Advances in Bioscience and Biotechnology, 2011, 2, 13-19 ABB
doi:10.4236/abb.2011.21003 Published Online February 2011 (http://www.SciRP.org/journal/abb/).
Published Online February 2011 in SciRes. http://www.scirp.org/journal/ABB
A versatile vector system for generating recombinant
EGFP-tagged proteins in yeast
Francesco Palma, Laura Chiarantini
Dipartimento di Scienze Biomolecolari, Sezione di Biochimica e Biologia Molecolare “Giorgio Fornaini”. Università degli Studi di
Urbino “Carlo Bo”, 2–61029, Via Saffi, Urbino, Italy.
Received 5 November 2010; revised 20 November 2010; accepted 26 November 2010.
ABSTRACT
This paper reports a versatile egfp-tagged pFL61-
based expression vector system which allows the
production on yeast of homo- and heterologous pro-
teins fused with the Enhanced Green Fluorescent
Protein (EGFP) at the C-terminus. This expression
system, which involves a fluorescent protein, readily
allows both to verify the expression and to localize
the protein in the yeast cell. The vector carries a Not I
site upstream the first codon of the egfp gene. The
yeast cells harbouring this plasmid emit a feeble
emission compared to the fluorescence expected. Was
then investigated the effect of the Not I site, located
very close to the start codon, on the expression of the
reporter egfp gene using northern and western blot-
ting, fluorescence microscopy and flow cytometry.
Data indicated that this palindromic site could hide
the start codon so as to negatively affect translation.
This aspect confers to the proposed expression system
an advantage in distinguishing clones after transfor-
mation.
Keywords: Enhanced GFP; Protein Localization; Tuber
borchii Vittad; Saccharomyces cerevisiae
1. INTRODUCTION
Green fluorescent protein (GFP), a 238-amino acid
polypeptide, is intrinsically fluorescent, thus not requir-
ing substrates or co-factors to produce a green emission
when excited with near UV light or blue light [1]. GFP
has been used as a reporter gene in various organisms,
including Escherichia coli, Caernorhabditis elegans,
Drosophila melanogaster, Saccharomyces cerevisiae,
Aedes aegypti, fish, viruses, mammals and plants [1-7].
Unlike the bacterial β-galactosidase and β-glucuro-
nidase, which are widely used reporters in fungi, GFP
does not rely on exogenous substrates or co-factors other
than oxygen [8]. Therefore, GFP can be used as a fusion
tag “in vivo” to localize proteins, to follow their move-
ment, or to study the dynamics of the sub-cellular com-
partments which target these proteins [1,9]. Since
wild-type GFP performs inefficiently in various cellular
contexts, efforts were focused upon the improvement of
GFP expression and/or fluorescence levels.
The enhanced GFP (EGFP) is a red-shifted variant of
the wild-type [1,8,10] optimised for brighter green fluo-
rescence: the emission spectrum (emission maximum =
507 nm) is 35 times more intense than that of GFP on
excitation with blue light (excitation maximum = 488
nm) [11,12].This variant contains the double-amino-acid
substitution of Phe-64 to Leu, Ser-65 to Thr and several
silent base changes which optimize codon usage for
mammals [13], other variants optimised for fungi
YEGFP, plant SGFP [5] and green alga CGFP [14] have
been reported.
EGFP expression in yeast cells produces a diffuse cy-
toplasmic and nuclear fluorescence pattern which can be
observed in both fixed and living transformed cells [15].
Complementation of yeast mutation used to clone
genes from heterologous species has been a general ap-
proach in molecular biology. For example, the yeast
mutant rtf1-1, defective in cell cycle progression and
arrests before mitosis was functionally complemented by
human p53 [16]. Furthermore, the yeast two-hybrid sys-
tem has been widely used to study protein-protein inter-
action and EGFP evaluated as an alternative reporter
gene for detection by flow cytometry [17].
The PFL61 is a shuttle vector used in complementa-
tion of Saccharomyces cerevisiae auxotropic mutant by
heterologous cDNAs. This vector contains the phosphor-
glycerate kinase promoter (PGK) separated by its termi-
nator by a Not I site [18].
We have engineered this vector to obtain a versatile
expression system which allows C-terminal fusion of the
egfp gene to a hexogenous gene of interest to generate
fusion protein whose subcellular localisation can be fol-
lowed with fluorescence microscopy in living yeast
F. Palma et al. / Advances in Bioscience and Biotechnology 2 (2011) 13-19
Copyright © 2011 SciRes. ABB
14
cells.
