Advances in Biological Chemistry, 2013, 3, 564-578 ABC
http://dx.doi.org/10.4236/abc.2013.36065 Published Online December 2013 (http://www.scirp.org/journal/abc/)
Isolation and molecular characterization of a novel
pseudomonas putida strain capable of degrading
organophosphate and aromatic compounds
Rupa Iyer*, Victor G. Stepanov, Brian Iken
Department of Biology and Biochemistry, University of Houston, Houston, USA
Corresponding Author: *[email protected]
Received 8 October 2013; revised 12 November 2013; accepted 27 November 2013
Copyright © 2013 *Rupa Iyer et al. This is an open access article distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT
A bacterial strain designated in this st udy as POX N01
was found to be capable of degrading the synthetic
organophosphorus pesticides paraoxon and methyl
parathion. The strain was initially isolated through
enrichment technique from rice field soil near Har-
lingen, Texas. Phylogenetic analysis based on 16S
rRNA, gyrB and rpoD gene alignments identified the
POXN01 isolate as a new strain of Pseudomonas
putida, which is closely related to the recently discov-
ered nicotine-degrading strain Pseudomonas putida
S16. While being unable to metabolize nicotine, the
POXN01 isolate was observed to actively proliferate
using monocyclic aromatic hydrocarbons, in particu-
lar toluene, as nutrients. Search for the genetic deter-
minants of paraoxon catabolism revealed the pres-
ence of organophosphorus-degrading gene, opd, iden-
tical to the one from Sphingobium fuliginis (former
Flavobacterium sp. ATCC 27551). Assimilation of aro-
matic compounds likely relies on phc ARKLMNOPQ
gene cluster for phenol, benzene and toluene catabo-
lism, and on benRABCDKGEF cluster for benzoate
catabolism. The observed versatility of POXN01
strain in degradation of xenobiotics makes it useful
for the multi-purpose bioremediation of contamina-
ted sites in both agricultural and industrial environ-
mental settings.
Keywords: Organophosphates; Aromatic Hydrocarbons;
Bioremediation; Pseudomonas putida
1. INTRODUCTION
Quality of life achieved by modern society would be im-
possible without tremendous development of chemical
industry within the past century. As a side effect of this
growth, large amounts of man-made chemicals have been
released into the environment either intentionally (as
fertilizers, pesticides, or waste deposits) or by accident.
Consequently, a substantial number of terrestrial and
marine habitats today are contaminated by various xeno-
biotic compounds, many of which are harmful to living
organisms.
Among other xenobiotics, organophosphorus (OP)
compounds are of great concern considering their envi-
ronmental impact and threat to human health. These syn-
thetic chemicals are potent cholinesterase inhibitors once
intended for military use, but at the present time, widely
employed as insecticides. Occupational exposure to the
OP pesticides in agricultural industries and self-poison-
ing with OP compounds causes significant health prob-
lems [1-6]. In addition, there are risks associated with
major international efforts to destroy the stockpiled che-
mical warfare agents [7].
Despite their high toxicity, OP pesticides are exten-
sively used in developing countries [8]. Exposure to or-
ganophosphate pesticides both purposely and acciden-
tally results in millions of poisonings worldwide and
200,000 to 500,000 deaths annually throughout Asia and
the Western Pacific [9-12]. While being removed from
large-scale use in developed countries, organophosphates
still may threaten metropolitan water supplies through
unintentional contamination [13,14].
Removing environmentally hazardous OP compounds
through detoxification by microbial enzymes has become
the focus of biodegradation research over the last few
decades. Previous reports have identified several orga-
nophosphate-degrading bacterial species, among them are
Sphingobium fuliginis (former Flavobacterium sp. ATCC
27551) [15,16] and Brevundimonas diminuta GM (for-
mer Pseudomonas diminuta GM) [17,18], both express-
*Corresponding author.
OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578 565
ing identical organophosphate hydrolase enzymes. Or-
ganophosphate hydrolase is a zinc-containing homodi-
meric membrane protein that has been found to hydro-
lyze paraoxon at a rate approaching the diffusion limit
[19]. The enzyme is encoded by an opd (organophos-
phate degradation) gene and is capable of hydrolyzing a
wide range of oxon and thion organophosphates [20,21].
The opd gene has been detected in soil microorganisms
belonging to different taxonomic groups, which points
to its horizontal spread using mobile genetic elements
(transposons, plasmids, phages) as transfer vehicles [22-
28].
Currently, the isolation of a microorganism capable of
degrading a selected xenobiotic compound is a routine
task. However, modern DNA sequencing technologies
allow us to quickly assess biotransformation potentials of
the newly discovered strains well beyond the originally
targeted activity. A strain that can simultaneously de-
grade multiple types of xenobiotics will be a preferable
tool for decontamination of heavily polluted sites like
landfills and sewage collectors. It can also be included in
a variety of environmental clean-up scenarios as a multi-
purpose remedy for pollution.
We have isolated a bacterial strain capable of degrada-
tion of the OP pesticides paraoxon and methyl parathion
as well as several commonly used industrial aromatic
hydrocarbons. In the present paper, we describe charac-
terization of this microorganism along with identification
of molecular constituents responsible for its ability to
detoxify xenobiotics.
2. MATERIALS AND METHODS
2.1. Ethics Statement
The soil sample collected for this study was taken from a
rice field on private land by a student as part of a training
program in biotechnology funded by the Texas Work-
force Commission from 2011-2012. The student was
given consent and access to the field by the landowner
prior to collecting the sample. Sample collection in-
cluded only a small portion of the topsoil and did not
endanger any protected species.
2.2. Chemicals, Enzymes and Oligonucleotides
Paraoxon (O,O-diethyl O-p-nitrophenyl phosphate), me-
thyl parathion (O,O-dimethyl O-p-nitrophenyl phospho-
rothioate), L-(-)nicotine, toluene, benzene, and phenol
were obtained from Sigma-Aldrich (St. Louis, MO).
Other chemicals were either from Sigma-Aldrich (St.
Louis, MO) or from Fisher Scientific (Pittsburgh, PA).
Egg white lysozyme and DNase-free ribonuclease A
were obtained from Sigma-Aldrich (St. Louis, MO). Pro-
teinase K was from Promega (Madison, WI). Synthetic
deoxyoligonucleotides (Table 1) were purchased from
Eurofins MWG (Huntsville, AL).
2.3. Media for Bacterial Growth
A carbon-deficient minimal medium (CSM) had the fol-
lowing composition: 0.2 g L−1 MgSO4 * 7H2O; 0.08 g
L−1 Ca(NO3)2 * 4H2O; 0.005 g L−1 FeSO4 * 7H2O; 4.8 g
L−1 K
2HPO4; 1.2 g L−1 KH2PO4. Immediately prior to
inocu- lation, it was supplemented with an appropriate
carbon source. Luria-Bertani medium (LB) was prepared
from the following components: 10 g L−1 BactoTryptone
(Dif- co Laboratories, Detroit, MI); 5 g L−1 yeast extract
(Difco Laboratories, Detroit, MI); 10 g L−1 NaCl. The pH
of both mediums was adjusted to 7.5. For growth on a
solid surface, the media were supplemented with 1.5 g
L−1 BactoAgar (Difco Laboratories, Detroit, MI).
2.4. Isolation of Paraoxon-Metabolizing
Microbial Strains from a Soil Sample
Soil samples were collected from a rice field near Har-
lingen (Cameron County, TX) at 26˚11′N, 97˚35′W.
