Open Journal of Stomatology, 2013, 3, 402-410 OJST
http://dx.doi.org/10.4236/ojst.2013.38068 Published Online November 2013 (http://www.scirp.org/journal/ojst/)
Cleidocranial dysplasia with a rare mutation: Study of a
family with review of literature
Ahmet Ercan Sekerci2*, Burhan Balta1, Oğuzhan Bahadir1, Yildiray Sisman2, Munis Dundar1,
Turgut Tursem Tokmak3, Stefan Mundlos4
1Department of Medical Genetics, Faculty of Medicine, Erciyes University, Kayseri, Turkey
2Department of Oral Diagnosis and Radiology, Faculty of Dentistry, Erciyes University, Kayseri, Turkey
3Department of Radiodiagnostics, Faculty of Medicine, Erciyes University, Kayseri, Turkey
4Institute of Medical Genetics, Charité-Universitaetsmedizin, Berlin, Germany
Received 13 September 2013; revised 15 October 2013; accepted 23 October 2013
Copyright © 2013 Ahmet Ercan Sekerci et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited.
ABSTRACT
Introduction: The present study was aimed at ad-
vancing the understanding of the pathogenesis of
cleidocranial dysplasia (CCD) by presenting a case
study based on history, physical examination, typical
radiological features, and molecular analysis and a
review of the literature. Methods: This study began
with a 23-year-old boy (proband) who was referred
to the department of oral and maxillofacial radiol-
ogy with chief complaint of the upper-left first molar
tooth and routine dental examination. While evalu-
ating the panoramic radiograph, the patient had ap-
proximately 57 teeth in his both of the jaws. Clinical,
radiographical and molecular features of the pro-
band, two siblings and their parents were examined
and then, DNA analysis was performed. Results:
Overall, we present 3 CCD patients with a mutation
in the VWRPY motif. The deletion of c. 1754_1757
delTTTG (NM_001024630.2) is determined and it
leads to a frame shift mutation and stop codon, p.
V585Gfs56X. Conclusions: The present study em-
phasized the importance of further clinical and mo-
lecular investigation when even a single case of CCD
is identified within a family. This is the first study
performed in Turkey about a family with a mutation
in the VWRPY motif. Genotype-phenotype associa-
tion studies in individuals with CCD are necessary to
provide important insights into molecular mechanisms
associated with this disease.
Keywords: Cleidocranial Dysplasia; Mutation; RUNX2;
Gene; Impacted Supernumeraries
1. INTRODUCTION
Cleidocranial dysplasia (CCD), also known as Marie and
Sainton disease [1] or cleidocranial dysostosis, is a rare
congenital defect of autosomal dominance inheritance
that is characterized by persistently open sutures or de-
layed closure of sutures, hypoplasia or aplasia of the
clavicles, cone-shaped thorax, short stature, supernumer-
ary teeth, delayed eruption of permanent dentition and
other skeletal anomalies [2].
Dental anomalies and some degrees of clavicular hy-
poplasia seem to be consistent features of the disorder [3].
A variety of dental problems may occur in CCD. This
condition is of clinical significance to dentistry due to the
involvement of the facial bones, a prolonged retention of
deciduous teeth and several impacted permanent succes-
sors and supernumerary elements, sometimes accompa-
nied by follicular cysts and eruptive pseudocysts [4].
CCD manifests itself as a condition in which teeth fail to
erupt, which is thought to be due to the absence of cellu-
lar cementum and an increase in the amount of acellular
cementum of the roots of the affected teeth [5]. For these
reasons, dental management is a significant aspect of the
health care of affected persons [6].
This disorder is transmitted as an autosomal dominant
trait or it’s caused by a spontaneous genetic mutation and
is present at a frequency of one in one million individu-
als [7]. It affects both males and females equally [8]. It
has been demonstrated that mutation of the runt-related
transcription factor 2 gene (RUNX2), located at chromo-
some 6p21, is associated with CCD [9]. This gene en-
codes a protein necessary for the correct functioning of
osteoblastic differentiation and bone formation. RUNX2
has been shown to bind to the DNA sequence element
called RUNX-binding site (PyGPyGGT) and to regulate
*Corresponding author.
OPEN ACCESS
A. E. Sekerci et al. / Open Journal of Stomatology 3 (2013) 402-410 403
a number of bone-related genes [10]. So far, over 100
mutations of RUNX2 have been associated with CCD
[11-15]. The RUNX2 gene consists of several functional
domains. The Runt domain is a highly conserved se-
quence coding 128 amino acids. Runt domain is respon-
sible for DNA binding and heterodimerisation with a non
DNA-binding core-binding factor β (CBFβ) subunit [16].
Most of the missense mutations were located in the Runt
domain involving heterodimerisation and DNA binding
with CBF β [17]. Nonsense, splicing mutation and inser-
tion/deletions were also found and they were scattered
throughout the entire RUNX2 gene. The Q/A Domain is
located at the N-terminus of the protein and has a unique
role for the transcriptional activity of RUNX2 [9]. The
proline-serine-threonine (PST) rich domain comprises
the C-terminal end of the protein where these three
amino acids are frequently detected. The VWRPY amino
acid sequence is located at the C-terminal end of this
domain and also at the C-terminal end of all RUNX pro-
teins. The VWRPY motif is crucial for the proper repres-
sion activity of the RUNX2 protein [18,19].