In this study, we demonstrate the successful expres-
sion, using the proposed egfp-tagged pFL61-based ex-
pression vector, of two genes from Tuber borchii Vittad.
The lectin TBFL-1 is the main soluble secreted pro-
tein present in the fruiting body of Tuber borchii Vittad,
it is able to selectively bind the exopolysaccharides pro-
duced by the ascoma-associated Rhizobium spp [19].
The lectin gene, tbfl-1, encodes for a 12-amino acid
N-terminal non-canonical signal peptide, whose se-
quence does not match any homologous signal se-
quences stored in data banks, and drives the TBFL-1 to
the classical secretory pathway, via a non-conventional
route, when the gene is expressed in yeast [20]. The
other gene, a hexose transporter involved in sugar me-
tabolisms, known as Tbhxt1, encodes for a protein which
functionally complements the hxt-null mutant Sac-
charomyces cerevisiae EBYVW4000 [21]. The hexose
transporter has a strong preference for D-glucose over
D-fructose and also imports D-mannose. It catalyses the
transport via a proton-symport mechanism. The regula-
tion of Tbhxt1 gene expression is consistent with its role
as a high-affinity D-glucose transporter [21]. Analyses of
the expression, in live yeast cells, of the two EGFP-
tagged proteins revealed a localization patterns agree
with those of previous studies [20-22].
2. MATERIALS AND METHODS
2.1. Strains Maintenance
The Saccharomyces cerevisiae strain INVSc1 (Invitro-
gen, Life Technologies, USA) was propagated on YPD
agar. Transformation of yeast was performed using the
yeast transformation kit (Sigma-Aldrich, USA) [23,24].
The recombinant yeast strain was grown, at 30°C, in a
minimal medium composed of “yeast nitrogen base
without amino acids” (Sigma-Aldrich, USA), 2% w/w
D-glucose and supplemented with “yeast synthetic drop-
out medium supplement, without uracil” (Sigma-Aldrich,
USA).
For the experiments described in this paper a single
colony of yeast was grown overnight, in liquidin an or-
bital shaking dry incubator. One ml was added to 50 ml
of the same fresh medium. After 2 h aliquots were used
for flow cytometry analysis, while for the other experi-
ments the culture was grown until OD600 reached 1.0.
The construction of recombinant plasmids were carried
out in Escherichia coli strain BL21 by standard proto-
cols.
2.2. Preparation of Recombinant Vectors
Construction of the recombinant plasmids pBS(GFP)
was performed as followed. Five micrograms of the ret-
roviral plasmid PINCO [25], carrying the EGFP cDNA,
were digested with Hind III and Not I overnight. The
EGFP cDNA was separated by agarose gel electrophore-
sis and purified using the “Qiaquik Gel Extraction Kit”.
At the same time, 5 micrograms of plasmid pBlueScript
II KS (Stratagene, USA) were digested with the same
restriction enzyme, dephosphorylated with calf intestinal
phosphatase (CIP) and purified using the “Qiaquik PCR
Purification Kit”. One hundred micrograms of plasmid
and 50 micrograms of cDNA were used in 10 µl of a
ligation reaction. The obtained plasmid, pBS(GFP), was
used for the preparation of yeast expression vectors.
The yeast expression vectors, pFL61(GFP) and
pFL61(GFPmut), were constructed as follows.
Five micrograms of the plasmid pBS(GFP) were di-
gested with Nco I and Not I overnight. The insert was
filled with T4 DNA polymerase in the presence of
dNTPs. Meanwhile, 5 micrograms of the plasmid pFL61
[18], was incubated overnight with Not I, filled with T4
and dNTPs and dephosphorylated using calf intestinal
phosphatase (CIP, Boehringer Mannheim GmbH, Ger-
many). After purification, both plasmid and insert were
used in a ligation reaction to produce the expression
vector pFL61(GFP). The plasmid DNA was used as a
template for mis-matched primer mutagenesis [26] to
produce the pFL61(GFPmut) vector carrying a Not I site
upstream to the EGFP start codon. The primers utilized
are reported in Table 1.
The production of pFL61(TBFL1-EGFP) and pFL61
(TBHXT1-EGFP) was performed as described below.
