Open Journal of Stomatology, 2013, 3, 6-13 OJST
http://dx.doi.org/10.4236/ojst.2013.39A002 Published Online December 2013 (http://www.scirp.org/journal/ojst/)
Genetic expression of Col-2A and Col-10A as a function of
administration of IGF-1 & TGF-β with and without
anterior mandibular repositioning appliance on the growth
of mandibular condylar cartilage in young rabbit
A. S. Patil1, R. B. Sable1, R. M. Kothari2, P. Nagarajan2
1Deartment of Orthodontics and Dentofacial Orthopedics, Bharati Vidyapeeth Dental College and Hospital, Bharati Vidyapeeth
Deemed University, Pune, India
2Rajiv Gandhi Institute of Biotechnology, Bharati Vidyapeeth Deemed University, Pune, India
Received 25 September 2013; revised 31 October 2013; accepted 12 November 2013
Copyright © 2013 A. S. Patil et al. This is an open access article distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT
New Zealand (NZ) young rabbits with the admini-
stration of insulin-like growth factor (IGF-1) and
transforming growth factor-β (TGF-β) with and with-
out mandibular anterior repositioning appliances are
explored for the growth of the mandibular condylar
cartilage (MCC). 32 growing NZ and rabbits were di-
vided into 4 groups: the group with saline injection in
TMJ, the group which received growth factor injec-
tion in TMJ, the group which received anterior posi-
tioning appliance and the group which received g ro wt h
factors injection as well as mandibular repositioning
appliance. Gene expression was studied by real-time
RT-PCR and cartilage growth by histomorphometry.
Administration of growth factors along with mandibu -
lar repositioning appliances has induced 1) 1.70-fold
expression of Col-2A gene (p value < 0.0005) and 2)
1.47-fold expression of Col-10A gene (p value <
0.0005). In contrast, administration of only mandibu-
lar repositioning appliances induced 1) 1.28-fold ex-
pression of Col-2A gene (p value < 0.0005) and 2)
merely 0.62-fold expression of Col-10A gene (p value
< 0.0005), while administration of growth factors only
induced 1) mere 0.56-fold expression of Col-2A gene
(p value <0.0005) and 2) 0.86-fold expression of Col-
10A gene (p value < 0.0005). Administration of grow th
factors along with mandibular repositioning appli-
ances causes an increase in genetic expressions which
have been corroborated by histomorphometry and
validated by statistical analysis, during an accelerated
growth of mandibular condylar cartilage. Admini-
stration of growth factor s in the TMJ could provide a
synergistic role along with mandibular repositioning
appliances for treatment of mandibular retrogna-
thism as well as disorders on the MCC.
Keywords: Transforming Growth Factor-β (TGF-β);
Insulin-Like Growth Factor (IGF-1); Condylar Cartilage
Growth; Mandibular Repositioning Appliances; Col-2A;
Col-10A
1. INTRODUCTION
This MCC plays a significant role in the development of
oro-facial complex and has therefore received greater
attention in orthodontics [1]. During its development,
besides growth factors, condylar growth modification is
induced by mandibular advancement as reported by Pet-
rovic and Stutzmann [2]. Most of the studies in this re-
gard have used either histological, histomorphometric,
immuno-histomorphometric, biochemical or auto-radio-
graphic methods as a diagnostic tool to evaluate the
growth at the condyle [3-6] or detect increased expres-
sion of some growth factors/bio-markers of MCC growth
[7-9]. Although, these studies have provided some valu-
able leads at a cellular level, several questions have re-
mained unanswered. These could be answered only on a
genetic level, elucidated by cellular studies for site speci-
ficity, quantified by molecular markers through bio-
chemical analysis and their significance. The expression
of Col-2A gene and its derivative protein (collagen II) is
almost 80% component of the ECM in mice and rats
whereas Type X collagen is localised in the hypertrophic
and erosive zones of the condylar cartilage, where os-
teogenic transition takes place to facilitate endochondral
OPEN ACCESS
A. S. Patil et al. / Open Journal of Stomatology 3 (2013) 6-13 7
ossification. Thus Col-2A and Col-10A play an impor-
tant role in chondrogenesis of the mandibular condylar
cartilage. TGF-β and IGF-1 also have shown to have a
synergistic effect on chondrogenesis and cartilage heal-
ing. Thus, the present study has precisely attempted such
an integrated strategy for evaluation of condylar growth
in young rabbits as a function of administration of
growth factors (TGF-β and IGF-1) with and without
mandibular anterior repositioning appliances.
2. MATERIALS AND METHODS
2.1. Experimental Subjects
In this study, 60-day-old (pubertal age group) 32 male/
female NZ white rabbits were procured (Raj Biotech-
nology Laboratories, Pune), their use was approved by
the Animal Ethical Committee of the Medical College of
Bharati Vidyapeeth Deemed University (CPCSEA-01-
2009) and experiments performed according to the
guidelines laid down by the Committee for the Purpose
of Control and Supervision of Experiments on Animals
(CPCSEA) at the animal house of Bharati Vidyapeeth
Medical College, Pune.
