-
II, cytochrome cd1-nitrite reductase-like, RNA-binding
region RNP-1, metallothionein-like protein 1, and Cyto-
chrome P450. Also, transcription factor rough sheath 2
like proteins were analyzed and showed high interrela-
tionship in morphogenesis of “rolling leaf”.
4. Discussions
The mutant “rolling leaf (rl)” was reported in 11 different
kinds of the transposon element which affected the roll-
ing leaf until the present. Also the rl1~rl6 alelle, reces-
sive gene of 6 kinds, were situated within each chromo-
some 1, 4, 12, 3, 7 thru formal marker analysis [12,13].
The rl7~rl10 alelle mapping in the chromosome 5 [16,17,
21,26,27], Rl(t), had an incomplete recessive gene, map-
ping between the long arms (137 kb area) of chromosome
2 [22]. Yet there was also no report that there was any di-
rect gene cloning. OsAGO7, the “rolling leaf” related gene,
was reported to have an upward leaf curling in the over-
expressing transformants [23]. Zhang et al. [28] re-
ported that the Shallot-like 1 (SLL 1), MYB transcription
control factor, belonging to the KANADI family was
caused by the leaf-rolling cause on the chromosome 9 in
the rice. The plant height of the mutant “rolling leaf” was
higher than the donor plant. It was reported that there
was a photosynthesis difference because of the carbon
fixing or the gas exchange according to the three-dimen-
sional structure of leaf [5]. Though the mutant “rolling
leaf” was the transposon of the Tos 17, it occurred in
chromosome 11 and 12, each differed from the studies of
Shi et al. [23] and Zhang et al. [28] and the findings in
this research (Table 3 and Figure 3). This result maybe
Figure 3. Genes disrupted by insertion of Tos 17. Amino acid sequences deduced from target-site sequence (rolling
leaf) are aligned with sequenced of GenBank data (‘Nipponbare’). Red letters: amino acid sequence of Tos 17,
Rectangles: no homology.
Functional Analysis for Rolling Leaf of Somaclonal Mutants in Rice 1 (Oryza sativa L.)
Copyright © 2011 SciRes. AJPS
61
Table 3. Chromosome locations of Tos 17 in a rice mutant with rolling leaf.
Sequenced flanking
region of Tos-DNA Matched region with rice chromosomes Tos- DNA end Adaptor start Reading length
from to length Chr. from to Tos- DNA end Adaptor start Reading length
195 306 112 11 1492553 1492664 194 307 340
195 372 178 12 23812926 23812749 194 373 406
Table 4. Annotated genes of Tos 17 inserted flanking regions on chromosome in a rice 4 mutant with “rolling leaf”.
Chromosome No. Accession No. Protein Origin
NM_001072196.1 Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II Oryza sativa L.
NM_001072197.1 Cytochrome cd1-nitrite reductase-like Oryza sativa L.
NM_001072198.1 Protein kinase family protein Oryza sativa L.
NM_001072200.1 TPR-like domain containing protein Oryza sativa L.
NM_001072201.1 Resistance protein candidate (Fragment) Oryza sativa L.
11
NM_001072202.1 RNA-binding region RNP-1 Oryza sativa L.
FAA00315.1 TPA: metallothionein-like protein Oryza sativa L.
ABR25982.1 Metallothionein-like protein 1 Oryza sativa L.
ABR25363.1 Mitochondrial import inner membrane translocase subunit tim9 Oryza sativa L.
BAB61618.1 Transcription factor rough sheath 2 like protein Oryza sativa L.
BAC78592.1 pre-mRNA splicing factor Oryza sativa L.
12
AAY44413.1 Cytochrome P450 Oryza sativa L.
brought about by the mixing of a lot of gene numbers
that caused the “rolling leaf” mutant. The FST analysis
of the mutant “rolling leaf” and the cause of the muta-
tion should be studied continuously via genetic and mo-
lecular breeding of the S3 progeny to determine the rela-
tion of gene function.