The cDNA inserts of both tbhxt and tbfl-1 genes were
obtained by PCR, using a proofreading polymerase,
from total fruiting body cDNA, using the primers re-
ported in Table 1. The PCR products were incubated
Ta b le 1 . Primer sequences employed in the mutagenesis and in the gene amplification. The Not I sites are underlined and the start
codons are typed on bold letter.
Gene Forward Primer Reverse Primer
Primers mutagenesis CAACAAATATAAAACCAGCGG
CCGCAATGGTGAGCAAGG
CCTTGCTCACCATTGCGG
CCGCTGGTTTTATATTTGTTG
tbhxt1
GenBank = AY956320 ATGGGTTTCATCATCAAG GCGGCCGCAACCTCGCCGTGCC
tbfl-1
GenBank = U83996 ATGTCTTCTAAAATTGTTCGTGAGCC CAGAAGGCGGCCGCAACCTGGACC
F. Palma et al. / Advances in Bioscience and Biotechnology 2 (2011) 13-19
Copyright © 2011 SciRes. ABB
15
with Taq DNA polymerase at 72°C for 5 minutes and
then were cloned using the pGEM®-T Vector System
(Promega, USA). The recombinant pGEM vectors was
digested with Not I and the insert cloned in the dephos-
phorylated Not I-linearised pFL61(GFPmut).
2.3. Analysis of Gene Expression by Northern
and We stern Blotting
Northern blot analyses were performed using total RNA
extracted from 1.5 milligrams of wet weight cells har-
vested from log-phase yeast-grown cultures by the
RNeasy Plant Mini Kit (Qiagen GmbH, Germany).
Twenty micrograms of total RNA were used in a stan-
dard northern blot analysis. A hybridization probe was
purified from the pBS-EGFP digested with Nco I and
Not I. The cDNA fragment was P-labeled using the
RediPrime kit (Amersham Biosciences, UK) and the
filter exposed in a Phospho Imager apparatus. The ACT1
probe was used as housekeeping gene
The western blot analyses of yeast total proteins were
conducted by processing 50 ml of log-phase minimal
medium yeast-grown cultures. After cell harvesting by
centrifugation, 0.5 g of each wet weight yeast pellet, was
frozen in liquid nitrogen and ground into a powder with
mortar and pestle. The powder was then suspended in 1
ml of 10 mM Tris-HCl, pH 8.0 and 0.1% w/v SDS. The
cell lysate was clarified by centrifugation in 1.5-ml tubes
at 12,000 g for 15 min. Protein content was assayed by
the BioRad method. Equal amount of protein extract
(20µg) were resolved on a 15% SDS-polyacrilamide gels
[27], transferred to a nitrocellulose membrane (Hy-
bond-C Extra, Amersham Biosciences, UK.) and then
detected with a mouse monoclonal antiGFP antibody
(Chemicon International, USA). The secondary antibody
was horseradish peroxidase-conjugated goat anti-mouse
(Amersham Biosciences, UK). The immune complexes
were visualized with the ECL detection system (Amer-
sham Biosciencesces, UK) accordingly to the manufac-
turer’s instructions.
2.4. Microscopic Study and FACS Analysis
Microscopic evaluation of EGFP expression in the re-
combinant yeast clones was performed by direct cell
observation using a Leica DMLB uorescence micro-
scope, equipped with a FITC filter and a DC300 F cam-
era.
The early log-phase yeast cultures in minimal medium
were analyzed using a FACScan flow cytometer and
CellQuest software (Becton Dickinson, San Jose, CA,
USA) with a standard excitation wavelength of 488 nm.
3. RESULTS AND DISCUSSION.
Our objective was to develop of a pFL61-based versatile
plasmid construction system suitable for the efficient
preparation of yeast expression vectors for producing
C-terminal EGFP-tagged proteins. The pFL61 vector [18]
allows an efficient gene expression under the control of
the constitutive PGK promoter. We chose to localize the
fluorescent domain at the C-terminus to allow the pro-
teins, which have an N-terminal signal peptide, to follow
their own localization pathway [28-30].
