Molecular Characterization, 3D Modeling of Grass Carp Interleukin-10 Receptor 1 (IL10R1)

doi:10.4236/eng.2013.510B045

Paper Menu >>

Journal Menu >>

Engineering, 2013, 5, 214-219

http://dx.doi.org/10.4236/eng.2013.510B045 Published Online October 2013 (http://www.scirp.org/journal/eng)

Molecular Characterization, 3D Modeling of Grass Carp

Interleukin-10 Receptor 1 (IL10R 1 )

He Wei, Shangnian Wang, Lei Qin, Xinyan Wang, Hong Zhou

School of Life Science and Technology, University of Electronic Science and Technology of China,

Chengdu, China

Email: [email protected]

Received June 2013

ABSTRACT

Interleukin-10 (IL-10) is an important cytokine that plays a pivotal role in natural and adaptive immune systems. How-

ever, in lower vertebrates, especially in teleost the receptor of this cytokine is still largely unknown. This paper de-

scribed the cloning and characterization of grass carp interleukin-10 receptor 1 (gcIL10R1) and the 3D structure of its

extracellular domain was predicted. The gcIL10R1 cDNA included 180 bp 5’ untranslated region (UTR), 870 bp 3’

UTR and an open reading frame (ORF) of 1632 bp. The ORF was found to encode a 543 amino acid protein with a put-

ative JAK1 binding site, one STAT3 binding site. The phylogenetic analysis clusters gcIL10R1 with other teleost

IL10R1s but independently of the amphibian, avian and mammalian IL10R1s. The 3D structure of its extracellular do-

main was the first homology model of a fish IL10R1 that revealed a high similarity with its mammalian and avian

counterparts.

Keywords: Grass Carp; Interleukin-10 Receptor 1; Structure Characterization; 3D Modeling

1. Introduction

Interleukin-10 (IL-10) was first described as an activity

production by mouse Th2 cells that inhibited activation

and cytokine production by Th1 cells [1]. Since its dis-

covery, the biological effects of IL-10 were intensively

investigated in mammals . Known as a cytokine inhibito-

ry factor, the predominant functio n of IL-10 is r egulating

immune responses through direct or indirect effects on

many cell types, including macrophage/monocytes, T

cells, B cells, APCs, and NK cells [2-4]. IL-10 inhibits

the release of pro-inflammatory cytokines like TNF-α,

IL-1β, IL-6, and IL-8 from monocytes/macrophage [5,6].

Moreover, IL-10 inhibits IL-12 synthesis in dentritic

cells [7]. IL-10 also deduces the secretion of IL-23 by

macrophage and IFN-γ production in Th1 cells [8,9]. Our

previous study has identified grass carp IL-10 and inves-

tigated its function in grass carp peripheral blood leuko-

cytes [10].

IL-10 signaling initiates by binding of the ligand to its

specific cell surface receptor. In mammals, the IL-10

receptor complex is composed of two different chains,

IL10R1 and IL10R2. IL10R1 is the ligand-binding sub-

unit and IL10R2 is the accessory subunit which helps

IL-10 signaling transduction. IL10R2 is also part of re-

ceptor complexes of other ligands [11]. IL10R1 was first

be cloned in 1993 [12]. It belongs to the class II cytokine

receptor family whose extracellular domain form fibro-

nectin type III domain that has several conserved amino

acid positions that are important for their secondary

structure [13]. The fibronectin type III domain also exists

in the extracellular region of mammalian IFN-γ receptor

alpha chain [14]. When IL-10 binds to its receptor com-

plex, JAK-STAT signaling pathway is activated and sig-

naling transducer of activation 3 (STAT3) is phosphory-

lated by Janus kinases, JAK1 and Tyk2 [15].

IL-10 genes have been isolated and characterized from

many non-mammalian species, like chicken (Gallus gal-

lus) [16], frog (Xenopus tropicalis) [17], fugu (Fugu ru-

bripes) [18], common carp (Cyprinus carpio L.) [19],

rainbow trout (Oncorhynchus mykiss) [20], zebrafish

(Danio rerio) [21] and grass carp [10] by comparative

genomic analysis or by PCR-mediated homology cloning.

Increasing number of reports described fish IL-10, but

little is known about the IL-10 receptors in teleost. To

date, IL10R1 has only been identified in zebrafish and

goldfish [22] by gene synteny ana lysis.