Air-dried soil (1 g) was suspended in 50 mL of the LB
medium. The suspension was kept for 2 days on a rotary
shaker at 30˚C and 200 rpm. Insoluble materials were
allowed to settle out and an aliquot (100 μL) from the
cleared supernatant was used to inoculate 3 mL of CSM
supplemented with 0.1 mg mL−1 paraoxon. The culture
was incubated for 1 week on a rotary shaker at 30˚C and
200 rpm. 100 μL of the bacterial suspension was trans-
ferred into 3 mL of fresh paraoxon-containing CSM, and
the incubation step was repeated. After six consecutive
subcultivations, the bacteria were plated on a CSM agar
containing variable concentrations of paraoxon (0.1 - 2.0
mg mL−1). After overnight incubation at 30˚C, one dis-
tinct isolate that included large white or creamy-white
circular colonies with irregular margins was found on the
plates. This isolate, designated as POXN01, was deter-
mined to be a Gram-negative rod-shaped bacterium,
which exhibited noticeable paraoxon- and methyl para-
thion-degrading activity and was capable of growing on
minimal medium with paraoxon as a carbon source.
Table 1. Primers used for PCR and sequencing. M represents
an equimolar mixture of A and C.
Primer IDTarget Sequence (5' to 3') Ref.
27F 16S rDNAAGAGTTTGATCMTGGCTCAG[30]
U1510R16S rDNAGGTTACCTTGTTACGACTT [31]
F196 opd geneCGCGGTCCTATCACAATCTC[32]
F450 opd geneCGCCACTTTCGATGCGAT [32]
R757 opd geneTCAGTATCATCGCTGTGACC[32]
R840 opd geneCTTCTAGACCAATCGCACTG[32]
R977 opd geneTCACTCTCAGTGGAATGAAGGthis study
Copyright © 2013 SciRes. OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578
566
2.5. Effect of OP and Aromatic Compounds on
Bacterial Growth
To assess the effect of xenobiotics on the growth of
POXN01 strain, the bacterial suspension was spread on
CSM agar plates supplemented with the increasing con-
centrations of organophosphate or monocyclic aromatic
compounds. Paraoxon and methyl parathion concentra-
tion in agar was 100, 200 and 400 μg mL−1, nicotine
concentration was 8, 16 and 33 mg mL−1, and toluene
and benzene concentration was 33, 50 and 66 mg mL−1.
A 200 μl of 10,000-fold diluted (paraoxon, methyl para-
thion) or 5000-fold diluted (nicotine, toluene, benzene)
stationary culture of POXN01 strain was evenly spread
over the surface of an appropriate agar medium (plate
diameter 10 cm, volume of solid medium 30 mL). The
plates were incubated at 30˚C for 20 hours, and photo-
graphed for further analysis.
2.6. Degradation of OP and Aromatic
Compounds by Resting Cells
Bacterial cultures were grown in LB medium (150 mL)
on a rotary shaker at 37˚C and 200 rpm until cell density
reached OD600 equal to 1.0. Cells were harvested by cen-
trifugation for 10 min at 600 g and 4˚C, washed three
times with 50 mM potassium phosphate (pH 7.0), and
finally resuspended in 25 mL of the same buffer. The
degradation experiment was initiated by mixing the cell
suspension with an appropriate amount of a target com-
pound. Concentration of paraoxon and methyl parathion
in the degradation mixtures was 100 μg mL−1, while
concentration of nicotine, toluene, benzene and phenol
was 3 mg mL−1. The mixtures were incubated at 30˚C
under constant shaking (120 rpm). Aliquots were taken
from the mixtures at regular intervals, centrifuged to re-
move cells and insoluble materials, and analyzed either
for the removal of target compound or for the accumula-
tion of its degradation products in aqueous phase. De-
composition of OP pesticides was monitored by measur-
ing absorbance of the released metabolic product
p-nitrophenol at 405 nm. Degradation of nicotine, tolu-
ene, benzene and phenol was tracked by UV spectrome-
try within the range of 220 - 340 nm. TLC analysis of the
selected samples was done on Silica Alu Foil plates
(Sigma-Aldrich, St. Louis, MO) and Whatman KC18F
plates (Fisher Scientific, Pittsburgh, PA) in solvent sys-
tems chloroform : ethanol : methanol: 0.5 M NaOH 30 :
15 : 2 : 1.5 (v/v) and methanol: water 2:1 (v/v), respec-
tively.
2.7. Isolation of Cellular DNA
Total cellular DNA was extracted using the CTAB
method [29] with the following modifications: cells were
resuspended in TE buffer containing lysozyme (50,000
units mL−1) and ribonuclease A (300 Kunitz units mL−1),
and incubated for 1 hour at 37˚C. Immediately prior to
lysis, proteinase K (>30,000 units g−1) was added to a
final concentration 0.25 mg mL−1. Cells were lysed with
0.5% (w/v) SDS for one hour at 37˚C. The subsequent
removal of polysaccharides and residual proteins was
performed as described in the original protocol.
2.8. 16S rDNA Sequencing
Fragments of the 16S rRNA gene were amplified by PCR
from cellular DNA using 16S rDNA-specific primers
(Table 1) [30-32] and PCR Master Mix (Promega,
Madison, WI). The PCR conditions were as follows: ini-
tial denaturation at 94˚C for 4.5 min, 32 cycles consisting
of denaturation at 94˚C for 0.5 min, annealing at 52˚C
for 0.5 min, and extension at 72˚C for 1 min, and final
elongation at 72˚C for 4 min. PCR products were col-
umn-purified [33] and sequenced bi-directionally by the
dye-terminator method with the same primers used for
amplification. Sequencing was performed by SeqWright,
Inc. (Houston, TX).
2.9. Random Sequencing of Genomic DNA
Purified cellular DNA (5 μg) of the POXN01 isolate was
converted into a shotgun DNA library using a Paired End
DNA Sample Prep Kit (Illumina, Inc., San Diego, CA)
according to the manufacturer's instructions. Sequencing
was performed on an Illumina Genome Analyzer II with
a paired-end module at the Solexa Sequencing Core Fa-
cility of M. D. Anderson Cancer Center (University of
Texas, Houston, TX). After removal of duplicates and
low quality sequences from the raw dataset with the
FASTX toolkit [34], a total of 3.46 million usable pairs
of 36 nucleotide-long reads was obtained for a total of
249.14 million nucleotides. For a 6 Mb bacterial genome,
this would correspond to 41× coverage at the even dis-
tribution of reads. The reads were assembled into contigs
using Velvet 1.2.07 [35] or Edena 3 dev120626 [36] de
novo assemblers after several preliminary runs were un-
dertaken for parameter optimization. Eventually the Vel-
vet assembly was performed with a hash length of 19,
coverage cut-off of 2 and an expected coverage of 12.5×.
Other parameters were found to lesser affect length and
number of the assembled contigs. The Edena assembly
was performed with a minimum overlap size of 18 and a
coverage depth limit of 3. Both sets of contigs were
evaluated batchwise against an NCBI-maintained nu-
cleotide sequence database, nt (as of July 27, 2012), us-
ing NCBI-BLAST-2.2.25 + software [37,38]. Sequences
of the genes of interest from the POXN01 isolate were
reconstructed from the contigs exhibiting high similarity
to the homologues from closely related bacterial species.
The reconstruction from contigs was supplemented with
Copyright © 2013 SciRes. OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578 567
alignments of the short reads to the homologous genes in
order to validate the reconstructed sequences. The ali-
gnments were performed using either Mosaik 1.0.1388
[39] or BWA 0.5.9 [40] software packages.
2.10. Phylogenetic Analysis of Gene Sequences
Multiple DNA sequence alignments were performed us-
ing ClustalX 2.0.12 and corrected manually when neces-
sary [41]. Phylogenetic affiliations were evaluated using
a Phylip 3.69 software package [42]. Evolutionary dis-
tances for the neighbor-joining method of sequence clus-
tering were calculated using the F84 model of nucleotide
substitutions [43]. Maximum likelihood modeling of
DNA sequence evolution was done with transition- trans-
version ratio set at 2. The topology of generated dendro-
grams was validated by bootstrapping with 1000 repli-
cates for neighbor-joining trees and 200 replicates for
maximum likelihood trees. Trees were visualized using
TreeGraph 2.0.45 [44].