The EGFP open reading frame was obtained from the
PINCO retroviral plasmid [25]. Its Hind-Not fragment
was first subcloned the into the pBlueScript-KS vector to
obtain an easier to handle plasmid, named pBS(GFP),
which carrying an Nco I unique site. The digestion with
Nco I and Not I of the pBS(GFP), followed by a treat-
ment with T4 DNA polymerase and dNTPs, produce an
EGFP cDNA with blunt ends.
For generation of the pFL61(EGFP) plasmid, the blunt
fragment was cloned in the linearised pFL61. The re-
sulting plasmid was further engineered, using the
site-specific mutagenesis procedure, to generate a unique
Not I site upstream the EGFP start codon [26]. The novel
vector was named pFL61(EGFPmut).
The recovery of the Not I site, destroyed by insertion
of EGFP cDNA, made the vector suitable for cloning
employments. Furthermore the mutation preserved the
integrity of the Kozak sequence [31].
The pFL61(EGFPmut) vector was used to express two
Tuber borchii proteins in yeast: the TBFL-1 lectin [19]
and TBHXT1 hexose transporter [21].
A reproducible cloning protocol was developed in or-
der to obtain the versatile construction system.
The coding regions (ORF) of the target genes, the
tbfl-1 or the tbhxt1, were amplified by PCR using the
primers shown in Ta b le 1 . The forward primer was de-
signed to start from ATG codon while the reverse primer
contained a Not I site localized close to stop codon so to
make the coding region in frame to the EGFP sequence.
The amplified-fragment was subcloned in the pGEM-T
vector system. This step permitted to add to the cDNA a
further Not I site, came from the pGEM polylinker, up-
stream the 5’ ATG. The Not I digestion of the recombi-
nant pGEM(ORF) plasmid generated a cDNA fragment
compatible with the expression vector pFL61(EGFPmut).
The schematic diagram in Figure 1 summarizes the
steps previously described.
Following this procedure we were able to obtain the
vectors pFL61(TBFL1-EGFP) and pFL61(TBHXT1-
EGFP) carrying the two Tuber borchii genes [19,21].
We used a complementation study, exploiting the fluo-
rescence properties of EGFP, to demonstrate the correct
expression of recombinant chimeric gene. In fact, in
fluorescence microscopy the cells expressing the EGFP
should show a diffuse cytoplasmic fluorescence [15], due
to the soluble nature of the protein, while, the yeast
F. Palma et al. / Advances in Bioscience and Biotechnology 2 (2011) 13-19
Copyright © 2011 SciRes. ABB
16
Figure 1. The strategy for preparing the pFL61-based expression vector to produce, in
yeast cells, C-terminal EGFP-tagged protein under PGK promoter control. The ORF
(open reading frame) is the coding region either of the tbfl-1 or of the tbhxt1 gene.
clones expressing fusion protein, should show a fluores-
cence localised to the protein sub-cellular target: mem-
brane localization for the transporter TBHXT1 [21] and
cell-wall localization for TBFL1 lectin [22].
Surprisingly, as shown in Figure 2, the yeast cells,
transformed by the pFL61(EGFPmut), produce feeble
fluoresce compare to those expressing EGFP or EGFP-
tagged protein. This observation was take in account and
was planed further experiments to investigate the influ-
ence of the Not I site, closely upstream to the ATG start
codon, on gene expression. The transcription process as
well as the mRNA stability was tested by northern blot-
ting analysis. As shown in Figure 3 in all samples are
present a high amount of the mRNA containing the
EGFP sequence.
In contrast, as shown in Figure 4, the western blotting
analysis evidences a very low amount of EGFP signal in
yeast cells carrying the expression vector pFL61
(EGFPmut).
These data confirmed the observation done by fluo-
rescence microscopy: this Not I site do not influence the
transcription but negatively affects the translation proc-
ess.
During translation in eukaryotes the small ribosomal
subunit is first attached to the mRNA capped 5'-end and
then translocates to the first suitable AUG codon (re-
viewed in [32,33]). The large ribosomal subunit joins the
pre-initiation complex there and translation initiation
occurs. Since the Not I tract was situated close to the
first AUG codon, their inhibitory effect on translation
can be explained by several different mechanisms.