In this study, 3 related patients with the mutation in
VWRPY peptide sequence were reported. The deletion
of c. 1754_1757 delTTTG (NM_001024630.2) is deter-
mined and it leads to a frame shift mutation and stop
codon, p. V585Gfs56X. The aim of present study was to
identify the spectrum of mutations in RUNX2 in this
population and to analyze the genotype-phenotype cor-
relations accordingly and then assessed subcellular lo-
calization of the RUNX2 mutants or relations accord-
ingly.
2. METHODS
This study began with a 23-year-old (proband, patient I)
boy who was referred to the department of oral and max-
illofacial radiology for extraction of the upper-left first
molar tooth and routine dental examination. Clinical,
radiographical and molecular examinations of the pro-
band, two siblings and their parents were performed.
Mutation Identification
Patients with a clinical diagnosis of cleidocranial dyspla-
sia were recruited via consultation service in Institute of
Medical Genetics, Charité-Universitaetsmedizin, Berlin,
Germany. All samples were obtained following informed
consent for DNA testing. Approximately 10 mL periph-
eral blood was collected from all patients and then, DNA
analysis was performed.
3. RESULTS
3.1. Study Cohort
A total of three family members were tested for RUNX2
mutations, two siblings and their father. Both patients
had been clinically diagnosed with CCD, however, the
mother and little boy were normal.
Patient I: Intraoral examination revealed that the pa-
tient was in a dental class III relationship with mala-
ligned teeth. Intraoral examination revealed multiple
overretained deciduous teeth and some missing teeth
(Figure 1(a)). Panoramic radiograph was required to
evaluate the patient’s overall dentition. On evaluating the
panoramic radiograph, the classical signs of cleidocranial
dysplasia were immediately recognized (Figure 1(b)).
The patient had approximately 57 teeth in his both of the
jaws. Some of the teeth were erupted but most of them
were unerupted and mimicking a premolar in shape. Go-
nial angles on both sides of mandible were missing and
maxillary sinuses were underdeveloped. 3-D cone beam
computed tomography images showed position of all
teeth (Figure 2(a)).
At that time he was 183 cm (50 - 75 p) tall and
weighed 77 kg. On general examination he was well
oriented, of normal build and stature. In facial examina-
tion he had hypertelorism, frontal bossing, prognathism,
depressed nasal bridge, synophyrs and a widely opened
anterior fontanel. The most striking feature was ap-
proximation of both shoulders near midline suggestive of
hypermobility of shoulders (Figure 2(a)). The patient’s
other findings included pectus excavatum, overlapped
fingers and nail atrophy of the toes. Chest radiograph
revealed a cone-shaped thorax with aplasia of the right
clavicle and dysplastic left clavicle (Figure 2(b)). A
head CT demonstrated that he had wormian bones, unos-
sified cranial sutures, absence of mastoid aeration, bilat-
eral narrow external acoustic meati and cervical-1 verte-
(a)
(b) (c)
Figure 1. (a) Intraoral view of the patient, (b) OPG of patient I
showing multiple supernumerary and impacted teeth in maxilla
and mandible and (c) hypermobility of shoulders.
Copyright © 2013 SciRes. OPEN ACCESS
A. E. Sekerci et al. / Open Journal of Stomatology 3 (2013) 402-410
404
(a) (b)
Figure 2. (a) Three dimensional cone beam computed tomo-
graphy showing impacted supernumeraries. (b) X-ray chest
revealing a cone-shaped thorax with aplasia of the right clavicle
and dysplastic left clavicle.
brae anterior arch cleft anomaly. A pelvic X-ray showed
wide symphysis pubis. Bone mineral density (BMD) was
evaluated by DEXA and BMD was normal.
Patient II, an 18 year old male, the brother of patient 1,
measuring 159 cm (<3 p) was examined clinically. He
was in a dental class III relationship, on evaluating the
panoramic radiograph (Figure 3(a)), he had 53 teeth in
his both of the jaws. In general examination he was of
short, abnormal stature and had a rib hump deformity.
The other head examination findings included frontal
bossing, hypertelorism, prognathism, depressed nasal
bridge and widely opened anterior fontanel. The patient
had a mid-sagittal groove on the forehead. There was
swelling of the middle interphalangeal joints. Low-grade
conductive hearing loss was found in audiometric studies.
In medical history he had had an adenoidectomy opera-
tion. Ophthalmic findings were normal except for wid-
ening of the eye sockets.
Chest radiograph revealed that there were dysplastic
tubular bones, probably clavicle, in both shoulders (two
tubular bones on the left side). These tubular bones had
no connection with the sternoclavicular and acromio-
clavicular joints. He had severe rotoscoliosis of the tho-
rax (Figure 3(b)). Widening of the symphysis pubis and
sacroiliac joints were determined. There was absent ossi-
fication of the pubic and ischial bones. A three-dimen-
sional reconstruction (3D) CT showed an open anterior
fontanel and metopic suture. In addition there were nu-
merous wormian bones in parietal-occipital region. Bi-
lateral mastoid cell aeration was absent. The external
acoustic meati were bilaterally narrow. There was an
ossification defect in posterior processus spinosus of the
cervical-6 vertebrae. A brain MRI indicated abnormal
angulation of the cerebral peduncle. BMD was evaluated
by DEXA. Lumbar vertebrae bone mineral density was
reduced. Femur neck bone mineral density was normal.
Patient III, a 52 year old male, the father of patient 1
and 2, was 156 cm in height (<3 p) and in a dental class
(a) (b)
(c) (d)
Figure 3. (a) OPG of patient II showing multiple supernumer-
ary and impacted teeth in maxilla and mandible and (b) his
chest radiograph showing dysplastic tubular bones, probably
clavicle, in both shoulders (two tubular bones on the left side).