5. Acknowledgements
We are grateful to Dr. Baek Hie Nahm (bhnahm@
gmail.com) for the technological study and critical read-
ing of the manuscript. Sylvia T. Lapitan (stlapitan@yahoo.
com) for critical proofreading of the manuX-X-SCRIPT.
Flanking DNA sequencing was supported by GreenGene
Biotech Inc.This work was supported by a grant from the
Next Biogreen 21 R&D program, Rural Development
Administration, Republic of Korea.
REFERENCES
[1] K. Arjun, E. Guiderdoni, G. An, Y. C. Hsing, C. D. Han,
M. C. Lee, S. M. Yu, N. Upadhyaya, S. Ramachandran
and Q. Zhang, “Mutant Resources in Rice for Functional
Genomics of the Grasses,” Plant physiology, Vol. 149,
No. 1, 2009, pp. 165-170. doi:10.1104/pp.108.128918
[2] H. G. Chin, M. S. Choe, S. H. Lee, S. H. Park, S. H. Park,
J. C. Koo, N. Y. Kim, J. J. Lee, B. G. Oh, G. Yi, S. C.
Kim, H. C. Choi, M. J. Cho, C. D. Han, “Molecular
Analysis of Rice Plants Harboring an Ac/Ds Transposable
Elementmediated Gene Trapping System,” The Plant
Journal, Vol. 19, No. 5, 1999, pp. 615-623.
[3] L. Gao, E. M. McCarthy, E. W. Ganko and J. F. McDon-
ald, “Evolutionary History of Oryza sativa LTR Retro-
Transposons: A Preliminary Survey of the Rice Genome
Sequences,” BMC Genomics, Vol. 5, No. 1, 2004, pp.
1-18. doi:10.1186/1471-2164-5-18
[4] G. Gavazzi, C. Tonelli, G. Todesco, E. arreghini, F. Raf-
faldi, F. Vecchio, G. Barbuzzi, M. Biasini and F. Sala,
“Somaclonal Variation Versus Chemically Induced Muta-
Genesis in Tomato(Lycopersicon esculentum L.),” Theo-
retical and Appled Genetics, Vol. 74, No. 6, 1987, pp.
733-738.
[5] Y. M. Govaerts, S. Jacquemoud, M. M. Verstraete and S.
L. Ustin, “Three-10 Dimensional Radiation Transfer
Modeling in a Dicotyledon Leaf,” Applied Optics, Vol. 35,
No. 33, 1996, pp. 6585-6598. doi:10.1364/AO.35.006585
[6] H. Hirochika, A. Fukuchi and F. Kikuchi, “Retrotranspo-
son Families in Rice,” Molecular and General Genetics,
Vol. 233, No. 1-2, 1992, pp. 209-216.
doi:10.1007/BF00587581
Functional Analysis for Rolling Leaf of Somaclonal Mutants in Rice 1 (Oryza sativa L.)
Copyright © 2011 SciRes. AJPS
62
[7] H. Hirochika, H. Otsuki, M. Yoshikawa, Y. Otsuki, K.
Sugimoto and S. Takeda, “Autonomous Transposition of
the Tobacco Retrotransposon Tto 1 in rice,” The Plant
Cell, Vol. 8, No. 4, 1996a, pp. 725-734.
[8] H. Hirochika, K. Sugimoto, Y. Otski, H. Tsugawa and
M .Kanda, “Retrotransposones of Rice Involved in Muta-
tions Induced by Tissue Culture,” Proceedings of Na-
tional Acadenny of Sciences of the United States of
America, Vol. 93, No. 15, 1996b, pp. 7783-7788.
doi:10.1073/pnas.93.15.7783
[9] B. O. Juliano, C. M. Perez, A. B. Blakeney, T. Castillo, N.
Ongseree, B. Laignelet, E. T. Lapis, V. V. S. Murty, C. M.