2.2. Experimental Conditions
The rabbits were maintained 1) in the animal house with
fluoroscent light (12 hours day/12 hours night), relative
humidity 95% and 25˚C ± 1˚C, 2) provided with normal
feed pellets (Amrut Seeds, Sangli), fresh green leafy
vegetables and mineral water ad libitum and 3) their
body weight and net weight of dry feed (pellets)/wet
feed (cabbage/cauliflower/carrots) consumed determined
daily.
2.3. Experimental Design
The rabbits were randomly divided into following four
groups of 8 each (4 males and 4 females).
Group I—Saline injection in TMJ;
Group II—Growth factor injection in TMJ;
Group III—Mandibular advancement appliance with
saline injection in TMJ;
Group IV—Mandibular advancement appliance with
growth factor injection in TMJ.
2.4. Appliance Fabrication
Custom trays were prepared for taking impression of the
upper incisors of rabbits using alginate, considering the
anatomy oftheir upper arch studied on a rabbit head pro-
cured from a local abattoir (pre-experimental study) and
appliances accordingly fabricated using heat-cure acrylic
material [9] (IvoclarVivadent-SR TriplexHot) as shown
in Figure 1.
Figure 1. Mandibular repositioning ap-
pliance cemented on upper anteriors.
2.5. Appliance Cementation
Initially, appliances were tried on to the rabbits to exam-
ine irritation (if any), subsequently fitted at the proposed
position by application of the adhesive material into the
incisor slot and their cementation was done using Para-
post dual-cure cement and light-cure unit to cure the ce-
ment. These were closely observed daily at 0600, 0930,
1230, 1400, 1630, 2130 and 2400 hours for retention of
the appliance, its wear or damage, tissue irritation, so-
matic growth status (if any) and their tolerance, as
judged from the quantum of food intake and body
weight.
2.6. Injection of Growth Factors
Insulin-like Growth Factor-I (IGF-1, lyophilized powder
from mouse recombinant expressed in Escherichia coli;
Sigma) 25 ng/25 μl and Transforming Growth Factor-β-1
(TGF-β, lyophilized powder from human platelets, 1 ×
106 units/mg; Sigma) 20 ng/25 μl were injected in the
inferior joint space, by prior sedation of the rabbits with
a combination of Xylaxine (5 mg/kg body wt.) and Keta-
mine (35 mg/kg body wt.). The needle was directed at
45˚ in reference to the mid-sagittal plane in the fossa
behind the posterior orbital ridge, till it contacted the
condyle. If the needle was not in precise location as
judged by digital radiographs, desired correction in its
angle and depth was ensured prior to injection of both
the growth factors. The same procedure was repeated on
the contra-lateral side too. The control group was in-
jected with an equal volume of phosphate buffered saline
(PBS) instead of growth factors, following the same
procedure. The injections were administered on day 7,
day 14 and day 21. Throughout the experimental dura-
tion, the rabbits were maintained at 25˚C on feed pre-
scribed before and euthanatized on day 30, condyles re-
covered immediately, snap frozen in liquid nitrogen and
stored at 80˚C until isolation of RNA.
2.7. Real Time RT-PCR Technique
The condylar tissue isolated from the 4 groups were
Copyright © 2013 SciRes. OPEN ACCESS
A. S. Patil et al. / Open Journal of Stomatology 3 (2013) 6-13
8
treated with Ribopure kit (Ambion, USA), for rapid puri-
fication of total high quality RNA as per its protocol and
stored at 20˚C. Subsequently, RNA from each control
and experimental sample was converted into c-DNA,
using equal quantity of 2X RT master-mix in PCR tubes
and thermo-cycled according to the protocol by c-DNA
reverse transcription kit (Applied Biosystems, USA).
The reaction was set in 48 well plates in an Applied
Biosystems Step One Real Time PCR machine with the
TaqMan technique., with each well containing 10 μl
Master mix TaqMan2X, 1 μl primer (gene specific), 2 μl
c-DNA (sample specific), 7 μl sterile H2O, making total
20 μl reaction mixture, and Glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) as the endogenous control. The
primers used for the corresponding genes are shown in
Table 1.
2.8. Histomorphometry
Alician Blue—PAS staining and Hematoxylin and Eosin
staining was carried out for histologic sections and the
slides were observed under Leica DM 5000B microscope
under 10× magnification. The images were captured with
a Leica DFC 320 camera and were analyzed by Leica
Application Suite 3.70 Image analysis software.
2.9. Statistical Analysis
The data was statistically analyzed using Statistical Pa-
ckage for Social Sciences (SPSSver 11.5, Inc. Chicago,
USA). The p-values less than 0.05 are considered to be
statistically significant. All the hypotheses were formu-
lated using two tailed alternatives against each null hy-
pothesis (hypothesis of no difference). All results are
presented as mean ± standard deviation (SD) across the
study groups and statistical significance of difference for
histology tested using Mann-Whiteny U test, for testing
the significance of difference between the independent
groups with a relatively smaller sample size.