2.11. Detection and Identification of
Organophosphorus Hydrolase gene
The presence of an organophosphorus hydrolase gene in
the bacterial genome was assessed by PCR with forward
and reverse primers derived from the sequence of the
parathion hydrolase gene of Sphingobium fuliginis (for-
mer Flavobacterium sp. strain ATCC 27551), accession
number M29593 (Tab le 1) [30-32]. PCR was performed
under the following conditions: initial denaturation at
94˚C for 4.5 min, 32 cycles consisting of denaturation at
94˚C for 0.5 min, annealing at 55˚C for 0.5 min, and ex-
tension at 72˚C for 1 min, and final chain elongation at
72˚C for 4 min. PCR products were analyzed by electro-
phoresis in a 2% agarose gel with 1 × TBE as the run-
ning buffer. When necessary, the obtained DNA frag-
ments were excised from the gel, purified as described in
[33], and sequenced by the dideoxy-terminator method at
SeqWright, Inc. (Houston, TX).
2.12. Nucleotide Sequence Accession Numbers
POXN01 nucleotide sequences were deposited in Gen-
Bank under the following accession numbers: KC189953
(benABCDKGEF operon), KC189954 (benR gene), KC
189955 (catBCA operon), KC189956 (gyrB gene), KC
189957 (opd gene fragment), KC189958 (pcaIJFTBDC
gene cluster), KC189959 (pcaRK gene cluster), KC152
907 (phcARKLMNOPQ gene cluster), KC189960 (rpoD
gene), KC189961 (16S rRNA gene fragment), KC189 962
(todX gene), KC189963 (ttg2ABCDEFG gene cluster),
KC189964 (ttg8 gene), KC189965 (ttgRABC gene cluster).
3. RESULTS AND DISCUSSION
The bacterial strain designated as POXN01 was isolated
from rice field soil by enriching for bacteria capable of
using synthetic OP pesticide paraoxon as the sole source
of carbon. When grown in pure culture in paraoxon-
supplemented CSM medium, the isolate promoted a
color change of the culture medium to yellow, which
pointed to its ability to hydrolyze paraoxon to p-nitro-
phenol and diethylphosphate. The isolate was observed
to form colonies on CSM agar supplemented with 100 -
400 μg mL−1 paraoxon or methyl parathion as the only
available carbon sources (Figure 1). Thus, the strain is
capable of both degrading the OP pesticides and utiliz-
ing products of their degradation as nutrients. Paraoxon
is apparently a better substrate for the POXN01 isolate
than methyl parathion since paraoxon decomposition by
POXN01 resting cells proceeds noticeably faster (Figure
2).
Initial attempt to identify the isolate relied on se-
quence analysis of 16S rRNA genes probed by PCR with
standard 16S rDNA-specific primers. A fragment of 16S
rDNA from strain POXN01 was obtained by PCR with
primer pair 27F-U1510R. BLAST analysis revealed the
amplicon to be identical to a number of sequences from
GenBank database, and all of them belonged to environ-
mental isolates related to the genus Pseudomonas . How-
ever, these isolates did not apparently form a coherent
phylogenetic group, and the majority of them were not
characterized beyond 16S rDNA sequencing. Thus, the
exact taxonomic position of the POXN01 strain remained
obscure.
Further insight into the phylogenetic affiliation of the
POXN01 isolate was obtained from random sequencing
of its genomic DNA using the Illumina short read se-
quencing system. The collected short reads were as
(a)
(b)
Figure 1. Growth of POXN01 isolate on CSM agar plates sup-
plemented with methyl parathion (a) or paraoxon (b). A culture
dilution factor of 10 - 4 was used for plate inoculation. Images
depict colony growth within representative 1 cm2 frames.
Copyright © 2013 SciRes. OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578
568
Figure 2. Degradation of paraoxon and methyl parathion by
POXN01 isolate. Starting concentration of paraoxon and
methyl parathion for degradative analysis was 100 μg mL-1.
Concentration of pnitrophenol, the metabolic byproduct of
paraoxon and methyl parathion, in the media was derived from
the absorbance at 405 nm. P. putida strain CBF10-2 harboring
the opd gene (67) was used as a positive control. All values
have been corrected for the spontaneous organophosphate hy-
drolysis by subtracting the amount of p-nitrophenol formed in
the presence of E. coli JM109/pUC19 cells (non-OP-degrading
strain). Shown are paraoxon degradation by POXN01 isolate
(diamonds), methyl parathion degradation by POXN01 isolate
(triangles), and paraoxon degradation by P. putida CBF10-2
(circles).
sembled using Velvet or Edena assemblers into two re-
specttive sets of contigs. Each set was used to perform a
BLAST similarity search through the NCBI's nt nucleo-
tide sequence database. In both cases the vast majority of
top scoring hits were against Pseudomonas putida nu-
cleotide sequences. Among bacteria with sequenced
complete genomes, a nicotine-degrading strain P. putida
S16 exhibited the highest degree of similarity to the
POXN01 isolate (Table 2).
It is known that 16S rDNA similarity analysis alone
does not provide satisfactory intrageneric resolutions for
pseudomonads, and therefore, it is often supplemented by
sequence comparison of other conserved genes [46-50].
Two housekeeping genes, gyrB and rpoD, are frequently
utilized as molecular markers to elaborate phylogenetic
relationships within the genus Pseudomonas [48,51-53].
Sequences of the POXN01 gyrB and rpoD genes were
recovered from the obtained contigs of POXN01 ge-
nomic DNA and individually aligned with the homolo-
gous genes from type strains of 105 species belonging to
genus Pseudomona s. This was combined with analogous
Table 2. Summary of POXN01 genome sequence assembly.
Only contigs longer than 100 bp were considered. BLAST
search was performed with E-value cut-off 10−6. For each men-
tioned P. putida strain, the whole genome sequence is available.
Edena Velvet
Number of assembled contigs 8,230 9,725
Total number of base pairs in
assembled contigs 4,843,570 4,885,502
Total number of base pairs in
contigs with a single top BLAST
hit in nt database
4,686,122 4,719,402
of those,
total number of base pairs aligned to
BLAST targets (percent identity
among the aligned base pairs)
4,607,345
(97.67)
4,601,117
(97.64)
of those,
with top hit to a sequence originating
from a Pseudomonas putida strain
4,559,596
(97.82)
4,559,426
(97.80)
of those,
from P. putida S16 4,323,490
(98.39)
4,317,142
(98.37)
from P. putida GB-1 86,772
(88.19)
69,629
(88.13)
from P. putida BIRD-1 44,467
(88.77)
49,508
(88.42)
from P. putida ND6 25,052
(86.17)
21,272
(85.74)
from P. putida KT2440 23,227
(86.32)
31,081
(86.92)
from P. putida F1 13,595
(87.10)
13,379
(86.95)
from P. putida DOT-T1E 14,812
(84.94)
20,855
(86.87)
from P. putida W619 15,230
(81.43)
19,994
(83.86)
from other P. putida strains 12,951
(90.38)
16,566
(92.83)
with top hit to a sequence originating
from another species of genus Pseudo-
monas
30,686
(82.60)
28,832
(81.28)
with top hit to a sequence originating
from an organism unrelated
to genus Pseudomonas
17.063
(83.26)
12,859
(77.24)
Total number of base pairs in contigs
with multiple equally good top
BLAST hits in nt database
79,843 79,170
Total number of base pairs in contigs
with no BLAST hits in nt database 77,605 86,930
alignment of 16S rDNA genes. An unrooted neighbor-
joining tree was computed from concatenated individual
alignments joined in the following order: 16S rDNA -
gyrB - rpoD. The POXN01 isolate was found grouped
with P. monteilii within P. putida group of species (Fig-
ure S1). The refined analysis of POXN01 taxonomic
affiliation was performed as above and included 20
strains of Pseudomonas pu tida , 8 other species belonging
Copyright © 2013 SciRes. OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578 569
to the P. putida intrageneric group (P. fulva, P. parafulva,
P. entomophila, P. monteilii, P. mosselii, P. plecoglossi-
cida, P. cremoricolorata, and P. oryzihabitans), and P.
aeruginosa taken as an outgroup. In both maximum like-
lihood and neighbor-joining trees, the POXN01 isolate
was clustered together with P. putida S16 known for its
ability to efficiently metabolize nicotine [54,55], P.
putida BH, which can use phenol as a nutrient [56,57],
and P. putida A10L, which can feed on 2-hydroxy-2-
phenylacetate [58] (Figure 3). This whole branch is lo-
cated somewhat closer to P. monteilii than to P. putida
type strain, ATCC12633, which explains the observed
association of POXN01 isolates with P. monteilii rather
than with P. putida on the genus-wide tree.