(c) OPG of patient III (father) showing supernumerary and
impacted teeth in maxilla and mandible and (d) 3D CT image
revealing the top of the metopic suture, anterior fontanel, sagit-
tal suture and posterior fontanels were widely opened.
III relationship. Panoramic oral examination revealed the
presence of 10 erupted permanent teeth and 11 impacted
supernumerary teeth (Figure 3(c)). He had central obe-
sity. His clinical findings included hypertelorism, de-
pressed nasal bridge, frontal bossing, prognathism, a
mid-sagittal groove on the forehead, widely opened ante-
rior fontanel and metopic sutures. From his medical his-
tory we learned that he had frequently recurring otitis
externa. An ear examination showed that his external
acoustic meatus were narrow. Low-grade conductive
hearing loss was found. Ophthalmic consultation was
normal except for widening of the eye sockets.
On chest X-ray mild scoliosis of the thorax was de-
termined. On pelvic X-ray widening of the symphysis
pubis and sacroiliac joints was determined. In 3D CT
images the top of the metopic suture, anterior fontanel,
sagittal suture and posterior fontanels were widely
opened (Figure 3(d)). Numerous wormian bones were
observed in the parietal-occipital region. There was no
aeration in the mastoid cells and they were sclerotic. An
ossification defect in cervical-6 vertebrae of the posterior
proccesus spinosus was observed. In a brain MRI the
cerebral peduncle was angulated and basilar invagination
was determined. BMD was evaluated by DEXA. Lumbar
vertebrae and femur neck bone mineral densities were
reduced. They were informed about the CCD and sched-
uled for a follow-up appointment. In addition, other
mandatory dental procedures were done according to
patients’ requests.
The patients with CCD were informed about the dis-
Copyright © 2013 SciRes. OPEN ACCESS
A. E. Sekerci et al. / Open Journal of Stomatology 3 (2013) 402-410
Copyright © 2013 SciRes.
405
OPEN ACCESS
Table 1. Used primers.
ease. Mandatory dental procedures were done according
to patients’ requests. They didn’t accept treatment pro-
cedures involve a combination of maxillofacial surgery,
orthodontics, and prosthodontics. The proband’s little
brother and mother clinically and radiographically were
normal.
3.2. Genetic Analysis
The cDNA sequence of CBFA1 was determined by a
combination of nested RT-PCR with lymphoblast RNA
and genomic sequencing of PAC clones. For the analysis
of lymphoblast RNA, PCR primers were designed to
amplify the 1.4 kb cDNA in 2 overlapping fragments,
from the start of the Runt domain in exon 1 to the stop
codon in exon 7. The primers for the first/second round
PCR were AML3F1/AML3F2 and CBFA-7/CBFA-6,
respectively. In the second round, the 5’ or 3’ primer was
replaced by AML3F5 or AML3R4, respectively. The
characterization of the 5’ end of CBFA1, as well as all
the intron-exon boundaries, were determined by direct
sequencing (using an ABI sequencer) of the PAC clones
with appropriate exon primers. These primers were de-
rived from published sequences by the sequencing of
RT–PCR products, or from conserved segments in the
mouse. The primers used are shown in Table 1.
4. DISCUSSION
Dental findings in patients with CCD are characterized
by abnormal dentition, including multiple supernumerary
teeth, retention of primary teeth, eruption failure of per-
manent teeth, malocclusion, irregular forms of dentition,
wide spacing in the lower incisor area, supernumerary
tooth germs, parallel-sided ascending rami, cysts in their
gums that usually form around extra teeth [20] and in-
crease in odontogenesis leading to excessive number of
supernumerary teeth [21]. Suggested factors of over re-
tained deciduous teeth are lack of eruption potential and
lack of cellular cementum on roots of permanent teeth,
delayed mineralization of teeth, physical barrier-abnor-
mal density of bone overlying the succedaneous teeth,
and failure of bony crypt to resorb. Suggested etiology
for supernumerary teeth is incomplete or severely de-
layed resorption of the dental lamina, which is then reac-
tivated at the time of crown completion in the normal
permanent teeth [22]. Delayed or arrested eruption has
also been attributed to lack of cellular cementum. Less
commonly alterations of hard dental tissues, eruption
cysts, a high propensity for caries and narrow high palate
have been found [23]. The most consistent dental find-
ings in individuals with CCD are the presence of the sec-
ond permanent molar with the primary dentition (80%),
wide spacing in the lower incisor area, supernumerary
tooth germs (70%), and parallel-sided ascending rami
[20]. Individuals with CCD are more likely to have an
underbite and to have cysts in their gums that usually
form around extra teeth [24]. In present sudy, the siblings
have multiple impacted teeth in maxilla and mandible.
Underdevelopment of the maxilla and relative mandibu-
lar prognathism are common [25]. There is a predisposi-
tion to develop numerous supernumerary teeth, particu-
larly in mandibular premolar and maxillary anterior re-
gions [26]. Other than delayed, the permanent molars
generally erupt without incident [27] as siblings in the
present sdudy.