3. RESULTS
3.1. Collagen-II Gene
From Figure 2, Col-2A gene expression was 1) merely
0.56-fold (p value < 0.0005) as a function of the admini-
stration of IGF-1 and TGF-β, 2) 1.28-fold increased (p
value < 0.0005) as a function of mandibular anterior re-
positioning appliance, indicating that the application of
Table 1. Profile of primer sequence used for the corresponding
genes for TaqMan technique in real time RT-PCR.
Gene Primer sequence
Col-2A CCTGGGCCTCAGGGACCTGCAGGTG
Col-10A CGGGACTGCAAGGAGAGCCAGGGTT
Figure 2. Histogram representing relative quantitation (RQ) of
COL-2A and COL-10A gene.
appliances has induced positive effect, 3) 1.70-fold in-
creased (p value < 0.0005) as a function of mandibular
repositioning group in conjunction with an administra-
tion of both the growth factors, pointing that this com-
bined treatment has synergy and 4) in the order of AI >
AS > I. Histo-chemical evidence (Figure 3) confirmed
an enhanced PG biosynthesis as a molecular marker en-
meshed in collagen-II protein which validates the ex-
pression of Col-2A gene during the condylar growth in
the young rabbits.
3.2. Collagen X Gene
From Figure 2, it is obvious that Col 10A gene expres-
sion was 1) 0.82-fold (p value < 0.0005) as a function of
the administration of IGF-1 and TGF-β, 2) mere
0.62-fold (p value < 0.0005) as a function of the man-
dibular anterior repositioning appliance, indicating that
the application of appliances has indeed induced a nega-
tive effect, 3) 1.47-fold increased (p value < 0.0005) as a
function of the mandibular repositioning in conjunction
with an administration of both the growth factors, point-
ing that this combined treatment has good degree of syn-
ergy and 4) the order of amplification is AI > I > AS.
3.3. Histomorphometry
The histo-chemical profile derived by staining with
Alician Blue-PAS and Hematoxylin & Eosin (H & E)
(Figure 3) showed 1) an increase in the size of the pro-
liferative layer of the cartilage, 2) increase in the length
of the cartilage. The histomorphometric measurements
have been summarized in Table 2 and the statistical
comparisons of the field mesurments are summarized in
Table 3. The length of the condylar cartilage from the
fibrous layer to the hypertrophic layer was greater in the
group treated by appliances and growth factor as com-
pared to the other groups (Figure 3).This is supported by
an increase of the width in the cartilage in the descending
order AI > AS > I > S. Compared to the control, the in-
Copyright © 2013 SciRes. OPEN ACCESS
A. S. Patil et al. / Open Journal of Stomatology 3 (2013) 6-13
Copyright © 2013 SciRes.
9
(a) (b) (c) (d)
Figure 3. Increase in the proliferative layer as compared to the hypertrophic layer and a concomitant increase in thickness in
the cartilage in experimental groups. (a) Control group treated with injection of saline; (b) Experimental group treated with
growth factor injection; (c) Group treated with mandibular advancement appliance; (d) Group treated with growth factor injec-
tion and mandibular advancement appliance.
Table 2. Comparison of histologic field measurements of MCC
across the study groups.
Group I
Saline
controls
Group II
growth
factors
Group III
Mandibular
appliance
Group IIV
Mandibular
appliance +
growth factors
Fibrous +
proliferative zone 54.7 ± 19.1 154 ± 10.2 160.7 ± 15.7 270 ± 37.9
Hypertrophic +
maturational
zone
146.3 ± 49.3 98 ± 20 89.4 ± 27.4 89.5 ± 30.9
Length of
cartilage 214.9 ± 61.7 254 ± 24 262 ± 24.2 359.6 ± 58.4
OPEN ACCESS
Table 3. Statistical comparison of histo-morphometric meas-
urements of MCC (Students t test).
Group I v/s
Group II
Group I v/s
Group III
Group I v/s
Group IV
Fibrous +
proliferative zone 0.001 0.001 0.001
Hypertrophic +
maturational zone 0.001 0.001 0.001
Length of cartilage 0.001 0.001 0.001
crease was significant in the experimental groups cor-
roborating the RQ profile in Figure 1.
4. DISCUSSION
4.1. Rationale Underlying the Choice of Rabbit
as Experimental Aminal
The choice of NZ rabbits as a dependable research model
in the present study was made by virtue of their 1)
placement as higher mammals than rodents and closer to
human beings in the evolutionary scale for extrapolating
observations made to clinical applicability, 2) temporo-
mandibular joints (TMJ) being essentially identical to
those in human beings, 3) jaw apparatus being special-
ized for herbivorous diet as in human beings and 4) ad-
ministration of the growth factors in the TMJ/retro-discal
tissue appeared to be precise because of larger TMJ
compared to that of mice on which majority of the stud-
ies have been conducted so far (9).