Since the decomposition of paraoxon by the POXN01
strain apparently proceeds via the hydrolysis of a phos-
phoester bond yielding diethylphosphate and p-nitro-
phenol, the obtained fragments of its genomic DNA se-
quence were searched for the presence of an organo-
phosphorus hydrolase gene. However, the sequenced part
of the POXN01 genome did not contain any segment
with significant similarity to the genes of known OP-
degrading enzymes. Therefore, we attempted to identify
organophosphorus hydrolase gene by PCR. Among OP-
hydrolyzing enzymes, the most studied so far is a prod-
uct of opd gene, which was found in Sphingobium fu-
liginis [27,59], Brevundimonas diminuta GM [17,27],
and in several representatives of genera Pseudomonas
and Agrobacterium (in the latter case the gene is design-
nated opdA) [24-26,60]. Detection of the gene in the
POXN01 strain was performed according to an estab-
lished protocol that relies on analytical PCR with opd-
specific primers [32]. PCR on the whole POXN01 ge-
nomic DNA yielded a single amplicon of the expected
size for each of the primer pairs F196-R757, F196-R840,
F450-R757, and F450-R840 (Figure 4). The largest am-
plicon obtained with primer pair F196-R977 was se-
quenced, and its sequence was found to be identical to
that of the opd gene from S. fuliginis (Table 3).
Availability of sequenced fragments of POXN01 ge-
nome made it possible to search for the genes involved in
degradation of other xenobiotics. In spite of high overall
similarity to P. putida S16, no nicotine catabolism genes
were identified in the POXN01 contigs. Furthermore, the
POXN01 strain was unable to grow on nicotine-supple-
mented CSM and its resting cells did not degrade nico-
tine (data not shown). At the same time, POXN01 ge-
nome was found to contain several gene clusters related
to the catabolism of monocyclic aromatic hydrocarbons
(Table 3). In agreement with this finding, the POXN01
strain formed colonies on benzene- and toluene-supple-
mented CSM agar (Figure 5). Incubation of POXN01
resting cells with benzene, phenol, or toluene in phos-
phate buffer resulted in significant alteration of the UV
absorption spectra of the solutions, which implies forma-
tion of water-soluble products of decomposition of these
aromatic compounds (Figure 6). This was accompanied
by accumulation of fluorescent metabolite(s) detected by
TLC analysis (Figure S2). Overall, these observations
revealed the ability of POXN01 strain to tolerate pres-
ence of various aromatic hydrocarbons, and to degrade
(a)
(b)
Figure 3. Phylogenetic trees derived from concatenated align-
ments of 16S rRNA - gyrB - rpoD genes of the POXN01 iso-
late and species belonging to the Pseudomonas putida in-
trageneric group. The trees were rooted using Pseudomonas
aeruginosa as an outgroup. Bootstrap values expressed as per-
centages of the total number of replicates are shown next to
each node (values below 50% are not shown). Scale of the total
number of replicates are shown next to each node (values be-
low 50% are not shown). Scale.
Copyright © 2013 SciRes. OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578
570
Figure 4. Detection of the opd gene in the genomic DNA of the
POXN01 isolate. Electrophoretic analysis of PCR products
obtained by amplification of the genomic DNA of the POXN01
strain with opd-specific primer pairs F450-R757 (lane 1),
F450-R840 (lane 2), F196-R757 (lane 3) and F196-R840 (lane
4). The expected length of PCR fragments is 304 bp, 390 bp,
584 bp and 670 bp, respectively.
(a)
(b)
Figure 5. Growth of POXN01 isolate on CSM agar plates sup-
plemented with toluene (a) and benzene (b). A culture dilution
factor of 2 × 10 - 4 was used for plate inoculation. Images
depict colony growth within representative 1 cm2 frames.
them in the course of assimilation.
The initial steps of aromatic hydrocarbon degradation
by the POXN01 strain likely involve phc and ben gene
clusters. phc (phenol catabolism) cluster includes genes
for catechol 1,2-dioxygenase (phcA), sigma54-dependent
transcriptional activator (phcR), six subunits of multi-
component phenol/benzene hydroxylase (phcKLMNOP),
and conserved exported protein of unknown function
(designated here as phcQ). Phenol/benzene hydroxylase
can oxidize both phenol and benzene to catechol, which
is then converted to cis,cis-muconate through intradiol
cleavage catalyzed by catechol 1,2-dioxygenase [61].
ben cluster consists of nine genes involved in benzoate
uptake and degradation: transcriptional regulator (benR),
three subunits of benzoate 1,2-dioxygenase (benABC),
1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehy-
drogenase (benD), two putative benzoate transporters
(benK, benE), catechol 1,2-dioxygenase (designated here
as benG), and benzoate-specific outer membrane porin
(benF). The enzymes encoded in ben cluster convert
benzoate to cis,cis-muconate via 1,2-cis-dihydroxyben-
zoate and catechol (62). Thus, phenol, benzene, and ben-
zoate upper degradation pathways converge at cis,cis-
muconate, which is further processed by the enzymes of
catBCA operon and pca regulon to tricarboxylic acid
cycle intermediate, succinyl-CoA (Figure 7). At the
same time, no close homologs of the known genes for the
specialized toluene degradation enzymes have been
found. While this may certainly result from incomplete-
ness of the available POXN01 genome sequence, there is
a possibility that the toluene ring fission is initiated by
phenol/benzene hydroxylase. Indeed, this enzyme exhib-
its quite a relaxed specificity towards their aromatic hy-
drocarbon substrates, and can oxidize toluene albeit at a
lower rate than phenol and benzene [63]. Similarly, it
might hydroxylate p-nitrophenol released during parao-
xon hydrolysis, thus making it susceptible to dioxi-
genase-mediated ring cleavage.
An ability of POXN01 strain to proliferate in the en-
vironment containing toxic substances while using them
as nutrients implies tight control over their uptake and
intracellular concentration. The strain maintains homeo-
stasis using TtgABC efflux pump to expel aromatic hy-
drocarbons and some antibiotics from the cytoplasm
[64,65]. It is supplemented by another putative trans-
porter complex, Ttg2, which has been shown to signify-
cantly increase host tolerance of toluene [66]. Hydrocar-
bon uptake is mediated by a TodX-like outer membrane
channel protein with a hatch domain regulating a passage
of hydrophobic compounds to the periplasm [67]. In ad-
dition, the strain carries ttg8 gene encoding a conserved
protein of unknown function, which plays an important
role in resistance to toluene [66]. The protein exhibits a
pronounced similarity to O-antigen polymerases, and as
such might control permeability of cell envelope to xeno-
biotics.
The discovered biotransformation capabilities of
POXN01 strain may find application in a variety of tasks.
The strain can be used to speed up mineralization of OP
pesticides in agricultural systems and sewage water, to
degrade chemical warfare agents, and to contain spills of
petroleum hydrocarbons and related industrial chemicals.
Further studies on POXN01 metabolism might reveal
other useful properties of this microorganism.
5. ACKNOWLEDGEMENTS
Partial funding for this research was supplied by the Texas Workforce
Copyright © 2013 SciRes. OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578
Copyright © 2013 SciRes.
571
OPEN ACCESS
Table 3. Genes identified in POXN01 strain.