The differential diagnosis of CCD includes osteogene-
sis imperfecta (frequent fractures), pycnodysostosis
(skeletal density), congenital hypothyroidism (disturbed
thyroid metabolism). Gardner syndrome, Hallerman-
Streiff syndrome (narrow face, hypotrichosis, mi-
crophthalmia), and the orofaciodigital syndrome type I
[6], Crane-Heise syndrome, mandibuloacral dysplasia,
Sense Antisense
Exon 0 AML3F8/5-GAGAATGCTAACTCGCCTCCAG AML3R8/5-GAGACCACCCGAGTCAGTGAGTCG
CBFA-9/5-CCACGACAACCGCACCATG
MCBFA-1/5-ATGCGTATTCCTGTAGATCCG
Exon 1
MCBFA-3/5 -AGCGACGTGAGCCCGGTG
CBFA-8/5-CATGGTGCGGTTGTCGTGG
Exon 2 AML3F2/5 -CGGAGAGGTACCAGATGGGAC AML3R1/5 -GTCCCATCTGGTACCTCTCCG;
Exon 3 AML3F2/5 -CGGAGAGGTACCAGATGGGAC AML3R1/5 -GTCCCATCTGGTACCTCTCCG
Exon 4 AML3F4/5 -ACAAATCCTCCCCAAGTAGCT AML3R2/5 -TGATAGGTAGCTACTTGGGGA
Exon 5 AML3F5/5 -TACCACCCCGCTGTCTTCCAC AML3R4/5 -GAAATGCGCCTAGGCACATCG
Exon 6 AML3F7/5 -ATGATGACACTGCCACCTCTG AML3R7/5 -TGCCTGGCTCTTCTTACTGAG
AML3R5/5 –GGTTGGAGAAGCGGCTCTCAG
CBFA-6/5 –CACTGGGCCACTGCTGAG
Exon 7
CBFA-7/5 -GATACGTGTGGGATGTGGC
A. E. Sekerci et al. / Open Journal of Stomatology 3 (2013) 402-410
406
pycnodysostosis, yunis varon syndrome, CDAGS syn-
drome and hypophosphatasia, Parietal foramina with
cleidocranial dysplasia, Chromosomal abnormalities [20].
These conditions may share some characteristics with
CCD, however all these are autosomal recessive disor-
ders and have other specific features. Some of these con-
ditions may result from mutation in genes that affect the
action of RUNX2 on its downstream targets [28].
The purpose of dental management in patients with
CCD is to achieve an optimal functional and cosmetic
result by early adulthood [29]. The planning of dental
treatment aims in CCD varies from individual to indi-
vidual and primarily depends on the needs of the patient,
the age at diagnosis, and social and economic circum-
stances [30]. A multidisciplinary approach is required.
The current “state-of-the-art” treatment involves a com-
bination of maxillofacial surgery, orthodontics, and
prosthodontics. Several combination treatment ap-
proaches have been reported [29]. The most popular or-
thodontic-surgical regimes have been reported with great
success including the Toronto-Melbourne (Table 2). The
Toronto-Melbourne approach [31-36] is based on timed,
Table 2. Management approaches of patients with cleidocranial dysplasia.
Procedure
5 to 6 years Extraction of deciduous incisors
Deciduous incisors are exposed and healing is allowed
Orthodontic brackets arc placed on permanent anterior teeth incisors
6 to 7 years
Extraction of posterior deciduous teeth
Permanent bicuspids are exposed
Surgical removal of supernumerary teeth and healing allowed
Surgical exposure of permanent premolars
Toronto-Melbourne
approach
9 to 12 years
Brackets placed on canines and premolars
Removal of all deciduous and supernumerary teeth
Single method Exposure of all impacted teeth are surgically
Age: not specified Surgical packing are placed to prevent healing of bone and soft tissue over teeth
Healing by secondary intention
Placement of orthodontic attachments
Placement of orthodontic appliances placed on fully erupted teeth
Belfast-Hamburg
approach
Placement of elastic thread between appliances on unerupted teeth and the arch wires
Stage 1
Extraction of deciduous incisors
Extraction of all supernumerary teeth
Exposure of permanent incisors
Brackets bonded immediately
10 to 12 years
Surgical flaps are closed completely
Stage 2
Extraction of posterior deciduous teeth
Exposure of unerupted permanent canines and premolars
Brackets bonded immediately
Jerusalem approach
Age 13
Surgical flaps are closed completely
Stage 1
Two at most 3 Removal of all primary and supernumerary teeth
Procedures Surgical flaps closed
Age: not specified Stage 2
Exposure of unerupted permanent teeth
Placement of orthodontic attachments
Surgical flaps are closed and overdenture is placed
Placement of conventional orthodontic appliances
Stage 3
Leforte I osteotomy-orthognathic surgery
Bronx approach
Placement of dental implants
Copyright © 2013 SciRes. OPEN ACCESS
A. E. Sekerci et al. / Open Journal of Stomatology 3 (2013) 402-410 407
serial extraction of deciduous teeth and depends on the
extent to which the roots of the permanent teeth have
developed. The Belfast-Hamburg approach is a single
surgical procedure that limits the number of surgeries to
a single episode. All deciduous and supernumerary teeth
are extracted and all unerupted permanent teeth are ex-
posed simultaneously under general anesthesia. A third
approach, the Jerusalem approach is based on at least 2
surgical interventions, the timing of which is dependent
on the root development of the permanent dentition. The
Bronx approach uses 2, and at most 3, surgical interven-
tions.