In this investigation, IL10R1 cDNA has been identi-

fied and characterized from grass carp. The 3D model of

extracellular domain of gcIL10R1 protein was predicted,

representing the first 3D analysis of the quaternary

structure of a fish IL10R1, which provides the basis for

further investigation of the IL-10 signaling in teleo s t.

H. WEI ET AL.

215

2. Material and Methods

2.1. Animals

The 1-year-old Chinese grass carp (Ctenopharyngodon

idellus) with 1 - 1.5 kg body weigh were obtained from

Chengdu Tongwei Aquatic Science and Technology

Company. An acclimation period of two weeks was ob-

served prior to the experiments commencing. Tissues for

cloning of IL-10R2 were taken from freshly killed fish

according to the Regulation of Animal Use in Sichuan

province, China.

2.2. RNA Extraction and cDNA Synthesis

Total RNA was extracted from grass carp spleen with

Tripure Reagent (Roche, Basel, Switzerlan) according to

the manufacturer’s instructions. After extraction of total

RNA, five μg was reverse transcribed to cDNA using

Superscript II reverse transcriptase (Invitrogen, Carlsbad,

CA) with oligo d(T)18 pr ime r .

2.3. Cloning of Grass Carp IL10R1

Partial cDNA sequence of the grass carp IL10R1 gene

was obtained by PCR using the primers IL10R1F and

IL10R1R (Table 1), which was designed basing on the

conserved regions of goldfish and zebrafish IL10R1s.

PCR was performed with one cycle of incubation at 94˚C

for 3 min, followed by 35 cycles at 94˚C for 30 s, 58˚C

for 30 s and 72˚C f or 1min with a final cycle at 72˚C for

10 min. To obtain the complete grass carp IL10R1 se-

quence, 5’ and 3’ RACE techniques were used to obtain

the 5’ and 3’-end sequences of grass carp IL1 0R1 cDN A.

Referring to the nucleotide sequence of the partial se-

quenced grass carp IL10R1 cDNA, gene-specific primers

were designed for 3’ and 5’-RACE (Table 1), and PCR

was performed with a GeneRacer Kit (Invitrogen) ac-

cording to the protocol.

2.4. Sequence Analysis and Phylogeny Analysis

The full cDNA sequence and deduced amino acid se-

quence of IL-10 were analyzed using BLAST program

from NCBI and the ExPASy Molecular Biology server

Table 1. Oligonucleotide primers used to amplify grass carp

IL10R1.

Name

Sequence (5’to 3’)

object

IL10R1F

ATATGGGAGGGAATGTAACTG

partial

IL10R1R

TCCTGGTTTTGCACCACATGC

IL10R1-5N1

TCACCATCTTATCATCATCATC

5’-race

IL10R1-5N2

CTTTCTGTGAATTTTAACCTTC

IL10R1-3N1

TCAGCAGTGGAAGAAGAAGC

3’-race

IL10R1-3N2

GATGGATATCGTAGTCAGAG

(http://us.expasy.org). The multiple alighments were

made using DNAMAN software (Lynnon Biosoft, Pointe-

Claire, Canada). The molecular mass and isoelectric

point of the putative grass carp IL10R1 were predicted

using Compute PI/Mw tool at the ExPASy

(http://www.expasy.c-h/). The deduced signal peptide

was predicted using SignalP [23] and the transmembrane

regions were predicted using the TMHMM Server v. 2.0

(http://www.cbs.dtu.dk/ser vices/T-HMM/). The fibro-

nectin type III domain and the immunoglobulin-like fold

of the grass carp IL10R1 were predicted using the Inter-

Pro Scan online server

(http://www.ebi.ac.uk/Too ls /pfa/ip-rscan/). The putative

N-glycosylation sites of the grass carp IL10R1 were de-

termined using the NetNGlyc Server v. 1.0

(http://www.cbs.dtu.dk/-services/netnglyc/). Phylogenetic

trees were constructed using MEGA3.1 software [24].

The genetic distance between species was calculated us-

ing ρ−distance method. The cladogram was generated

using the neighbor-joining (NJ) method. In the analysis,

the gaps were deleted, and a 1000 bootstrap procedure

was used to test the robustness of the node on the trees.