Closest homologous gene
Gene
CDS
length,
bp
G + C
content,
%
Putative function
of gene product Gene ID Organism Accession
number
Percent
nucleotide
identity in
CDS
Percent
amino acid
identity in
gene product
Percent
amino acid
similarity in
gene product
Rrs
(fragment) 1498 53.81 16S ribosomal
RNA 16S rRNAPseudomonas sp.
clone Filt.89 HM152676100 - -
opd
(fragment) 823 56.38 organophosphate
hydrolase opd Sphingobium
fuliginis M29593100 100 100
gyrB 2418 57.28 DNA gyrase subunit beta PPS_0012Pseudomonas
putida S16 NC_01573398.96 99.75 99.87
rpoD 1848 60.34 RNA polymerase sigma
factor RpoD (sigma 70) PPS_0383Pseudomonas
putida S16 NC_01573399.89 100 100
phcA 897 65.89 catechol 1,2-dioxygenase PputGB1_33
13
Pseudomonas
putida GB-1 NC_01032285.71 89.36 94.01
phcR 1701 65.96 sigma 54-specific
transcriptional regulator
PputGB1_33
12
Pseudomonas
putida GB-1 NC_01032290.65 96.82 97.88
phcK 255 64.31 phenol/benzene hydroxylase
subunit
PputGB1_33
11
Pseudomonas
putida GB-1 NC_01032291.76 92.94 94.11
phcL 993 66.67 phenol/benzene hydroxylase
subunit
PputGB1_33
10
Pseudomonas
putida GB-1 NC_01032291.74 95.77 98.48
phcM 267 60.67 phenol/benzene hydroxylase
subunit
PputGB1_33
09
Pseudomonas
putida GB-1 NC_01032294.38 95.50 98.87
phcN 1512 62.76 phenol/benzene hydroxylase
subunit
PputGB1_33
08
Pseudomonas
putida GB-1 NC_01032293.84 97.22 98.61
phcO 357 66.95 phenol/benzene hydroxylase
subunit
PputGB1_33
07
Pseudomonas
putida GB-1 NC_01032289.07 90.75 93.27
phcP 1059 66.48 phenol/benzene hydroxylase
subunit
PputGB1_33
06
Pseudomonas
putida GB-1 NC_01032290.17 95.46 97.73
phcQ 897 62.21 meta-pathway phenol
degradation-like protein
PputGB1_33
05
Pseudomonas
putida GB-1 NC_01032291.97 96.65 98.66
benR 954 61.01 transcriptional regulator PPS_2766Pseudomonas
putida S16 NC_01573397.06 100 100
benA 1356 62.91 benzoate 1,2-dioxygenase
subunit alpha PPS_2765Pseudomonas
putida S16 NC_01573398.89 99.33 99.55
benB 483 59.83 benzoate 1,2-dioxygenase
subunit beta benB P. putida GJ31,
plasmid pKW1AY83145899.58 100 100
benC 1008 65.77 benzoate 1,2-dioxygenase
oxidoreductase subunit PPS_2763Pseudomonas
putida S16 NC_01573397.51 99.40 100
benD 759 64.82 1,6-dihydroxycyclohexa-2,4-diene
-1-carboxylate dehydrogenase PPS_2762 Pseudomonas
putida S16 NC_01573398.28 99.60 100
benK 1326 64.86 benzoate transporter PPS_2761Pseudomonas
putida S16 NC_01573398.49 99.54 99.54
benG 912 65.68 catechol 1,2-dioxygenase PPS_2760Pseudomonas
putida S16 NC_01573398.35 100 100
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578
572
Continued
benE 1197 69.01 benzoate transporter PPS_2759Pseudomonas
putida S16 NC_01573398.74 99.74 99.74
benF 1248 62.82 outer membrane porin PPS_2758Pseudomonas
putida S16 NC_01573398.63 99.27 99.51
catB 1110 64.86 muconate cycloisomerase PPS_3181Pseudomonas
putida S16 NC_01573399.18 99.45 99.72
catC 288 64.58 muconolactone delta-isomerase PPS_3180Pseudomonas
putida S16 NC_01573398.95 100 100
catA 933 66.35 catechol 1,2-dioxygenase PPS_3179Pseudomonas
putida S16 NC_01573398.71 100 100
pcaK 1380 63.41 4-hydroxybenzoate transporter PPS_4279Pseudomonas
putida S16 NC_01573398.91 99.78 100
pcaI 828 64.25 beta-ketoadipate:succinyl-CoA
transferase subunit alpha PPS_4278 Pseudomonas
putida S16 NC_01573398.79 100 100
pcaJ 777 65.77 beta-ketoadipate:succinyl-CoA
transferase subunit beta PPS_4277Pseudomonas
putida S16 NC_01573398.97 99.61 100
pcaF 1200 65.75 beta-ketoadipyl-CoA thiolase PPS_4276Pseudomonas
putida S16 NC_01573399.16 100 100
pcaT 1287 61.46 major facilitator superfamily
metabolite/H(+) symporter PPS_4275Pseudomonas
putida S16 NC_01573398.91 99.76 99.76
pcaB 1350 69.11 3-carboxy-cis,cis-muconate
cycloisomerase PPS_4274Pseudomonas
putida S16 NC_01573398.59 99.55 99.77
pcaD 789 66.41 beta-ketoadipate enol-lactone
hydrolase PPS_4273Pseudomonas
putida S16 NC_01573398.60 98.85 99.23
pcaC 390 62.82 4-carboxymuconolactone
decarboxylase PPS_4272 Pseudomonas
putida S16 NC_01573399.23 100 100
ttgR 630 60.48 transcriptional regulator PPS_4266Pseudomonas
putida S16 NC_01573399.04 99.52 100
ttgA 1152 64.32 RND family efflux transporter,
MFP subunit PPS_4267 Pseudomonas
putida S16 NC_01573399.47 100 100
ttgB 3150 62.57 hydrophobe/amphiphile efflux-1
family protein PPS_4268Pseudomonas
putida S16 NC_01573399.39 100 100
ttgC 1455 65.15 RND efflux system outer
membrane lipoprotein PPS_4269 Pseudomonas
putida S16 NC_01573399.10 100 100
ttg2A 807 63.82 toluene tolerance protein
similar to ABC transporter ttg2A Pseudomonas
putida GM73AF10600299.50 100 100
ttg2B 795 62.52 toluene tolerance
transmembrane protein ttg2B Pseudomonas
putida GM73AF10600299.87 100 100
ttg2C 483 60.25 toluene tolerance protein ttg2C Pseudomonas
putida GM73AF106002100 100 100
ttg2D 645 60.47 toluene tolerance protein ttg2D Pseudomonas
putida GM73AF10600299.53 100 100
ttg2E 300 68.00 toluene tolerance protein ttg2E Pseudomonas
putida GM73AF10600297.33 100 100
ttg2F 237 55.70 toluene tolerance protein ttg2F Pseudomonas
putida GM73AF106002100 100 100
ttg2G 1263 63.18 UDP-N-acetylglucosamine
1-carboxyvinyltransferase transferasePPS_0992Pseudomonas
putida S16 NC_01573398.81 99.52 99.76
ttg8 603 62.19 toluene tolerance protein PPS_4781Pseudomonas
putida S16 NC_01573397.18 99.50 100
todX 1278 57.90 aromatic hydrocarbon
degradation membrane protein PPS_1340 Pseudomonas
putida S16 NC_01573399.29 99.76 99.76
Copyright © 2013 SciRes. OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578 573
Figure 6. Spectral analysis of degradation of aromatic compounds by POXN01 resting cells.
Benzene (a), (b), phenol (c), (d) or toluene (e), (f) were resuspended in 0.05 M potassium
phosphate (pH 7.0) and incubated either with (a), (c), (e) or without (b), (d), (f) POXN01 cells
as described in Materials in Methods. At indicated times, samples were withdrawn and centri-
fuged to remove cells and to separate aqueous and organic phases. UV spectra of clarified
aqueous phases were measured against 0.05 M potassium phosphate (pH 7.0).