Kalliala [27] suggested that removal of primary or su-
pernumerary teeth does not usually promote eruption of
unerupted permanent teeth. However, Golan et al. [20]
proposed that supernumerary teeth in patients with CCD
should be diagnosed and removed as early as possible
because the supernumerary teeth will always impede
normal eruption of permanent teeth. Following alignment
of all permanent teeth, any underlying skeletal discrep-
ancy (most commonly a Class III skeletal malocclusion)
can be corrected through orthognathic surgery after the
completion of growth [Lefort 1 maxillary osteotomy].
The complete overlay denture has numerous advantages
for the pediatric patient. Enhanced mastication and es-
thetics are the more obvious benefits and speech also
may be improved. The alveolar bone is maintained by
the retention of teeth compared to its loss when teeth are
extracted [37].
Sato [38] suggests the use of a three-dimensional
method of locating the position of impacted supernumer-
ary teeth insisting upon the importance of the removal of
the supernumerary teeth and the planning of an ortho-
dontic treatment that will allow for occlusion of the re-
tained teeth. In our case, cone-beam computed tomogra-
phy scans of Patient I was performed. In present case, the
protocol involves timely extraction of deciduous teeth,
staged surgical removal of supernumerary teeth, expo-
sure of selected unerupted permanent teeth and ortho-
dontic forced eruption. Then Lefort I maxillary osteot-
omy corrected through orthognathic surgery, but both he
and other patients with CCD did not accepted unfortu-
nately for any treatment planning.
Mutations in RUNX2 have a high penetrance and ex-
treme variability, ranging from isolated dental anomalies
to fully manifesting disease with poorly ossified cranium
and absence of clavicles [39]. In experimental studies,
mice carrying one mutated RUNX2 allele show all the
hallmarks of CCD, like hypoplasia of the clavicles and
patent fontanels. When both copies of the RUNX2 gene
are inactivated, bone development cannot proceed be-
cause of a block in differentiation of the mesenchymal
precursor cells toward osteoblasts [40]. This shows that
RUNX2 gene is one of the main regulatory genes for
bone formation. Although RUNX2 is a key regulatory
gene for bone formation, low BMD is not one of the
main findings in CCD. In fact we can say that it is rarely
reported in CCD. In present report, patients II and III
have decreased BMD levels but patient I was normal
with regard to BMD. A remarkable point is that the two
patients with scoliosis also have low BMD levels. Thus it
is possible that there could be a correlation between
BMD and scoliosis; but of course this must be supported
with further research in more patients.
Many researchers have tried on this subject to find a
genotype-phenotype correlation in CCD [17]. However
there is no reliable data on this subject. Yoshida et al.
suggested that there is a correlation, inverse ratio, be-
tween height and the number of supernumerary teeth
[17]. However this correlation could not be supported in
subsequent studies. In our study, patient I had 29 im-
pacted teeth and was 183 cm in height (75 - 90 p). Pa-
tient II was 159 cm (<3 p) tall and had 23 impacted teeth.
Patient III was 156 cm (<3 p) tall and had 11 impacted
teeth. Patient I was the most severely affected sibling in
respect to supernumerary teeth but his height was in the
normal range (75 - 90 p). The other two patients had
fewer supernumerary teeth than patient I but their heights
were under 3P. Our report is not in agreement with Yo-
shida et al.’s suggestion [17].
The Runt-related transcription factor, RUNX, genes
are key regulators for bone [40] and hematopoietic
[41,42] formation. RUNX2 is a member of this family
and has a crucial role in bone formation [40]. This pro-
tein has several domains. These are; Q/A domain, the
length of this domain is important for the transcriptional
activity of RUNX2 [9,43]; Nuclear Localization Signal
(NLS), reponsible for the nuclear transportation of
RUNX2 protein [44]; the proline-serine-threonine Rich
Domain, essential for the transcriptional activity of
RUNX2 protein [45]; the last five amino acids of the
whole protein is known as the VWPRY motif. This motif
has a crucial role for the repression activity of Runt do-
main. The Runt domain is highly conserved peptide mo-
tif in all RUNX proteins in humans and other vertebrates.
It is the active DNA-binding site of RUNX proteins [16].
The Runt domain has two distinct repression activities,
one is dependent on intact VWRPY sequence and the
other is unrelated with this conserved sequence [46].
VWRPY-dependent repression activity needs co-rep-
ressor proteins and an intact VWRPY motif to reveal its
effect properly. The Groucho protein is the prototype of
the co-repressor family which was first defined in Dro-
sophila. Transducin-like enhancers of split (TLE) pro-
teins are human homologs of Groucho. As co-repressors,
Gro/TLE family of proteins does not bind to DNA di-
rectly. Instead, it interacts with the Runt domain and the
VWRPY motif of the Runt related transcription factors
Copyright © 2013 SciRes. OPEN ACCESS
A. E. Sekerci et al. / Open Journal of Stomatology 3 (2013) 402-410
408
like RUNX1 and RUNX2 to repress gene transcription.
For a consistent interaction between the Runt and
Gro/TLE protein, the C-terminal 49 amino acids of the
Runt domain and the conserved VWRPY motif are nec-
essary [18,46]. In addition, two translocations in Acute
Myeloid Leukemia, t (3; 21) and t (8; 21), cause rear-
rangement in the RUNX1 gene which is homolog of
RUNX2. As a result of these rearrangements, the fusion
protein maintains an intact Runt domain but loses the
VWRPY motif. Thus, it is predicted that fusion proteins
can be deficient with regard to TLE-mediated transcrip-
tional repression [47,48]. In experimental studies, the
WRPY tetra-peptide sequence was deleted from the
C-terminus and this showed that a mutant protein cannot
interact with Groucho whereas intact proteins can [46].