2.5. 3D Modeling

Two suitable structural templates for grass carp IL10R1

extracellular domain, chicken IFN-γ receptor alpha chain

extracellular domai n s and human IFN-γ receptor alpha

chain extracellular domain were identified by a BLAST

search as implemented in the SWISS-MODEL Protein

Modelling Server (http://www.isb-sib.ch/ ). The automat-

ic sequenc-e alignment thus obtained was used for ho-

mology modeling with SWISS-MODEL. The resulting

theoretical model of a protein monomer was displayed

and analyzed with Swiss-PDB Viewer. Models pictures

were obtained using the PyMOL program

(http://www.pymol.sour c efor-ge.net/index.html).

3. Results

3.1. Molecular Cloning and Sequence Analysis

of Grass Carp IL10R1

By using the primers which were designed on the basis

of the conserved region of the known fish IL10R1 se-

quences and 5’ and 3’ RACE, we got the cDNA se-

quences of grass carp IL10R1 (Figure 1). The gcIL-

10R1 shared 73% homology with amino acid sequence

of goldfish IL10R1, and gcIL10R1 protein had conserved

four cysteine residues as well as partially conserved hy-

drophobic residues, suggesting importance in the st ruc-

tural integrity and receptor-ligand interactions. The

gcIL10R1 protein had a putative fibronectin type III do-

main, an immunoglobin-like fold and several predicted

N-glycosylation sited. Its sequence also bared putative

H. WEI ET AL.

216

Figure 1. Nucleotide and deduced amino acid sequences of

grass carp IL10R1.

JAK1 (SVLLFKK) and STAT3 (YXXQ) binding sites.

The identified gcIL10R1 possessed one STAT3 binding

site (Figure 2). Furthermore, like other fish, the C-ter-

minal serine-rich areas were present in gcIL10R1 protein,

which proposed to be essential for the immunosuppres-

sive effects of the mammalian IL10R1 [25].

Phylogenetic analysis of gcIL10R1 proteins demon-

strated their close relationship with the zebrafish and

goldfish IL10R1s. The IL10R1 proteins of the abov e fish

species branched independently to the IL10R1s of other

vertebrates, while the amphibian and avian IL10R 1s also

branched independently from the IL10R1 of mammals

(Figure 3).

3.2. 3D Modeling

The structure of gcIL10R1 extracellular domain which

was for ligand binding was predicted by comparative

modeling using the extracellular domains of chicken

IFN-γ receptor alpha chain (PDB id: 4EQ3) and human

IFN-γ receptor alph a chain (PDB id: 3S8W) as template.

The homology model of grass carp IL10R1 has thr ee-

helix and several beta strands (Figure 4). The alignment

used in the model shows a high similarity (75%) between

the target molecular and comparing extracellular do-

mains of human and chicken IFN-γ receptor alpha chain.

4. Discussion

In the present study, IL10R1 cDNA was cloned and cha-

racterized. For gcIL10R1, an open reading frame of 1632

bp was found to encode a 543 amino acid protein. The

putative grass carp IL10R1 is a 60016 molecular mass

polypeptide with a pI of 4.5. The gcIL10R1 shares high

homology with amino acid sequence of other known te-

leost IL10R1. Analysis of gcIL10R1 sequence revealed

the conserved putative JAK1 and STAT3 binding sites.

JAK1 binding sites on the mammalian IL10R1 were

identified in a region consisting of four core hydrophobic

residues [26,27], comprising of the SVLLFKK motif on

the human IL10R1. Our analysis of gcIL10R1 revealed

that this region has been partially conserved evolutiona-

rily, with gcIL10R1 proteins exhibiting the AVLKSAV

motif in the corresponding region. The STAT3 binding

motif (YXXQ), present on the mammalian IL10R1 is

indispensable to IL-10 function [28,29]. This motif ap-

pears to have been evolutionarily conserved across ver-

tebrate IL10R1 proteins including teleost. Ho wev er,

while the amphibian, avian and mammalian IL10R1 pro-

teins possess two potential STAT3 binding sites, the

grass carp and other teleost IL10R1 proteins appear to

only have one putative STAT3 docking site. It will be

interesting to learn the significance of having one rather

than two STAT3 binding sites.

The predicted 3D structure for the gcIL10R1 extracel-

lular domain revealed a high similarity with IFN-γ re-

ceptor alpha chain. Since IL-10 has similar structure with

IFN-γ [14], our results indicated that gcIL10R1 is suita-

ble for binding with grass carp IL-10.