Figure 7. Putative pathway for the degradation of aromatic compounds by the POXN01 isolate. Gene prod-
ucts involved are as follows: (1) phenol/benzene hydroxylase (phcKLMNOP), (2) catechol 1,2-dioxygenase
(phcA, benG, catA ), (3) benzoate 1,2-dioxigenase (benABC), (4) 1,6-dihydroxycyclohexa-2,4-diene-1-car-
boxylate dehydrogenase (benD), (5) muconate cycloisomerase (catB), (6) muconolactone delta-isomerase
(catC), (7) beta-ketoadipate enol-lactone hydrolase (pcaD), (8) beta-ketoadipate:succinyl-CoA transferase
(pcaIJ), (9) beta-ketoadipyl-CoA thiolase (pcaF).
Copyright © 2013 SciRes. OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578
Copyright © 2013 SciRes.
574
Commission (TWC 2811wpb001 Title: Building a 21st Century Bio-
technology Workforce). The authors would like to thank Roland Tsai,
biotechnology undergraduate major, Kevin Smith, biotechnology lab
manager, and Ashish Damania, bioinformatics undergraduate major,
for assistance with sample collection, preparation and data analysis
respectively.
OPEN ACCESS
REFERENCES
[1] Grillo, G., Karalliedde, L. and Senanayake, N. (1989)
Organophosphorus insecticide poisoning. British Journal
of Anaesthesia, 63, 736-750.
http://dx.doi.org/10.1093/bja/63.6.736
[2] van der Hoek, W. and Konradsen, F. (2006) Analysis of
8000 hospital admissions for acute poisoning in a rural
area of Sri Lanka. Clinical Toxicology (Philadelphia), 44,
225-231. http://dx.doi.org/10.1080/15563650600584246
[3] van der Hoek, W., Konradsen, F., Athukorala, K. and
Wanigadewa, T. (1998) Pesticide poisoning: A major
health problem in Sri Lanka. Social Science & Medicine,
46, 495-504.
http://dx.doi.org/10.1016/S0277-9536(97)00193-7
[4] Eddleston, M., Eyer, P., Worek, F., Mohamed, F., Sena-
rathna, L., von Meyer, L., Juszczak, E., Hittarage, A., Az-
har, S., Dissanayake, W., Sheriff, M.H., Szinicz, L., Daw-
son, A.H. and Buckley, N.A. (2005) Differences between
organophosphorus insecticides in human self-poisoning:
A prospective cohort study. Lancet, 366, 1452-1459.
http://dx.doi.org/10.1016/S0140-6736(05)67598-8
[5] Jeyaratnam, J., Lun, K.C. and Phoon, W.O. (1987) Sur-
vey of acute pesticide poisoning among agricultural wor-
kers in four Asian countries. Bulletin of the World Health
Organization, 65, 521-527.
http://dx.doi.org/10.1002/ajim.20623
[6] Calvert, G.M., Karnik, J., Mehler, L., Beckman, J., Mor-
rissey, B., Sievert, J., Barrett, R., Lackovic, M., Mabee,
L., Schwartz, A., Mitchell, Y. and Moraga-McHaley, S.
(2008) Acute pesticide poisoning among agricultural
workers in the United States, 1998-2005. American Jour-
nal of Industrial Medicine, 51, 883-898.
[7] US Congress, Office of Technology Assessment (1992)
Disposal of chemical weapons: Alternative technologies-
Background Paper. US Government Printing Office.
http://www.fas.org/ota/reports/9210.pdf.
[8] Eddleston, M., Karalliedde, L., Buckley, N., Fernando, R.,
Hutchinson, G., Isbister, G., Konradsen, F., Murray, D.,
Piola, J.C., Senanayake, N., Sheriff, R., Singh, S., Siwach,
S.B. and Smit, L. (2002) Pesticide poisoning in the de-
veloping world: A minimum pesticides list. Lancet, 360,
1163-1167.
http://dx.doi.org/10.1016/S0140-6736(02)11204-9
[9] Buckley, N.A., Karalliedde, L., Dawson, A., Senanayake,
N. and Eddleston, M. (2004) Where is the evidence for
treatments used in pesticide poisoning? Is clinical toxi-
cology fiddling while the developing world burns? Jour-
nal of Toxicology-Clinical Toxicology, 42, 113-116.
http://dx.doi.org/10.1081/CLT-120028756
[10] Jeyaratnam, J. (1990) Acute pesticide poisoning: A major
global health problem. World Health Statistics Quarterly,
43, 139-144.
[11] World Health Organization (1990) The public health im-
pact of pesticides use in agriculture. WHO, Geneva, 128.
http://whqlibdoc.who.int/publications/1990/9241561394.
pdf. Accessed 1 July 2012
[12] Kesavachandran, C.N., Fareed, M., Pathak, M.K., Bihari,
V., Mathur, N. and Srivastava, A.K. (2009) Adverse health
effects of pesticides in agrarian populations of developing
countries. In: Whitacre, D.M., Ed., Reviews of Environ-
mental Contamination and Toxicology, 200, Springer Sci-
ence + Business Media, New York, 33-52.
[13] Coupe, R.H., Manning, M.A., Foreman, W.T., Goolsby,
D.A. and Majewski, M.S. (2000) Occurrence of pesti-
cides in rain and air in urban and agricultural areas of
Mississippi, April-September 1995. Science of the Total
Environment, 248, 227-240.
http://dx.doi.org/10.1016/S0048-9697(99)00545-8
[14] Schipper, P.N., Vissers, M.J. and van der Linden, A.M.
(2008) Pesticides in groundwater and drinking water
wells: Overview of the situation in the Netherlands. Wa-
ter Science and Technology, 57, 1277-1286.
http://dx.doi.org/10.2166/wst.2008.255
[15] Sethunathan, N. and Yoshida, T. (1973) A Flavobacte-
rium sp. that degrades diazinon and parathion. Canadian
Journal of Microbiology, 19, 873-875.
http://dx.doi.org/10.1139/m73-138
[16] Kawahara, K., Tanaka, A., Yoon, J. and Yokota, A. (2010)
Reclassification of a parathione-degrading Flavobacte-
rium sp. ATCC 27551 as Sphingobium fuliginis. Journal
of General and Applied Microbiology, 56, 249-255.
http://dx.doi.org/10.2323/jgam.56.249
[17] Serdar, C.M., Gibson, D.T., Munnecke, D.M. and Lan-
caster, J.H. (1982) Plasmid involvement in parathion hy-
drolysis by Pseudomonas diminuta. Applied and Envi-
ronmental Microbiology, 44, 246-249.
[18] Segers, P., Vancanneyt, M., Pot, B., Torck, U., Hoste, B.,
Dewettinck, D., Falsen, E., Kersters, K. and De Vos, P.
(1994) Classification of Pseudomonas diminuta Leifson
and Hugh 1954 and Pseudomonas vesicularis Busing,
Doll, and Freytag 1953 in Brevundimonas gen. nov. as
Brevundimonas diminuta comb. nov. and Brevundimonas
vesicularis comb. nov., respectively. International Jour-
nal of Systematic Bacteriology, 44, 499-510.
http://dx.doi.org/10.1099/00207713-44-3-499
[19] Caldwell, S.R., Newcomb, J.R., Schlecht, K.A. and Rau-
shel, F.M. (1991) Limits of diffusion in the hydrolysis of
substrates by the phosphotriesterase from Pseudomonas
diminuta. Biochemistry , 30, 7438-7444.
http://dx.doi.org/10.1021/bi00244a010
[20] Dumas, D.P., Caldwell, S.R., Wild, J.R. and Raushel,
F.M. (1989) Purification and properties of the phosphot-
riesterase from Pseudomonas diminuta. Journal of Bio-
logical Chemistry, 264, 19659-19665.
[21] Dumas, D.P., Wild, J.R. and Raushel, F.M. (1989) Diiso-
propylfluorophosphate hydrolysis by a phosphotriesterase
from Pseudomonas diminuta. Biotechnology and Applied
Biochemistry, 11, 235-243.