The GCGGCCGC sequence may affect the process of
F. Palma et al. / Advances in Bioscience and Biotechnology 2 (2011) 13-19
Copyright © 2011 SciRes. ABB
17
(a) (b)
(c) (d)
Figure 2. Fluorescence microscopy analyses of
the expression of GFP fusion proteins in recom-
binant yeast cells harbouring different expression
vectors. The Saccharomyces cerevisiae cells
transformed with the following expression vec-
tors: a) pFL61(EGFP); b) pFL61(EGFPmut); c)
pFL61 (TBFL1-EGFP); d) pFL61(TBHXT1-
EGFP) are shown. The pictures were obtained
by the fluorescent microscopy analysing live
cells and were token by a camera setting the
exposition time to 1 sec.
Figure 3. Northern blot of 20 µg of total RNA
extracted from 1.5 mg of wet weight yeast cells
log-phase harvested harbouring different expres-
sion vectors. Lane 1, pFL61(EGFP); lane 2,
pFL61(EGFPmut); lane 3, pFL61(TBFL1-EGFP);
lane 4, pFL61(TBHXT1-EGFP). In panel A the
hybridization was performed with 32P labelled
EGFP cDNA as specific probe. In panel B the
ACT1 probe was 32P labelled and used as internal
control.
Figure 4. Western blotting analysis of total pro-
teins from yeast cells harbouring different ex-
pression vectors. Lane 1, pFL61(EGFP); lane 2,
pFL61(EGFPmut); lane 3, pFL61(TBFL1-
EGFP); lane 4, pFL61(TBHXT1-EGFP).
recognition of the start codon after the translocation of
the small ribosomal subunit from RNA 5'-end, called
scanning (reviewed in [32]). We hypnotized that this Not
I sequence, close to ATG, might form a hairpin which
reduces the rate of translation. It is well documented that
eukaryotic mRNAs with highly structured 5'-UTRs are
relatively inefficient translationally [34,35]. This is
likely due to the inability of the 40S ribosomal subunit
and/or associated RNA helicases to unwind stable sec
ondary structures in the 5'-UTR during scanning and
AUG recognition [36]. This phenomenon gave an ad-
vantage to the proposed yeast expression vector system,
in fact a bright florescence were observed only in yeast
cells carrying the exogenous gene fused with egfp; in
contrast a feeble florescence emission was found in
clone harbouring the void vector and no fluorescence
was found in the cells containing the vector where the
exogenous genes were in a wrong orientation (data not
shown).
The phenotypic differences among the yeast clones
were also analysed by flow cytometer. The yeast cultures
were analysed in an early stage of growth to have a bet-
ter plasmid retention rate [37].
The Figure 5 reports the FACS graph of the different
yeast clones. The filled histogram represents a negative
control yeast cells. The line histograms describe the
fluorescence distribution of the four yeast clone cells.
The green line represents the yeast carrying pFL61
(EGFPmut) that shows lower fluorescence than
pFL61(EGFP), magenta line, pFL61(TBF1-EGFP), blue
line, and pFL61(TBHXT1-EGFP), orange line. Unfor-
tunately, this comparative analysis evidences that the
different fluorescence properties among the yeast clones
do not permit to sort them by flow cytometry.
The versatile expression system based on pFL61, re-
(a)
F. Palma et al. / Advances in Bioscience and Biotechnology 2 (2011) 13-19
Copyright © 2011 SciRes. ABB
18
(b)
Figure 5. Cytometry analyses of transformed yeast cells con-
stitutively expressing EGFP-tagged proteins The Panel A re-
ports the analysis of a yeast clone. In panel B is shown the
fluorescence intensity by yeast cells harbouring the vector
pFL61(EGFPmut) in green line, harbouring pFL61(EGFP) in
magenta line; pFL61(TBFL1-EGFP) in blue line, and harbour-
ing pFL61(TBHXT1-EGFP) in orange line; the filled histo-
gram was obtained by untransformed yeast cells.
ported in this paper, allows obtaining, in a few steps, a
vector for producing proteins fused with EGFP in yeast.
We also noted that the palindromic Not I restriction site,
close to the start codon, affects the translation process.
This phenomenon could be further investigated to create
vectors that generate a fluorescent phenotype only if
they carry an exogenous gene inserted in the correct
orientation.
REFERENCES
[1] Chalfie, M., Tu, Y., Euskirchen, G., Ward, W.W. and
Prasher, D. C. (1994) Green fluorescent protein as a
marker for gene expression. Science, 263, 802-805.
doi:10.1126/science.8303295
[2] Plautz, J.D., Day, R.N., Dailey, G.M., Welsh, S.B., Hall, J.