The mutation in this report is quite similar to this ex-
perimental study. The valine (V) amino acid in VWRPY
turns into glycine by a frame shift mutation. Until 2005,
there was no reported patient of mutation in VWPRY.
Napierala et al. [49] first identified the 1754_1757del
TTTG mutation (NM_0010 24630.2) in one patient. This
deletion results in a frame shift and stop codon p.
V585Gfs56X. Herein we report another three patients
affected by this mutation.
5. CONCLUSION
In conclusion, we can say that an intact VWRPY motif is
crucial for the transcriptional repression activity of
RUNX2 proteins and, as a result of mutation in the
VWRPY peptide sequence, the transcriptional repression
activity of the RUNX2 protein, which is essential for
osteogenesis, disappeared via the breaking interaction
between RUNX2 and TLE proteins. In the management
of CCD patients, a molecular genetic analysis would be
helpful. The clinician has a key role in identifying CCD
patients and arranging a mutation search by a genetic
counseling.
REFERENCES
[1] Marie, P. and Sainton P. (1898) Sur la dysostose cleido-
cranienne hereditaire. Revista de Neurología, 6, 835-838.
[2] Mundlos, S. (1999) Cleidocranial dysplasia: Clinical and
molecular genetics. Journal of Medical Genetics, 36,
177-182.
[3] Quack, I., Vonderstrass, B., Stock, M., Aylsworth. A.S.,
Becker, A., Brueton. L., et al. (1999) Mutation analysis
of core binding factor A1 in patients with cleidocranial
dysplasia. The American Journal of Human Genetics, 65,
1268-1278. http://dx.doi.org/10.1086/302622
[4] Figueroa, A.A. and Friede, H. (2000) Craniofacial growth
in unoperated craniofacial malformations. The Cleft Pal-
ate—Craniofacial Journal, 37, 431-432.
http://dx.doi.org/10.1597/1545-1569(2000)037<0431:CG
IUCM>2.0.CO;2
[5] Counts, A.L., Rohrer, M.D., Prasad, H. and Bolen, P.,
(2001) An assessment of root cementum in cleidocranial
dysplasia. The Angle Orthodontist, 71, 293-298.
[6] Roberts, T., Stephen, L. and Beighton, P. (2013) Cleido-
cranial dysplasia: A review of the dental, historical, and
practical implications with an overview of the South Af-
rican experience. Oral Surgery, Oral Medicine, Oral Pa-
thology and Oral Radiology, 115, 46-55.
http://dx.doi.org/10.1016/j.oooo.2012.07.435
[7] Dalessandri, D., Laffranchi, L., Tonni, I., Zotti, F., Pi-
ancino, M.G., Paganelli, C., et al. (2011) Advantages of
cone beam computed tomography (CBCT) in the ortho-
dontic treatment planning of cleidocranial dysplasia pa-
tients: A case report. Head & Face Medicine, 27, 6.
[8] Mohan, R.P., Suma, G.N., Vashishth, S. and Goel, S.
(2010) Cleidocranial dysplasia: Clinico-radiological il-
lustration of a rare case. Journal of Oral Science, 52, 161-
166. http://dx.doi.org/10.2334/josnusd.52.161
[9] Mundlos, S., Otto, F., Mundlos, C., Mulliken, J.B., Ayls-
worth, A.S., Albright, S., et al. (1997) Mutations involve-
ing the transcription factor CBFA1 cause cleidocranial
dysplasia. Cell, 89, 773-779.
http://dx.doi.org/10.1016/S0092-8674(00)80260-3
[10] Li, Y.L. and Xiao, Z.S. (2007) Advances in Runx2 regu-
lation and its isoforms. Medical Hypotheses, 68, 169-175.
http://dx.doi.org/10.1016/j.mehy.2006.06.006
[11] Shen, Z., Zou, C.C., Yang, R.W. and Zhao, Z.Y. (2009)
Cleidocranial dysplasia: Report of 3 cases and literature
review. Clinical Pediatrics, 48, 194-198.
http://dx.doi.org/10.1177/0009922808323107
[12] Li, Y., Pan, W., Xu, W., He, N., Chen, X., Liu, H., et al.
(2009) RUNX2 mutations in Chinese patients with clei-
docranial dysplasia. Mutagenesis, 24, 425-431.
http://dx.doi.org/10.1093/mutage/gep025
[13] Zhang, C., Zheng, S., Wang, Y., Zhao, Y., Zhu, J. and Ge,
L. (2010) Mutational analysis of RUNX2 gene in Chinese
patients with cleidocranial dysplasia. Mutagenesis, 25,
594. http://dx.doi.org/10.1093/mutage/geq044
[14] Wang, G.X., Sun, R.P. and Song, F.L. (2010) A novel
RUNX2 mutation (T420I) in Chinese patients with clei-
docranial dysplasia. Genetics and Molecular Research, 9,
41-47. http://dx.doi.org/10.4238/vol9-1gmr685
[15] Fang, C.Y., Xue, J.J., Tan, L., Jiang, C.H., Gao, Q.P.,
Liang, D.S. and Wu, L.Q. (2011) A novel single-base de-
letion mutation of the RUNX2 gene in a Chinese family
with cleidocranial dysplasia. Genetics and Molecular
Research, 10, 3539-3544.