4.2. Real Time RT-PCR
Since impaired growth of the condyles contributes to the
development of mandibular asymmetries and retrognatia
[10], role of mandibular condyles in the development of
oro-facial complex has received focused attention of or-
thodontics. Accordingly, earlier studies on growing mice
have thrown light on the post-natal cranio-facial skeletal
growth and development in its entirety by delineating
biochemical processes, certainly regulated by a complex
network of genes and interacting genetic/epigenetic fac-
tors [11-13], which induce secretion of enzymes, growth
factors, their receptors etc. representing integration of
various physiological sub-processes [14]. As cartilage
provides endochondral bone as an adaptive growth site
during the mandibular development [10,15-17], present
study has attempted to understand the expression of ge-
netic factors (SOX-9, Col-2A and Col-10A) in young NZ
rabbit model as a function of mandibular anterior reposi-
tioning appliances with and without the administration of
TGF-β and IGF-1 growth factors.
For this purpose, an accurate, sensitive and rapid mea-
surement of the expression of these genes regulating the
MCC growth using real time reverse transcription PCR
(RT-PCR).
A. S. Patil et al. / Open Journal of Stomatology 3 (2013) 6-13
10
4.3. Expression of Collagen Specific Gene
Gene expression for collagen II and collagen X which-
have contributed to ECM genesis in rat and mouse is
studied for young rabbits also.
4.3.1. Collage n II G en e
Since matrix formation is a prerequisite during the
growth and development of MCC, it was considered
worthwhile to study the expression of Col-2A gene, its
derivative protein (collagen II) being almost 80% com-
ponent of the ECM in mice and rats. Accordingly, ex-
pression of Col-2A gene is depicted in Figure 2.
4.3.2. C ollagen X Gene
After studying the profile of Col-2A gene, which is pri-
marily found throughout the ECM in mice and rats, it
was considered worthwhile to study the profile of Col-10A
genes, which has exhibited high reactivity in the hyper-
trophic chondrocytes in the mineralization zone. This
profile is depicted in Figure 2.
From Figure 2, it is obvious that Col-10A gene ex-
pression was 1) 0.82-fold (p value < 0.0005) as a func-
tion of the administration of IGF-1 and TGF-β, 2) mere
0.62-fold (p value < 0.0005) as a function of the man-
dibular anterior repositioning appliance, indicating that
the application of appliances has indeed induced a nega-
tive effect, 3)1.47-fold increased (p value < 0.0005) as a
function of the mandibular repositioning in conjunction
with an administration of both the growth factors, point-
ing that this combined treatment has good degree of syn-
ergy and 4) the order of amplification is AI > I > AS. In
contrast, Rabie et al. [18] noted 5.4 fold increase in type
X collagen and 3.19 fold increase in collagen-II as a re-
sult of forward mandibular positioning in young Sprague
Dawley rats. However, in the young rabbits biochemical
assay has confirmed an enhanced PG biosynthesis in
contrast to collagen II and X synthesis as a molecular
marker; coupled with the histo-chemical evidence, en-
hanced expression of PG validates the condylar growth.
4.4. Collagen II and Collagen X
4.4.1. Types of Collagen
Over 19 types of collagen are known, each with a distinct
biological function [19]. Among these types, a major
sub-class is those of fibrillar collagens, which form the
ordered extracellular fibrils; they are type I, type II, type
III, type V and type XI collagens. While young cartilage
cells contain pro-type I as well as pro-type II collagen,
mature molecules of type I collagen appear only in the
mineralisation zone of ECM, close to the ossification
front. The condylar cartilage, a precursor of the new
bone in the developing mandible, has been reported to
contain only types I, II and X collagens in rats [20]. Thus,
it appeared that different collagen types exist in different
tissues, in different forms, in different ratios and in dif-
ferent times of aging.
4.4.2. Localization of Type II and Type X Collagen
Perichondrium, and not the cartilage, reacts positively for
Type III collagen; type II is primarily found throughout
the extracellular matrix (ECM) as soon as the chondro-
progenitor cells are formed and in the cartilage, where it
is the most abundant protein, responsible for its tensile
strength, while type I and type III collagens are found in
most non-cartilagenous tissues. In contrast, type XI col-
lagen was recognized as a minor fibrillar collagen in the
cartilage that was similar to type II collagen [21] and
co-distributed with it in the cartilage and bone. When
entrapped within type II collagen lattice, aggrecan mo-
lecules provide compressive strength to the cartilage.
Type II collagen is also present in several other tissues in
the early embryonic development and detected in the
core of the newly formed bone trabeculae within the
primary spongiosa. Ordinarily, type II collagen consti-
tutes the major ingredient deposited in the ECM in the
fibrous form, which accounts for about 80% of the or-
ganic matrix of the cartilage.
Type X collagen and capillary endothelium are local-
ised in the hypertrophic and erosive zones of the condy-
lar cartilage, where osteogenic transition takes place to
facilitate endochondral ossification [21]. Only the hyper-
trophic chondrocytes within the mineralisation zone de-
monstrate an intense reactivity for the type X collagen,
whilemild reactivity of type VI collagen is encountered
throughout the condylar process.