[22] Siddavattam, D., Khajamohiddin, S., Manavathi, B., Pa-
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578 575
kala, S. and Merrick, M. (2003) Transposon-like organi-
zation of the plasmid-borne organophosphate degradation
(opd) gene cluster found in Flavobacterium sp. Applied
and Environmental Microbiology, 69, 2533-2539.
http://dx.doi.org/10.1128/AEM.69.5.2533-2539.2003
[23] Somara, S., Manavathi, B., Tebbe, C. and Siddavattam, D.
(2002) Localisation of identical organophosphorus pesti-
cide degrading (opd) genes on genetically dissimilar in-
digenous plasmids of soil bacteria: PCR amplification,
cloning and sequencing of the opd gene from Flavobac-
terium balustinum. Indian Journal of Experimental Biol-
ogy, 40, 774-779.
[24] Horne, I., Qiu, X., Russell, R.J. and Oakeshott, J.G. (2003)
The phosphotriesterase gene opdA in Agrobacterium ra-
diobacter P230 is transposable. FEMS Microbiology Let-
ters, 222, 1-8.
http://dx.doi.org/10.1016/S0378-1097(03)00211-8
[25] Horne, I., Sutherland, T.D., Harcourt, R.L., Russell, R.J.
and Oakeshott, J.G. (2002) Identification of an opd (or-
ganophosphate degradation) gene in an Agrobacterium
isolate. Applied and Environmental Microbiology, 68,
3371-3376.
http://dx.doi.org/10.1128/AEM.68.7.3371-3376.2002
[26] Chaudhry, G.R., Ali, A.N. and Wheeler, W.B. (1988)
Isolation of a methyl parathion-degrading Pseudomonas
sp. that possesses DNA homologous to the opd gene from
a Flavobacterium sp. Applied and Environmental Micro-
biology, 54, 288-293.
[27] Harper, L.L., McDaniel, C.S., Miller, C.E. and Wild, J.R.
(1988) Dissimilar plasmids isolated from Pseudomonas
diminuta MG and a Flavobacterium sp. (ATCC 27551)
contain identical opd genes. Applied and Environmental
Microbiology, 54, 2586-2589.
[28] Pandeeti, E.V., Chakka, D., Pandey, J.P. and Siddavattam,
D. (2011) Indigenous organophosphate-degrading (opd)
plasmid pCMS1 of Brevundimonas diminuta is self-
transmissible and plays a key role in horizontal mobility
of the opd gene. Plasmid, 65, 226-231.
http://dx.doi.org/10.1016/j.plasmid.2011.02.003
[29] Wilson, K. (1990) Preparation of genomic DNA from
bacteria. In: Ausubel, F.M., Brent, R., Kingston, R.E.,
Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K.
Eds., Current Protocols in Molecular Biology, John Wi-
ley & Sons, Inc., New York.
[30] Frank, J.A., Reich, C.I., Sharma, S., Weisbaum, J.S., Wil-
son, B.A. and Olsen, G.J. (2008) Critical evaluation of
two primers commonly used for amplification of bacterial
16S rRNA genes. Applied and Environmental Microbi-
ology, 74, 2461-2470.
http://dx.doi.org/10.1128/AEM.02272-07
[31] Baker, G.C., Smith, J.J. and Cowan, D.A. (2003) Review
and re-analysis of domain-specific 16S primers. Journal
of Microbiological Methods, 55, 541-555.
http://dx.doi.org/10.1016/j.mimet.2003.08.009
[32] Sprenger, W.W., Dijkstra, A., Zwart, G.J., Agterveld,
M.P., Noort, P.C. and Parsons, J.R. (2003) Competition
of a parathion-hydrolyzing Flavobacterium with bacteria
from ditch water in carbon-, nitrate- and phosphate-lim-
ited continuous cultures. FEMS Microbiology Ecology,
43, 45-53.
http://dx.doi.org/10.1111/j.1574-6941.2003.tb01044.x
[33] Borodina, T.A., Lehrach, H. and Soldatov, A.V. (2003)
DNA purification on homemade silica spin-columns.
Analytical Biochemistry, 321, 135-137.
http://dx.doi.org/10.1016/S0003-2697(03)00403-2
[34] Hannon, G.J. (2010) FASTX-Toolkit.
http://hannonlab.cshl.edu/fastx_toolkit.
[35] Zerbino, D.R. and Birney, E. (2008) Velvet: Algorithms
for de novo short read assembly using de Bruijn graphs.
Genome Research, 18, 821-829.
http://dx.doi.org/10.1101/gr.074492.107
[36] Hernandez, D., François, P., Farinelli, L., Osteras, M. and
Schrenzel, J. (2008) De nov o bacterial genome sequencing:
Millions of very short reads assembled on a desktop com-
puter. Genome Research, 18, 802-809.
http://dx.doi.org/10.1101/gr.072033.107
[37] Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and
Lipman, D.J. (1990) Basic local alignment search tool.
Journal of Molecular Biology, 215, 403-410.
[38] Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papado-
poulos, J., Bealer, K. and Madden, T.L. (2009) BLAST+:
Architecture and applications. BMC Bioinformatics, 10,
421. http://dx.doi.org/10.1186/1471-2105-10-421
[39] Smith, D.R., Quinlan, A.R., Peckham, H.E., Makowsky,
K., Tao, W., Woolf, B., Shen, L., Donahue, W.F., Tusneem,
N., Stromberg, M.P., Stewart, D.A., Zhang, L., Ranade,
S.S., Warner, J.B., Lee, C.C., Coleman, B.E., Zhang, Z.,
McLaughlin, S.F., Malek, J.A., Sorenson, J.M., Blanchard,
A.P., Chapman, J., Hillman, D., Chen, F., Rokhsar, D.S.,
McKernan, K.J., Jeffries, T.W., Marth, G.T. and Richard-
son, P.M. (2008) Rapid whole-genome mutational profiling
using next-generation sequencing technologies. Genome
Research, 18, 1638-1642.
http://dx.doi.org/10.1101/gr.077776.108
[40] Li, H. and Durbin, R. (2009) Fast and accurate short read
alignment with Burrows-Wheeler Transform. Bioinformatics,
25, 1754-1760.
http://dx.doi.org/10.1093/bioinformatics/btp324
[41] Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R.,
McGettigan, P.A., McWilliam, H., Valentin, F., Wallace,
I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J.
and Higgins, D.G. (2007) Clustal W and Clustal X ver-
sion 2. Bioinformatics, 23, 2947-2948.
http://dx.doi.org/10.1093/bioinformatics/btm404
[42] Felsenstein, J. (1989) PHYLIP-Phylogeny inference package.
Cladistics, 5, 164-166.
[43] Felsenstein, J. and Churchill, G.A. (1996) A Hidden
Markov Model approach to variation among sites in rate
of evolution. Molecular Biology and Evolution, 13, 93-104.
http://dx.doi.org/10.1093/oxfordjournals.molbev.a025575
[44] Stöver, B.C. and Müller, K.F. (2010) TreeGraph 2: Com-
bining and visualizing evidence from different phyloge-
netic analyses. BMC Bioinformatics, 11, 7.
http://dx.doi.org/10.1186/1471-2105-11-7
[45] Iyer, R., Iken, B. and Tamez, T. (2012) Isolation, mo-
lecular and biochemical identification of Paraoxon-meta-
bolizing Pseudomonas species. Journal of Bioremediation
Copyright © 2013 SciRes. OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578
576
and Biodegradation, 2, 2011, 5.
http://www.omicsonline.org/2155-6199/2155-6199-2-132
.pdf.