http://dx.doi.org/10.4238/2011.December.14.5
[16] Ogawa, E., Maruyama, M., Kagoshima, H., Inuzuka, M.,
Lu, J., Satake, M., et al. (1993) PEBP2/PEA2 represents
a new family of transcription factor homologous to the
products of the Drosophila runt and the human AML1
gene. Proceedings of the National Academy of Sciences,
90, 6859-6863. http://dx.doi.org/10.1073/pnas.90.14.6859
[17] Yoshida, T., Kanegane, H., Osato, M., Yanagida, M.,
Miyawak, T., Ito, Y., et al. (2002) Functional analysis of
RUNX2 mutations in Japanese patients with cleidocranial
dysplasia demonstrates novel genotype-phenotype corre-
lations. The American Journal of Human Genetics, 71,
Copyright © 2013 SciRes. OPEN ACCESS
A. E. Sekerci et al. / Open Journal of Stomatology 3 (2013) 402-410 409
724-738. http://dx.doi.org/10.1086/342717
[18] Chen, G. and Courey, A.J. (2000) Groucho/TLE family
proteins and transcriptional repression. Gene, 249, 1-16.
http://dx.doi.org/10.1016/S0378-1119(00)00161-X
[19] Levanon, D., Goldstein, R.E., Bernstein, Y., Tang, H.,
Goldenberg, D., Stifani, S., et al. (1998) Transcriptional
repression by AML1 and LEF-1 is mediated by the
TLE/Groucho corepressors. Proceedings of the National
Academy of Sciences, 95, 11590-11595.
http://dx.doi.org/10.1073/pnas.95.20.11590
[20] Golan, I., Baumert, U., Hrala, B.P. and Mussig, D. (2003)
Dentomaxillofacial variability of cleidocranial dysplasia:
clinicoradiological presentation and systematic review.
Dentomaxillofacial Radiology, 32, 347-354.
http://dx.doi.org/10.1259/dmfr/63490079
[21] Quinn, P.D., Lewis, J. and Levin, L. (1992) Surgical
management of a patient with cleidocranial dysplasia: A
case report. Special Care Dentistry, 12, 131-133.
http://dx.doi.org/10.1111/j.1754-4505.1992.tb00429.x
[22] Alves, N. and De Caso, R. (2008) Cleidocranial dyspla-
sia—A case report. International Journal of Morphology,
26, 1065-1068.
http://dx.doi.org/10.4067/S0717-95022008000400043
[23] Fukuta, Y., Totsuka, M., Fukuta, Y., Takeda, Y., Yoshida,
Y., Niitsu, J., et al. (2001) Histological and analytical
studies of a tooth in a patient with Cleidocranial dysplasia.
Journal of Oral Science, 43, 85-89.
http://dx.doi.org/10.2334/josnusd.43.85
[24] McNamara, C.M., O’Riordan, B.C., Blake, M. and Sandy,
J.R. (1999) Cleidocranial dysplasia: Radiological ap-
pearances on dental panoramic radiography. Dentomax-
illofacial Radiology, 28, 89-97.
http://dx.doi.org/10.1038/sj.dmfr.4600417
[25] Winter. G.R. (1943) Dental conditions in cleidocranial
dysostosis. American Journal of Orthodontics and Oral
Surgery, 29, 61-89.
http://dx.doi.org/10.1016/S0096-6347(43)90045-6
[26] Jensen, B.L. and Kreiborg, S. (1990) Development of the
dentition in cleidocranial dysplasia. Journal of Oral Pa-
thology & Medicine, 19, 89-93.
http://dx.doi.org/10.1111/j.1600-0714.1990.tb00803.x
[27] Kalliala, E. and Taskinen, P.J. (1962) Cleidocranial dy-
sostosis: Report of six typical cases and one atypical case.
Oral Surgery, Oral Medicine, Oral Pathology and Oral
Radiology, 14, 808.
http://dx.doi.org/10.1016/0030-4220(62)90331-6
[28] Goto, T., Aramaki, M., Yoshihashi, H., Nishimura, G.,
Hasegawa, Y., Takahashi. T., et al. (2004) Large fontan-
els are a shared features of haploinsufficiency of RUNX2
and its coactivator CBFB. Congenital Anomalies, 44,
225-229.
http://dx.doi.org/10.1111/j.1741-4520.2004.00043.x
[29] Becker, A., Lustman, J. and Shteyer, A. (1997) Cleido-
cranial dysplasia: Part 1-General principles of the ortho-
dontic and surgical treatment modality. American Journal
of Orthodontics and Dentofacial Orthopedics, 111, 28-33.
http://dx.doi.org/10.1016/S0889-5406(97)70298-1
[30] D’Alessandro, G., Tagariello, T. and Piana, G. (2010)
Craniofacial changes and treatment of the stomatognathic
system in subjects with cleidocranial dysplasia. European
Journal of Paediatric Dentistry, 11, 39-43.
[31] Smylski, P.T., Woodside, D.G. and Harnett, B.E. (1974)
Surgical and orthodontic treatment of cleidocranial dy-
sostosis. International Journal of Oral Surgery, 3, 380-
385. http://dx.doi.org/10.1016/S0300-9785(74)80002-5
[32] Hall, R.K. and Hyland, A.L. (1978) Combined surgical
and orthodontic management of the oral abnormalities in
children with cleidocranial dysplasia. International Jour-
nal of Oral Surgery, 7, 267-273.
http://dx.doi.org/10.1016/S0300-9785(78)80093-3
[33] Richardson, A. and Swinson, T. (1987) Combined ortho-
dontic and surgical approach to cleidocranial dysostosis.