Our studies cloned and analy zed the gcIL10R1 and its

3D structure was modeled. Those results suggested

gcIL10R1 is structurally similar to its counterpart in

mammals or avian, which pave the way for further inves-

tigation on IL-1 0 s ignaling in fish.

H. WEI ET AL.

217

Figure 2. Alignment of the amino acid sequence of grass carp IL10R1 with other homologues. The conserved cysteine resi-

dues are denoted by *. Conserved hy drophobi c residues are denoted by arr ows. The pr edicted gly cosylati on sites are denot ed

by overhead Y. The IL10R1 fibronectin type III domain and immunoglobin fold are indicated by an overhead line. Potential

JAK1 and STAT binding site s are boxed.

H. WEI ET AL.

218

Figure 3. Phylogenetic analysis of the IL10R1. An unrooted

phylogenetic tree constructed by the neighbor joining me-

thod using MEGA software from the amino acid sequences

of IL10R1s. Grass carp IL-10R1 was boxed. The numbers

indicate the bootstrap confidence values obtained for each

node after 1000 replications. The accession numbers of the

sequences used in the alignment and in Figure 2 are as fol-

lows: Human IL10R1:NP_001549, Monkey IL10R1: XP_

001092736, Pig IL10R1: XP_003129938, Mouse IL10R1:

NP_032374, Frog IL10R1: AAI59332, Chicken IL10R1:

NP_001034686, Turkey IL10R1:XP_003212786, Goldfish

IL10R1: JN203498, Zebrafish IL10R1: NP_001071093,

Grass carp: KF129394.

Figure 4. Homology modeling of grass carp IL10R1. Yellow

arrows represent beta strands, red arrows represent alpha

helices.

5. Acknowledgements

This work was supported by grant from the National

Natural Science Foundation of China (31101877).

REFERENCES

[1] D. F. Fiorentino, M. W. Bond and T. R. Mosmann, “Two

Types of Mouse T Helper Cell. IV. Th2 Clones Secrete a

Factor That Inhibits Cytokine Production by T h1 Clones,”

The Journal of Experimental Medicine, Vol. 170, 1989,

pp. 2081-2095.

http://dx.doi.org/10.1084/jem.170.6.2081

[2] D. F. Fiorentino, A. Zlotnik, P. Vieira, T. R. Mosmann,

M. Howard, K. W. Moore and A. O’Garra, “IL-10 Acts

on the Antigen-Presenting Cell to Inhibit Cytokine Pro-

duction by Th1 Cells,” The Journal of Immunology, Vol.

146, 1991, pp. 3444-3451.

[3] L. Ding and E. M. Shevach, “IL-10 Inhibits Mitogen-

Induced T Cell Proliferation by Selectively Inhibiting

Macrophage Costimulatory Function,” The Journal of

Immunology, Vol. 148, 1992, pp. 3133-3139.

[4] C. A. Akdis and K. Blaser, “Mechanisms of Interleukin-

10-Mediated Immune Suppression,” The Journal of Im-

munology, Vol. 103, 2001, pp. 131-136.

http://dx.doi.org/10.1046/j.1365-2567.2001.01235.x

[5] R. de Waal Malefyt, J. Abrams, B. Bennett, C. G. Figdor

and J. E. de Vries, “Interleukin 10(IL-10) Inhibits Cyto-

kine Synthesis by Human Monocytes: An Autoregulatory

Role of IL-10 Produced by Monocytes,” The Journal of

Experimental Medicine, Vol. 174, 1991, 1991, pp. 1209-

1220. http://dx.doi.org/10.1084/jem.174.5.1209

[6] D. F. Fiorentino, A. Zlotnik, T. R. Mosmann, M. Howard

and A. O’Garra, “IL-10 Inhibits Cytokine Production by

Activated Macrophages,” The Journal of Immunology,

Vol. 147, 1991, 1991, pp. 3815-3822.