4.5. Role of Collagen during Condylar
Intense research activity has been reported on the devel-
opment of the mandible in general and mandibular
condyles in particular, dealing with the growth changes
during the use of different orthopedic appliances on ex-
perimental animals [2,22-24]. The MCC in the young
animals, unlike other cartilages, is made up of a thick
layer of precursor cells, specialised cells (chondroblasts
and chondrocytes) and mineralised ECM. Condylar
growth is regulated by a host of growth regulatory fac-
tors, which are endogenously expressed in the condyles,
like the transcription factor SOX-9 which is required for
the differentiation of chondrocytes and for the expression
of a series of cartilage-specific marker genes, including
types II, X and XI collagens [25].
In the condyles, once the mesenchymal cells different-
tiate into chondrocytes, they mature, form the cartilage
and express type II collagen. The emerging mature
chondrocytes, later undergo hypertrophy and secrete type
X collagen, which constitutes the matrix for the hyper-
trophic cartilage as a marker destined for endochondral
Copyright © 2013 SciRes. OPEN ACCESS
A. S. Patil et al. / Open Journal of Stomatology 3 (2013) 6-13 11
ossification of the mandibular condyles [26,27]. Type X
collagen and capillary endothelium are expressed in the
hypertrophic and erosive zones of the condylar cartilage
where osteogenic transition takes place to facilitate en-
dochondral ossification [28].
4.6. Role of TGF-β in the Synthesis of Type-II
Collagen
Immuno-reactivity of TGF-β isoforms with collagen
type-II points out to their close association, physiologi-
cally and metabolically, during the genesis of MCC.
Accordingly, collagen synthesis by TGF-β in rabbit
model 1) appeared critically dependent on extra-cellular
environment, the effect varying with the differentiated
state of chondrocytes, 2) was dose-dependent on pro-
collagenase gene expression (especially for the synthesis
of type II collagen which augmented adhesion) and 3)
seemed stimulatory in human beings for type II collagen
in OA, where adhesion of chondrocytes to type IV col-
lagen decreased [29,30]. In fact, IGF-1 and TGF-β in-
duce expression of integrins, whose level is estimated by
cell adhesion, especially to collagen and fibronectin in
the ECM. However, distinguishing from these factors,
TGF-β markedly increases the efficiency of chondro-
cytes for colony formation in soft agar in the presence of
exudates. These chondrocytes produce large amount of
type-II collagen, without induction of type I, indicating
that even elongated chondrocytes can express their dif-
ferentiated functions and their shape is not necessarily
crucial for the synthesis of cartilage matrix [31].
4.7. Effect of Forward Mandibular Positioning
on Secretion of Collagen
4.7.1. Type II Collagen
Stimuli induced by the mechanical tension (tensile stress)
tend to increase type II collagen expression, during the
growth of the cartilage [32]. Mechanical stress generated
out of masticatory functions further increases the expres-
sion of genes for aggrecan, type-II collagen and osteo-
pontin. Type II collagen is expressed intensively in the
ECM of the hypertrophic layer and inside the chondro-
cytes of the glenoid fossa. Forward mandibular position-
ing leads to a significant increase in the expression of
type II collagen in the anterior, middle, and posterior
regions and shows the maximum level of expression at-
tained at 38th day of the natural growth, followed by a
gradual reduction in the expression thereafter.
Bio-mechanical forces induced by the forward man-
dibular positioning solicit cellular and molecular changes
that lead to up-regulation in the expression of type II
collagen in the glenoid fossa. These molecular changes
improve our understanding of the tissue responses to
functional appliance therapy [32,33]. Adaptation of the
condylar cartilage to the mandibular forward positioning
has been considered to constitute the biologial basis for
an altered osteogenic transition of chondrogenesis that
leads to increased endochondral ossification [34].
4.7.2. Type X Collagen
Type X collagen expression precedes the onset of endo-
chondral ossification in the mandibular condyles [27,35].
Type X collagen is synthesized exclusively by the hyper-
trophic chondrocytes and its expression indicates the
termination of chondrogenesis [35]. A similarity in the
temporal pattern, but a significant difference in the quan-
tity of type X collagen synthesis between these two
(natural vs adaptive) groups indicates that the rate of
chondrocyte maturation under an adaptive remodelling is
consistent with that under the natural growth, but at a
more enhanced degree [32]. In the growing rats, type X
collagen expression was significantly (541%) enhanced
upon the mandibular advancement. The cells constituting
this newly formed cartilaginous matrix in the growing
condyle undergo hypertrophy and synthesize the hyper-
trophic matrixby type X collagen [36,37].