Paule and B. D. Webb, “International Cooperative Test-
ing on the Amylose Content of Milled Rice,” Starch, Vol.
33, No. 5, 1981, pp. 157-162.
[10] Y. U. Jun, S. Hu, J. Wang, S. Li, K. S. G. Wong, B. Liu,
Y. Deng, L. Dai, Y. Zhou, X. Zhang, M. Cao, J. Liu, J.
Sun, J. Tang, Y. Chen, X. Huang, W. Lin, C. Ye, W.
Tong, L. Cong, J. Geng, Y. Han, L. Li, W. Li, G. Hu, X.
Huang, W. Wi, J. Li, Z. Liu, L. Li, J. Liu, Q . Qi, J. Liu, L.
Li, X .Wang, H. Lu, T. Wu, M. Zhu, P. Ni, W. Dong, X.
Ren, X. Feng, P. Cui, X. Li, H. Wang, X. Xu, W. Zhai, Z.
Xu, J. Zhang, S .He, J. Zhang, J. Xu, K. Zhang, X. Zheng,
J. Dong, W. Zeng, L. Tao, X. Chen, J. He, D. Liu, W.
Tian, H .Xia, G. Li, H. Gao, P. Li, W. Chen, X. Wang, Y.
Zhang, J. Hu, J. Wang, S. Liu, J. Yang, G. Zhang, Z. Li,
C. Zhou, R. Chen, B. Hao, W. Zheng, S. Chen, W. Guo,
G. Li, S. Liu, G. Hunag, M. Tao, J. Wang, L. Zhu, L.
Yuan and H. Yang, “A Draft Sequence of the Rice (Oryza
sativa ssp. indica) Genome,” Chinese Science Bulletin,
Vol. 46, No. 23, 2001, pp. 1937-1942.
doi:10.1007/BF02901901
[11] M. Kawai, S. Kidou, A. Kato, H. Uchimiya, “Molecular
Characterization of cDNA Encoding for Adenylate Kinase
of Rice (Oryza sativa L.),” The Plant Journal, Vol. 2, No.
6, 1992, pp. 845-854.
[12] G. S. Khush and T. Kinoshita, “Rice Karyotype, Marker
Genes, and Linkage Group,” Rice Biotechnology, CAB
International, Wallingford, 1991, pp. 83-107.
[13] T. Kinoshita, “Gene Analysis and Linkage Map,” Biology
of Rice, JSSP/Elsevier, Tokyo, 1984 pp. 187-274.
[14] P. J. Larkin, P. M. Bank, R. Bhati, R. I. S. Brettelli, P. A.
Davies, S. A. Ryan, W. R. Scowcroft, L. H. Spindle and
G. T. Tanner, “From Somatic Variant to Variant Plants:
Mechanisms and Applications,” Genomes, Vol. 31, No. 2,
1989, pp. 705-711.
[15] P. J. Larkin and W. R. Scowcroft, “Somaclonal Varia-
tion—A Novel Source of Variability from Cell Cultures
for Plant Improvement,” Theoretical and Applied Genet-
ics, Vol. 60, No. 4, 1981, pp. 197-214.
doi:10.1007/BF02342540
[16] S. G. Li, Y. Q. Ma, P. He, H. Y. Li, Y. Chen, K. D. Zhou
and L. H. Zhu, “Genetics Analysis and Mapping the Flag
Leaf Roll in Rice (Oryza. sativa. L.),” Journal Sichuan
Ag- riculture University, Vol. 16, 1998, pp. 391-393.
[17] Z. Luo, Z. Yang, B. Zhong, Y. Li, R. Xie, F. Zhao, Y.