[7] A. D’Andrea, M. Aste-Amezaga, N. M. Valiante, X. Ma,

M. Kubin and G. Trinchieri, “Interleukin 10 (IL-10) Inhi-

bits Human Lymphocyte Interferon Gamma-Production

by Suppressing Natural Killer Cell Stimulatory Factor/

IL-12 Synthesis in Accessory Cells,” The Journal of Ex-

perimental Medicine, Vol. 178, 1993, pp. 1041-1048.

http://dx.doi.org/10.1084/jem.178.3.1041

[8] A. Billiau and P. Matthys, “Interferon-Gamma: A Histori-

cal Perspective,” Cytokine & Growth Factor Reviews,

Vol. 20, 2009, pp. 97-113.

http://dx.doi.org/10.1016/j.cytogfr.2009.02.004

[9] N. Schuetze, S. Schoeneberger, U. Mueller, M. A. Freu-

denberg, G. Alber and R. K. Straubinger, “IL-12 Family

Members: Differential Kinetics of Their TLR4-Mediated

Induction by Salmonella enteritidis and the Impact of

IL-10 in Bone Marrow-Derived Macrophages,” Interna-

tional Immunology, Vol. 17, 2005, pp. 649-659.

http://dx.doi.org/10.1093/intimm/dxh247

[10] H. Wei, M. Yang, T. Zhao, X. Wang and H. Z hou , “Func-

tional Expression and Characterization of Grass Carp

IL-10: An Essential Mediator of TGF-Beta1 Immune

Regulation in Peripheral Blood Lymphocytes,” Molecular

Immunology, Vol. 53, 2013, pp. 313 -320.

http://dx.doi.org/10.1016/j.molimm.2012.08.021

[11] G. Lutfalla, K. Gardine r and G. U ze, “A New Member of

the Cytokine Receptor Gene Family Maps on Chromo-

some 21 at Less than 35 kb from IFNAR,” Genomics, Vol.

16, 1993, pp. 36 6-373.

http://dx.doi.org/10.1006/geno.1993.1199

[12] A. S. Ho, Y. L iu, T. A. Khan, D. H. Hsu, J. F. Bazan and

K. W. Moore, “A Receptor for Interleukin 10 Is Related

H. WEI ET AL.

219

to Interferon Receptors,” Proceedings of the National

Academy of Sciences of the United States of America, Vol.

90, 1993, pp. 11267-1171.

http://dx.doi.org/10.1073/pnas.90.23.11267

[13] S. V. Kotenko, “The Family of IL-10-Related Cytokines

and Their Receptors: Related, but t o What Extent?” Cyto-

kine & Growth Factor Reviews, Vol. 13, 2002, pp. 223-

240. http://dx.doi.org/10.1016/S1359-6101(02)00012-6

[14] M. R. Walter, W. T. Windsor, T. L. Nagabhushan, D. J.

Lundell, C. A. Lunn, P. J. Zauodny and S. K. Narula,

“Crystal Structure of a Complex between Interferon-

Gamma and Its Soluble High-Affinity Receptor,” Nature,

Vol. 376, 1995, pp. 230-235.

http://dx.doi.org/10.1038/376230a0

[15] R. M. Weber-Nordt, J. K. Riley, A. C. Greenlund, K. W.

Moore, J. E. Darnell and R. D. Schreiber, “Stat3 Re-

cruitment by Two Distinct Ligand-Induced, Tyrosine-

Phosphorylated Docking Sites in the Interleukin-10 Re-

ceptor Intracellular Domain,” The Journal of Biological

Chemistry, Vol. 271, 1996, pp. 27954-27961.

http://dx.doi.org/10.1074/jbc.271.44.27954

[16] L. Rothwell, J. R. Young, R. Zoorob, C. A. Whittaker, P.

Hesketh, A. Archer, A. L. Smith and P. Kaiser, “Cloning

and Characterization of Chicken IL-10 and Its Role in the

Immune Response to Eimeria maxima,” The Journal of

Immunology, Vol. 173, 2004, pp. 2675-2682.