[46] Anzai, Y., Kim, H., Park, J.Y., Wakabayashi, H. and Oyaizu,
H. (2000) Phylogenetic affiliation of the pseudomonads
based on 16S rRNA sequence. International Journal of Sys-
tematic and Evolutionary Microbiology, 50, 1563-1568.
http://dx.doi.org/10.1099/00207713-50-4-1563
[47] Moore, E.R.B., Mau, M., Arnscheidt, A., Bottger, E.C.,
Hutson, R.A., Collins, M.D., VandePeer, Y., DeWachter,
Y. and Timmis, K.N. (1996) The determination and
comparison of the 16S rRNA gene sequences of species
of the genus Pseudomonas (sensu stricto) and estimation
of the natural intrageneric relationships. Systematic and
Applied Microbiology, 19, 478-492.
http://dx.doi.org/10.1016/S0723-2020(96)80021-X
[48] Mulet, M., Lalucat, J. and García-Valdés, E. (2010) DNA
sequence-based analysis of the Pseudomonas species. En-
vironmental Microbiology, 12, 1513-1530.
[49] Ait Tayeb, L., Ageron, E., Grimont, F. and Grimont, P.A.D.
(2005) Molecular phylogeny of the genus Pseudomonas
based on rpoB sequences and application for the identifi-
cation of isolates. Research in Microbiology, 156, 763-
773. http://dx.doi.org/10.1016/j.resmic.2005.02.009
[50] Hilario, E., Buckley, T.R. and Young, J.M. (2004) Im-
proved resolution on the phylogenetic relationships among
Pseudomonas by the combined analysis of atpD, carA,
recA and 16S rDNA. Antonie van Leeuwenhoek, 86, 51-
64.
http://dx.doi.org/10.1023/B:ANTO.0000024910.57117.16
[51] Peix, A., Ramírez-Bahena, M.H. and Velázquez, E. (2009)
Historical evolution and current status of the taxonomy of
genus Pseudomonas. Infection, Genetics and Evolution, 9,
1132-1147.
http://dx.doi.org/10.1016/j.meegid.2009.08.001
[52] Yamamoto, S. and Harayama, S. (1998) Phylogenetic rela-
tionships of Pseudomonas puti da strains deduced from the
nucleotide sequences of gyrB, rpoD and 16S rRNA genes.
International Journal of Systematic and Evolutionary Mi-
crobiology, 48, 813-819.
http://dx.doi.org/10.1099/00207713-48-3-813
[53] Yamamoto, S., Kasai, H., Arnold, D.L., Jackson, R.W.,
Vivian, A. and Harayama, S. (2000) Phylogeny of the
genus Pseudomonas: Intrageneric structure reconstructed
from the nucleotide sequences of gyrB and rpoD genes.
Microbiology, 146, 2385-2394.
[54] Wang, S., Liu, Z., Tang, H., Meng, J. and Xu, P. (2007)
Characterization of environmentally friendly nicotine de-
gradation by Pseudomonas putida biotype A strain S16.
Microbiology, 153, 1556-1565.
http://dx.doi.org/10.1099/mic.0.2006/005223-0
[55] Tang, H., Yao, Y., Wang, L., Yu, H., Ren, Y., Wu, G.
and Xu, P. (2012) Genomic analysis of Pseudomonas
putida: Genes in a genome island are crucial for nicotine
degradation. Scientific Reports, 2, 377.
http://dx.doi.org/10.1038/srep00377
[56] Fujita, M., Ike, M. and Kamiya, T. (1993) Accelerated
phenol removal by amplifying the gene expression with a
recombinant plasmid encoding catechol-2,3-oxygenase.
Water Research, 27, 9-13.
http://dx.doi.org/10.1016/0043-1354(93)90189-O
[57] Takeo, M., Maeda, Y., Okada, H., Miyama, K., Mori, K.,
Ike, M. and Fujita, M. (1995) Molecular cloning and se-
quencing of the phenol hydroxylase gene from Pseudo-
monas putida BH. Journal of Fermentation and Bioengi-
neering, 79, 485-488.
http://dx.doi.org/10.1016/0922-338X(95)91266-8
[58] Shimao, M., Nakamura, T., Okuda, A. and Harayama, S.
(1996) Characteristics of transposon insertion mutants of
mandelic acid-utilizing Pseudomonas putida strain A10L.
Bioscience, Biotechnology and Biochemistry, 60 , 1051-
1055. http://dx.doi.org/10.1271/bbb.60.1051
[59] Mulbry, W.W. and Karns, J.S. (1989) Parathion hydro-
lase specified by the Flavobacterium opd gene: Relation-
ship between the gene and protein. Journ al of Bacteriology,
171, 6740-6746.
[60] Rani, N.L. and Lalithakumari, D. (1994) Degradation of
methyl parathion by Pseudomonas putida . Canadi an Jour-
na l o f Mic robiology, 40, 1000-1006.
http://dx.doi.org/10.1139/m94-160
[61] Santos, P.M. and Sa-Correia, I. (2007) Characterization
of the unique organization and co-regulation of a gene clu-
ster required for phenol and benzene catabolism in Pseu-
domonas sp. M1. Journal of Biotechnology, 131, 371-378.
http://dx.doi.org/10.1016/j.jbiotec.2007.07.941
[62] Cowles, C.E., Nichols, N.N. and Harwood, C.S. (2000)
BenR, a XylS homologue, regulates three different path-
ways of aromatic acid degradation in Pseudomon as putida.
Journal of Bacteriology, 182, 6339-6346.
http://dx.doi.org/10.1128/JB.182.22.6339-6346.2000
[63] Cafaro, V., Notomista, E., Capasso, P. and Di Donato, A.
(2005) Regiospecificity of two multicomponent mono-
oxygenases from Pseudomonas stutzeri OX1: Molecular
basis for catabolic adaptation of this microorganism to
methylated aromatic compounds. Applied and Environ-
mental Microbiology, 71, 4736-4743.
http://dx.doi.org/10.1128/AEM.71.8.4736-4743.2005
[64] Ramos, J.L., Duque, E., Godoy, P. and Segura, A. (1998)
Efflux pumps involved in toluene tolerance in Pseudo-
monas putida DOT-T1E. Journal of Bacteriology, 180,
3323-3329.
[65] Ramos, J.L., Duque, E., Gallegos, M.T., Godoy, P., Ramos-
Gonzalez, M.I., Rojas, A., Teran, W. and Segura, A. (2002)
Mechanisms of solvent tolerance in gram-negative bacte-
ria. Annual Review of Microbiology, 56, 743-768.
http://dx.doi.org/10.1146/annurev.micro.56.012302.16103
8
[66] Kim, K., Lee, S., Lee, K. and Lim, D. (1998) Isolation
and characterization of toluene-sensitive mutants from the
toluene-resistant bacterium Pseudomonas putida GM73.
Journal of Bacteriology, 180, 3692-3696.
[67] Hearn, E.M., Patel, D.R. and van den Berg, B. (2008)
Outer-membrane transport of aromatic hydrocarbons as a
first step in biodegradation. Proceedings of the National
Academy of Sciences of the United States of America, 105,
8601-8606. http://dx.doi.org/10.1073/pnas.0801264105
Copyright © 2013 SciRes. OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578
Copyright © 2013 SciRes.
577
Abbreviations TLC: Thin Layer Chromatography;
UV: Ultraviolet),
OP: Organophosphorus; PCR: Polymerase Chain Reaction.
CSM: Carbon-Deficient media;
Figure S1. Neighbor-joining tree derived from concatenated alignments of 16S rRNA - gyrB - rpoD genes of the POXN01 isolate
and type species of the genus Pseudomonas. Bootstrap values expressed as percentages of the total number of replicates are shown
next to each node (values below 50% are not shown). Scale bar represents 10% sequence difference.
OPEN ACCESS
R. Iyer et al. / Advances in Biological Chemistry 3 (2013) 564-578
578
(a) (b)
Figure S2. TLC analysis of products formed in the course of phenol degradation by POXN01 resting cells. Phenol degrada- tion
experiment was performed as described in Materials and Methods. Samples were collected at indicated times, cleared by centrifuga-
tion and kept frozen at (−80) ˚C prior analysis. As- cending TLC was carried out on Whatman KC18F plates using methanol: water
2:1 (v/v) as an eluent. Spots were visualized either under UVC light (200 - 280 nm) (a) or UVA light (340 - 400 nm) (b).
Copyright © 2013 SciRes. OPEN ACCESS