Ling and G. He, “Genetic Analysis and Fine Mapping of
a Dynamic Rolled Leaf Gene, RL 10(t), in Rice (Oryza.
sativa. L.),” Genome, Vol. 50, No. 9, 2007, pp. 811-817.
doi:10.1139/G07-064
[18] A. Miyao, Y. Iwasaki, H. Kitano, J. I. Itoh, M. Maekawa,
K. Murata, O. Yatou, Y. Nagato and H. Hirochika, “A
Large-Scale Collection of Phenotypic Data Describing an
Insertional Mutant Population to Facilitate Functional
Analysis of Rice Genes,” Plant Molecular Biology , Vol.
63, No. 5, 2007, pp. 625-635.
doi:10.1007/s11103-006-9118-7
[19] T. Murashige and F. Skoog, “A revised Medium for
Rapid Growth and Bioassays with Tobacco Tissue Cul-
tures,” Physioogial Plantarum, Vol. 15, No. 3, 16 1962,
pp. 473-497.
[20] K. M. Nori, K. Miyoshi, K. I. Nonomura, Y. Yamazaki
and Y. Ito, “Rice Mutants and Genes Related to Organ
Development, Morphogenesis and Physiological Traits,”
Plant Cell Physiology, Vol. 46, No. 1, 2005, pp. 48-62.
doi:10.1093/pcp/pci506
[21] Y. j. Shao, Z. X. Chen, Y. F. Zhang, E. H. Chen, D. C. Qi,
J. Miao and X. B. Pan, “One Major QTL Mapping and
Physical Map Construction for Rolled Leaf in Rice,” Acta
Genetica Sinica (in Chinese), Vol. 32, No. 5, 2005a, pp.
501-506.
[22] Y. J. Shao, C. H. Pan, Z. X. Chen, S. M. Zuo, Y. F.
Zhang and X. B. Pan, “Fine Mapping of an Incomplete
Recessive Gene for Leaf Rolling in Rice(Oryza. sativa.
L.),” Chiness Science Bulletin (in Chinese), Vol. 50, No.
21, 2005b, pp. 2466-2472.
[23] Z. Y. Shi, J. Wang, X. S. Wan, G. Z. Shen, X. Q. Wang
and J. l. Zhang, “Over-Expression of Rice OsAGO 7 Gene
Induces Upward Curling of the Leaf Blade that Enhanced
Erect-Leaf Habit,” Planta, Vol. 226, No. 1, 2007, pp.
99-108. doi:10.1007/s00425-006-0472-0
[24] K. Sugimoto, Y. Otsuki, S. Saji and H. Hirochika,
“Transposition of the Maize Ds Element from a Viral
Vector to the Rice Genome,” The Plant Journal, Vol. 5,
No. 6, 1994, pp. 863-871.
doi:10.1046/j.1365-313X.1994.5060863.x
[25] B. Winnepenninckx, T. Backeljau and R. De Wachter,
“Extraction of high molecular weight DNA from mol-
lusks,” Trends in Genetics, Vol. 9, No. 12, 1993, pp. 407.
doi:10.1016/0168-9525(93)90102-N
[26] Q. J. Xie, M. C. Ruch and J. H. Oard, “Homozygous
Variation in Rice Somaclones: Non Random Variation In-
stead of Mitotic Recombination,” Crop Science, Vol. 35,
No. 4, 1995, pp. 954-957.
doi:10.2135/cropsci1995.0011183X003500040002x
[27] C. J. Yan, S. Yan, Z. Q. Zhang, G. H. Liang, J. F. Lu and
M. H. Gu, “Genetic Analysis and Gene Fine Mapping for
a Rice Novel Mutant rl 9(t) with Rolling Leaf Character,”
Chi- ness Science Bulletin (in Chinese), Vol. 51, No. 1,
2006, pp. 63-69.
[28] G. H. Zhang, Q. Xu, X. D. Zhu, Q. Qian and H. W. Xue,
“Shallot-Like is a KANDI Transcription Factor that
Modulates Rice Leaf Rolling by Regulating Leaf Abaxial
Cell Development,” The Plant Cell Prev iew, Vol. 21, No.
3, 2009, pp. 719-735. doi:10.1105/tpc.108.061457