Type X collagen being relevant to the mineralization
of the cartilage, it is present in the hypertrophic cell layer
in the growth stage. It is ubiquitously observed, even
after the hypertrophic cell layer has disappeared, in the
area immediately above the mineralizing front of the
cartilage matrix. This finding suggests that type X colla-
gen is not produced for the sole purpose of inducing hy-
pertrophy in the chondrocytes. In this regard, Ekanayake
and Hall [37] reported that both hypertrophic and small
chondrocytes express type X collagen, when both types
of chondrocytes undergo the process of mineralization in
vitro. Immuno-histochemical localization of type X col-
lagen in the MCC showed that it is secreted in the early
stages of temporomandibular disorders, indicating the
possibility of a change in the matrix during the minerali-
zation process [38].
The proposed mechanism of type X collagen 1) in-
volves expression specifically in the hypertrophic carti-
lage, indicating its role in the terminal stage of the chon-
drocyte maturation, 2) regulates calcification during the
endochondral ossification and 3) provides an easily re-
sorbable fabric for the deposition of the bone matrix
[39].
In the present study, young rabbits have shown pref-
erence to biosynthesis of PG in sharp contrast to biosyn-
thesis of collagen Type-II observed in mice and rats.
These figures of expression of Col2A and Col 10A gene
cumulatively emphasize relatively less significance of
type II collagen and type X collagen over the synthesis
of above-mentioned derivatives of PG in the formation
of extracellular matrix (ECM) in the young rabbits.
These observations are finally validated by a mere 0.70-
Copyright © 2013 SciRes. OPEN ACCESS
A. S. Patil et al. / Open Journal of Stomatology 3 (2013) 6-13
12
fold increase in the expression of collagen II gene and a
mere 0.47-fold increase in the expression of collagen X
gene (Figure 2).
5. CONCLUSIONS
The following genes expressed after the administration
of growth factors along with mandibular repositioning
appliances has induced 1) 1.70-fold expression of Col-
2A gene (p value < 0.0005), 2) 1.47-fold expression of
Col-10A gene (p value < 0.0005); whereas administra-
tion only of mandibular repositioning appliances has
induced 1) 1.28-fold expression of Col-2A gene (p value
< 0.0005), 3) 0.62-fold expression of Col-10A gene (p
value <0.0005) and administration of growth factors only
has induced 1) 0.56-fold expression of Col-2A gene (p
value <0.0005), 3) 0.86-fold expression of Col-10A gene
(p value <0.0005).
In conclusion, this effort is superior to the in vivo
studies in the scope and certainly educative in the obser-
vations derived from the in vitro studies. In the ultimate
analysis, it may prove that reach of the genes is much
longer than human beings have ever envisaged.
6. ACKNOWLEDGEMENTS
ASP acknowledges the assistance of Dr. Prashant Khadke, Dr. Uday
Deshpande, Dr. Dada Akolkar and Mr. Mandar from LAB INDIA-
RGITBT collaboration in the gene expression studies and Mrs. Soumya
Koppikar in the analysis of PG.
REFERENCES
[1] Patil, A.S., Sable, R.B. and Kothari, R.M. (2011) An
update on transforming growth factor-β (TGF-β): Sources,
types, functions and clinical applicability for cartilage/
bone healing. Journal of Cellular Physiology, 226, 3094-
3103. http://dx.doi.org/10.1002/jcp.22698
[2] Petrovic, A.G. and Stutzmann, J.J. (1977) Further inves-
tigations into the functioning of the peripheral comparator
of the servosystem in the control of the condylar cartilage
growth rate and the lengthening of the jaw. In: McNa-
mara, J.A., Ed., The Biology of Occlusal Development,
Monograph 7, 255-291.
[3] Ghafari, J. and Degroote, C. (1986) Condylar cartilage
response to continuous mandibular displacement in the
rat. Angle Orthodontist, 56, 49-57.
[4] Patil, A.S., Merchant, Y. and Nagarajan, P. ( 2013) Tis-
sue engineering of craniofacial tissues. Journal of Regen-
erative Medicine and Tissue Engineering, 2, 1-19.
[5] Blumenfeld, I., Gasper, R., Laufer, D. and Livne, E. (2000)
Enhancement of toluidine blue staining by transforming
growth factor, insulin like growth factors and growth
hormone in the temporomandibular joint of aged mice.
Cells Tissues Organs, 167, 121-129.
http://dx.doi.org/10.1159/000016775
[6] Proff, P., Gedrange, T., Franke, R., Schubert, H., Fang-
hanel, J., Miehe, B., et al. (2007) Histological and histo-
morphometric investigation of the condylar cartilage of
juvenile pigs after anterior mandibular displacement.
Annals of Anatomy, 189, 269-275.
http://dx.doi.org/10.1016/j.aanat.2006.09.006
[7] Patil, A.S., Sable, R.B. and Kothari, R.M. (2012) Role of
insulin-like growth factors (IGFs), their receptors and
genetic regulation in the chondrogenesis and growth of
the mandibular condylar cartilage. Journal of Cellular
Physiology, 227, 1796-1804.
http://dx.doi.org/10.1002/jcp.22905
[8] Doshi, R.R. and Patil, A.S. (2012) Genes in craniofacial
growth. IIOAB Journal, 3, 19-36.