[17] M. Chadzinska, E. Kolaczkowska, A. Scislowska-Czar-

necka, N. Van Rooijen and B. Plytycz, “Effects of Ma-

crophage Depletion on Peritoneal Inflammation in Swiss

Mice, Edible Frogs and Goldfish,” Folia Biologica (Kra-

kow), Vol. 52, 2004, pp. 225-231.

http://dx.doi.org/10.3409/1734916044527557

[18] J. Zou, M. S. Clark and C. J. Secombe s, “Characterisation,

Expression and Promoter Analysis of an Interleukin 10

Homologue in the Puffer Fish, Fugu rubripes,” Immuno-

genetics, Vol. 55, 2003, pp. 325-335.

http://dx.doi.org/10.1007/s00251-003-0580-y

[19] R. Savan, D. Igawa and M. Sakai, “Cloning, Characteri-

zation and Expression Ana lysi s of Interleukin-10 from the

Common Carp, Cyprinus carpio L.,” European Journal

of Biochemistry, Vol. 270, 2003, pp. 4647-4654.

http://dx.doi.org/10.1046/j.1432-1033.2003.03854.x

[20] Y. Inoue, S. Kamot a, K. Ito, Y. Yoshiura, M. Ototake, T.

Moritomo and T. Nakanishi, “Molecular Cloning and Ex-

pression Analysis of Rainbow Trout (Oncorhynchus my-

kiss) Interleukin-10 cDNAs,” Fish and Shellfish Immu-

nology, Vol. 18, 2005, pp. 335-344.

http://dx.doi.org/10.1016/j.fsi.2004.08.004

[21] D. C. Zhang, Y. Q. Shao, Y. Q. Huang and S. G. Jiang,

“Cloning, Characterization and Expression Analysis of

Interleukin-10 from the Zebrafish (Danio rerion),” Jour-

nal of Biochemistry and Molecular Biology, Vol. 38,

2005, pp. 571-576.

http://dx.doi.org/10.5483/BMBRep.2005.38.5.571

[22] L. Grayfer and M. Belosevic, “Identification and Mole-

cular Characterization of the Interleukin-10 Receptor 1 of

the Zebrafish (Danio rerio) and the Goldfish (Carassius

auratus L.),” Developmental & Comparative Immunology,

Vol. 36, 2012, pp. 408-417.

http://dx.doi.org/10.1016/j.dci.2011.08.006

[23] J. D. Bendtsen, H. Ni elsen, G. von Heijne and S. Brunak,

“Improved Prediction of Signal Peptides: SignalP 3.0,”

Journal of Molecular Biology, Vol. 340, pp. 783-795.

http://dx.doi.org/10.1016/j.jmb.2004.05.028

[24] S. Kumar, K. Tamura and M. Nei, “MEGA3: Integrated

Software for Molecular Evolutionary Genetics Analysis

and Sequence Alignment,” Briefings in Bioinformatics,

Vol. 5, 2004, pp. 150-163.

http://dx.doi.org/10.1016/j.jmb.2004.05.028

[25] J. Reboul, K. Gardiner, D. Monneron, G. Uze and G.

Lutfalla, “Comparative Genomic Analysis of the interfe-

ron/Interleukin-10 Receptor Gene Cluster,” Genome Re-

search, Vol. 9, 1999, pp. 242-250.

[26] A. Usacheva, R. Sandoval, P. Domanski, S. V. Kotenko,

K. Nelms, M. A. Goldsmith and O. R. Colamonici, “Con-

tribution of the Box 1 and Box 2 Motifs of Cytokine Re-

ceptors to Jak1 Association and Activation,” The Journal

of Biological Chemistry, Vol. 277, 2002, pp. 48220-

48226. http://dx.doi.org/10.1074/jbc.M205757200

[27] A. Usacheva, S. Kotenko, M. M. Witte and O. R. Cola-

monici, “Two Distinct Domains within the N-Terminal

Region of Janus Kinase 1 Interact with Cytokine Recep-

tors,” The Journal of Immunology, Vol. 169, 2002, pp.

1302-1308.

[28] A. M. O’Farrell, Y. Liu, K. W. Moore and A. L. Mui,

“IL-10 Inhibits Macrophage Activation and Proliferation

by Distinct Signaling Mechanisms: Evidence for Stat3-

Dependent and -Independent Pathways,” EMBO Journal,

Vol. 17, 1998, pp. 1006-1018.

http://dx.doi.org/10.1093/emboj/17.4.1006

[29] J. K. Riley, K. Takeda, S. Akira and R. D. Schreiber,

“Interleukin-10 Receptor Signaling through the JAK-

STAT Pathway. Requirement for Two Distinct Receptor-

Derived Signals for Anti-Inflammatory Action,” The Jour-

nal of Biological Chemistry, Vol. 274, 1999, pp. 16513-

16521. http://dx.doi.org/10.1074/jbc.274.23.1651