Transactions European Orthodontic Society, 63, 23.
[34] Behlfelt, K. (1987) Cleido-cranial dysplasia: Diagnosis
and treatment concept. Transactions European Ortho-
dontic Society, 63, 25.
[35] Petropoulos, V.C., Balshi, T.J., Balshi, S.F., et al. (2004)
Treatment of a patient with cleidocranial dysplasia using
osseointegrated implants: A patient report. The Interna-
tional Journal of Oral & Maxillofacial Implants, 19, 282-
287.
[36] Kelly, E. and Nakamoto, R.Y. (1974) Cleidocranial dy-
sostosis—A prosthodontic problem. Journal of Prosthetic
Dentistry, 31, 518-526.
http://dx.doi.org/10.1016/0022-3913(74)90173-5
[37] Daskalogiannakis, J., Piedade, L., Lindholm, T.C., Sán-
dor, G.K. and Carmichael, R.P. (2006) Cleidocranial
Dysplasia: 2 Generations of management. Journal of the
Canadian Dental Association, 72, 337-342.
[38] Sato, K., Sugawara, J., Mitani, H. and Kawamura, H.
(1998) Use of selectively colored stereolithography for
diagnosis of impacted supernumerary teeth for a patient
with cleidocranial dysplasia. The International Journal of
Adult Orthodontics & Orthognathic Surgery, 13, 163-167.
[39] Golan, I., Preising, M., Wagener, H., Baumert, U., Nied-
erdellmann, H., Lorenz, B. and Mussig, D. (2000) A
novel missense mutation of the CBFA1 gene in a family
with cleidocranial dysplasia (CCD) and variable expres-
sivity. Journal of Craniofacial Genetics and Develop-
mental Biology, 20, 113-120.
[40] Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki,
K., Deguchi, K., Shimizu, Y., et al. (1997) Targeted dis-
ruption of Cbfa1 results in a complete lack of bone for-
mation owing to maturational arrest of osteoblasts. Cell,
89, 755-764.
http://dx.doi.org/10.1016/S0092-8674(00)80258-5
[41] Okuda, T., van Deursen, J., Hiebert, S.W., Grosveld, G.
and Downing, J.R. (1996) AML1, the target of multiple
chromosomal translocations in human leukemia, is essen-
tial for normal fetal liver hematopoiesis. Cell, 84, 321-
330. http://dx.doi.org/10.1016/S0092-8674(00)80986-1
[42] Speck, N.A., Stacy, T., Wang, Q., North, T., Gu, T.L.,
Miller, J., Binder, M., et al. (1999) Core-binding factor:
A central player in hematopoiesis and leukemia. Cancer
Research, 59, 1789-1793.
[43] Thirunavukkarasu, K., Mahajan, M., McLarren, K.W.,
Copyright © 2013 SciRes. OPEN ACCESS
A. E. Sekerci et al. / Open Journal of Stomatology 3 (2013) 402-410
Copyright © 2013 SciRes.
410
OPEN ACCESS
Stifani, S. and Karsenty, G. (1998) Two domains unique
to osteoblast-specific transcription factor Osf2/Cbfa1
contribute to its transactivation function and its inability
to heterodimerize with Cbfbeta. Molecular and Cellular
Biology, 18, 4197-4208.
[44] Kanno, T., Kanno, Y., Chen, L.F., Ogawa, E., Kim, W.Y.
and Ito, Y. (1998) Intrinsic transcriptional activation-inhi-
bition domains of the polyomavirus enhancer binding
protein 2/core binding factor alpha subunit revealed in the
presence of the beta subunit. Molecular and Cellular Bi-
ology, 18, 2444-2454.
[45] Zhang, Y.W., Yasui, N., Ito, K., Huang, G., Fuji, M.,
Hanai, J., et al. (2000) A RUNX2/PEBP2alpha A/CBFA1
mutation displaying impaired transactivation and Smad
interaction in cleidocranial dysplasia. Proceedings of the
National Academy of Sciences, 7, 10549-10554.
http://dx.doi.org/10.1073/pnas.180309597
[46] Aronson, B.D., Fisher, A.L., Blechman, K., Caudy, M.
and Gergen, J.P. (1997) Groucho-dependent and inde-
pendent repression activities of Runt domain proteins.
Molecular and Cellular Biology, 17, 5581-5587.
[47] Miyoshi, H., Shimizu, K., Kozu, T., Maseki, N., Kaneko,
Y. and Ohki, M. (1991) t(8;21) breakpoints on chromo-
some 21 in acute myeloid leukemia are clustered within a
limited region of a single gene, AML1. Proceedings of
the National Academy of Sciences, 88, 10431-10434.
http://dx.doi.org/10.1073/pnas.88.23.10431
[48] Nucifora, G., Birn, D.J, Erickson. P., Gao, J., LeBeau,
M.M., Drabkin, H.A., et al. (1993) Detection of DNA re-
arrangements in the AML1 and ETO loci and of an
AML1/ETO fusion mRNA in patients with t(8;21) acute
myeloid leukemia. Blood, 81, 883-888.
[49] Napierala, D., Garcia-Rojas, X., Sam, K., Wakui, K.,
Chen, C., Mendoza-Londono, R., et al. (2005) Mutations
and promoter SNPs in RUNX2, a transcriptional regula-
tor of bone formation. Molecular Genetics and Metabo-
lism, 86, 257-268.
http://dx.doi.org/10.1016/j.ymgme.2005.07.012.