[9] Patil, A.S., Sable, R.B. and Kothari, R.M. (2012) Genetic
expression of MMP-1 and MMP-13 as a function of ante-
rior mandibular repositioning appliance on the growth of
mandibular condylar cartilage with and without admini-
stration of IGF-1 and TGF-b. Angle Orthodontist, 82,
1053-1059. http://dx.doi.org/10.2319/122011-780.1
[10] Bushang, P.H. and Hinton, R.J. (2005) A gradient of
potential of modifying craniofacial growth. Seminars in
Orthodontics, 11, 219-226.
http://dx.doi.org/10.1053/j.sodo.2005.07.006
[11] Visnapuu, V., Peltomaki, T., Ronning, B., Vahlberg, T.
and Helenius, H. (2001) Growth hormone and insulin-like
growth factor receptors in the temporomandibular joint of
the rat. Journal of Dental Research, 80, 1903-1907.
http://dx.doi.org/10.1177/00220345010800100801
[12] Shen, G. and Darendeliler, M.A. (2005) The adaptive
remodeling of condylar cartilage—A transition from
chondrogenesis to osteogenesis. Journal of Dental Re-
search, 84, 691-699.
http://dx.doi.org/10.1177/154405910508400802
[13] Von Den Hoff, J.W. and Delatte, M. (2008) Interplay of
mechanical loading and growth factors in the mandibular
condyle. Archives of Oral Biology, 53, 709-715.
http://dx.doi.org/10.1016/j.archoralbio.2008.03.002
[14] Patil, A.S., Sable, R.B. and Kothari, R.M. (2012) Occur-
rence, biochemical profile of vascular endothelial growth
factor (VEGF) isoforms and their functions in endo-
chondral ossification. Journal of Cellular Physiology, 227,
1298-1308. http://dx.doi.org/10.1002/jcp.22846
[15] Rabie, A.B. and Hägg, U. (2002) Factors regulating man-
dibular condylar growth. American Journal of Orthodon-
tics and Dentofacial Orthopedics, 122, 401-409.
http://dx.doi.org/10.1067/mod.2002.125713
[16] Carlson, D.S. (2002) Biological rationale for early treat-
ment of dentofacial deformities. American Journal of
Orthodontics and Dentofacial Orthopedics, 121, 554-558.
http://dx.doi.org/10.1067/mod.2002.124164
[17] Rabie, A.B.M., Wong, L. and Tsai, M. (2003) Replicating
mesenchymal cells in the condyle and the glenoid fossa
during mandibular forward positioning. American Jour-
nal of Orthodontics and Dentofacial Orthopedics, 123,
49-57. http://dx.doi.org/10.1067/mod.2003.46
[18] Suzuki, S., Itoh, K. and Ohyama, K. (2004) Local ad-
ministration of IGF-I stimulates the growth of mandibular
condyle in mature rats. Journal of Orthodontics, 31, 138-
143. http://dx.doi.org/10.1179/146531204225020436
Copyright © 2013 SciRes. OPEN ACCESS
A. S. Patil et al. / Open Journal of Stomatology 3 (2013) 6-13
Copyright © 2013 SciRes.
13
OPEN ACCESS
[19] Prockop, D.J. (1995) Collagens: Molecular biology, dis-
eases, and potentials for therapy. Annual Review of Bio-
chemistry, 64, 403-434.
http://dx.doi.org/10.1146/annurev.bi.64.070195.002155
[20] Luder, H.U., Leblond, C.P. and Von Der Mark, K. (1988)
Cellular stages in cartilage formation as revealed by
morphometry, radioautography and type II collagen im-
munostaining of the mandibular condyle. Weaning Rats,
182, 197-204.
[21] Shen, G., Zhao, Z., Kaluarachchi, K. and Rabie, A.B.
(2006) Expression of type X collagen and capillary en-
dothelium in condylar cartilage during transition from
chondrogenesis to osteogenesis—A comparison between
condylar adaptation and natural growth. European Jour-
nal of Orthodontics, 28, 210-216.
http://dx.doi.org/10.1093/ejo/cji123
[22] Hinton, R.J. and Mc Namara Jr., J.A. (1984) Temporal
bone adaptations in response to protrusive function in ju-
venile and young adult rhesus monkeys (Macacamulatta).
European Journal of Orthodontics, 6, 155-174.
[23] Kantomaa, T. (1987) Reactions of the condylar tissues to
attempts to increase mandibular growth. Scandinavian
Journal of Dental Research, 95, 335-339.
[24] Johnston Jr., L.E. (1996) Functional appliances: A mort-
gage on mandibular position. Australian Orthodontic
Journal, 14, 154-157.
[25] De Crombrugghe, B., Lefebvre, V. and Nakashima, K.
(2001) Regulatory mechanisms in the pathways of carti-
lage and bone formation. Current Opinion in Cell Biology,
13, 721-727.
http://dx.doi.org/10.1016/S0955-0674(00)00276-3
[26] Salo, L.A., Metsikko, K., Palokangas, H., Lehenkari, P.
and Väänänen, H.K. (1996) The expression of types X
and VI collagen and fibrillin in rat mandibular condylar
cartilage. Response to mastication forces. Acta Odon-
tologica Scandinavica, 5, 295-302.
http://dx.doi.org/10.3109/00016359609003541
[27] Rabie, A.B.M., Shen, G., Hägg, U. and Kalurachchi, T.
(2000) Type X collagen—A marker for endochondral os-
sification of the mandibular condyles. Quintessence Or-
thodont Year Book, 50-58.
[28] Shen, G., Zhao, Z., Kaluarachchi, K. and Rabie, A.B.
(2006) Expression of type X collagen and capillary en-
dothelium in condylar cartilage during transition from
chondrogenesis to osteogenesis—A comparison between
condylar adaptation and natural growth. European Jour-
nal of Orthodontics, 28, 210-216.
http://dx.doi.org/10.1093/ejo/cji123
[29] Yaeger, P.C., Masi, T.L., De Ortiz, J.L., Binette, F., Tubo,
R. and Mcpherson, J.M. (1997) Synergistic action of
transforming growth factor-beta and insulin-like growth
factor-I induces expression of type II collagen and ag-
grecan genes in adult human articular chondrocytes. Ex-
perimental Cell Research, 237, 318-325.
http://dx.doi.org/10.1006/excr.1997.3781
[30] Grimaud, E., Heymann, D. and Redini, F. (2002) Recent
advances in TGF-β effect on chondrocyte metabolism:
Potential therapeutic roles of TGF-β in cartilage disor-
ders. Cytokine & Growth Factor Reviews, 13, 241-257.
http://dx.doi.org/10.1016/S1359-6101(02)00004-7
[31] Inoue, H., Kato, Y., Ivamoto, M., Hiraki, Y., Sakuda, M.
and Suzuki, F. (1989) Stimulation of cartilage-matrix
proteoglycan synthesis by morphologically transformed
chondrocytes grown in the presence of fibroblast growth
factor and transforming growth factor-beta. Journal of
Cellular Physiology, 138, 329-337.
http://dx.doi.org/10.1002/jcp.1041380216
[32] Rabie, A.B.M., She, T.T. and Harley, V.R. (2003) For-
ward mandibular positioning up-regulates SOX9 and type
II collagen expression in the glenoid fossa. Journal of
Dental Research, 82, 725-730.
http://dx.doi.org/10.1177/154405910308200913
[33] Kantomaa, T. and Pirttiniemi, P. (1998) Changes in pro-
teoglycan and collagen content in the mandibular condy-
lar cartilage of the rabbit caused by an altered relationship
between the condyle and glenoid fossa. European Jour-
nal of Orthodontics, 20, 435-441.
http://dx.doi.org/10.1093/ejo/20.4.435
[34] Rabie, A.B., Shum, L. and Chayanupatkul, A. (2002)
VEGF and bone formation in the glenoid fossa during
forward mandibular positioning. American Journal of Or-
thodontics and Dentofacial Orthopedics, 122, 202-209.
http://dx.doi.org/10.1067/mod.2002.125991
[35] Nishida, N., Fukuda, Y., Komeda, T., Ito, T., Nishimura,
T., Minata, M., Kuno, M., Katsuma, H., Ikai, I., Yamaoka,
Y. and Nakao, K. (2002) CTGF/Hcs24, a hypertrophic
chondrocyte specific gene product, stimulates prolifera-
tion and differentiation, but not hypertrophy of cultured
articular condrocytes. Journal of Cellular Physiology, 192,
55-63. http://dx.doi.org/10.1002/jcp.10113
[36] Rabie, A.B. and Hägg, U. (2002) Factors regulating man-
dibular condylar growth. American Journal of Orthodon-
tics and Dentofacial Orthopedics, 122, 401-409.
http://dx.doi.org/10.1067/mod.2002.125713
[37] Ekanayake, S. and Hall, B.K. (1994) Hypertrophy is not a
prerequisite for type X collagen expression or mineralize-
tion of chondrocytes derived from cultured chick man-
dibular ectomesenchyme. The International Journal of
Developmental Biology, 38, 683-694.
[38] Ohashi, N., Robling, A.G., Burr, D.B. and Turner, C.H.
(2002) The effects of dynamic axial loading on the rat
growth plate. Journal of Bone and Mineral Research, 17,
284-292. http://dx.doi.org/10.1359/jbmr.2002.17.2.284
[39] Fukada, K., Shibata, S., Suzuki, S., Ohya, K. and Kuroda,
T. (1999) In situ hybridisation study of type I, II, X col-
lagens and aggrecan mRNAs in the developing condylar
cartilage of fetal mouse mandible. Journal of Anatomy,
195, 321-329.
http://dx.doi.org/10.1046/j.1469-7580.1999.19530321.x