C., Halpain, S. and Kay, S.A. (1996) Green fluorescent
protein and its derivatives as versatile markers for gene
expression in living Drosophila melanogaster, plant and
mammalian cells. Gene, 173, 83-87.
[3] Higgs, S., Traul, D., Davis, B.S., Kamrud, K.I., Wilcox,
C.L. and Beaty, B.J. (1996) Green fluorescent protein
expressed in living mosquitoes--without the requirement
of transformation. Biotechniques, 21, 660-664.
[4] Cubitt, A.B., Heim, R., Adams, S.R., Boyd, A.E., Gross,
L.A. and Tsien, R.Y. (1995) Understanding, improving
and using green fluorescent proteins. Trends in Bio-
chem ical Sciences, 20, 448-455.
doi:10.1016/S0968-0004(00)89099-4
[5] Chiu, W., Niwa, Y., Zeng, W., Hirano, T., Kobayashi, H.
and Sheen, J. (1996) Engineered GFP as a vital reporter
in plants. Current Biology, 6, 325-330.
doi:10.1016/S0960-9822(02)00483-9
[6] Baulcombe, D.C., Chapman, S. and Santa, C.S. (1995)
Jellyfish green fluorescent protein as a reporter for virus
infections. Plant Journal, 7, 1045-1053.
doi:10.1046/j.1365-313X.1995.07061045.x
[7] Amsterdam, A., Lin, S. and Hopkins, N. (1995) The Ae-
quorea victoria green fluorescent protein can be used as a
reporter in live zebrafish embryos. Developmental Biol-
ogy, 171, 123-129. doi:10.1006/dbio.1995.1265
[8] Prasher, D.C., Eckenrode, V.K., Ward, W.W., Prendergast,
F.G. and Cormier, M.J. (1992) Primary structure of the
Aequorea victoria green-fluorescent protein. Gene, 111,
229-233.
[9] Prasher, D.C. (1995) Using GFP to see the light. Trends
in Genetics, 11, 320-323.
doi:10.1016/S0168-9525(00)89090-3
[10] Inouye, S. and Tsuji, F.I. (1994) Aequorea green fluores-
cent protein. Expression of the gene and fluorescence
characteristics of the recombinant protein. FEBS Letters,
341, 277-280. doi:10.1016/0014-5793(94)80472-9
[11] Heim, R., Cubitt, A.B. and Tsien, R.Y. (1995) Improved
green fluorescence. Nature, 373, 663-664.
doi:10.1038/373663b0
[12] Heim, R. and Tsien, R.Y. (1996) Engineering green fluo-
rescent protein for improved brightness, longer wave-
lengths and fluorescence resonance energy transfer. Cur-
rent Biology, 6, 178-182.
doi:10.1016/S0960-9822(02)00450-5
[13] Cormack, B.P., Valdivia, R.H. and Falkow, S. (1996)
FACS-optimized mutants of the green fluorescent protein
(GFP). Gene, 173, 33-38.
[14] Fuhrmann, M., Oertel, W. and Hegemann, P. (1999) A
synthetic gene coding for the green fluorescent protein
(GFP) is a versatile reporter in Chlamydomonas rein-
hardtii. Plant Journal, 19, 353-361.
doi:10.1046/j.1365-313X.1999.00526.x
[15] Rizzuto, R., Brini, M., Pizzo, P., Murgia, M. and Pozzan,
T. (1995) Chimeric green fluorescent protein as a tool for
visualizing subcellular organelles in living cells. Current
Biology, 635-642. doi:10.1016/S0960-9822(95)00128-X
[16] Koerte, A., Chong, T., Li, X., Wahane, K., and Cai, M.,
"Suppression of the yeast mutation rft1-1 by human
p53," Journal of Biological Chemistry, Vol. 270, No. 38,
22-9-1995, pp. 22556-22564.
[17] Starling, A.L., Ortega, J.M., Gollob, K.J., Vicente, E.J.,
ndrade-Nobrega, G. M., and Rodriguez, M. B., "Evalua-
tion of alternative reporter genes for the yeast two-hybrid
system," Genetics and Molecular Research, Vol. 2, No. 1,
2003, pp. 124-135.
[18] Minet, M., Dufour, M.E. and Lacroute, F. (1992) Com-
plementation of Saccharomyces cerevisiae auxotrophic
mutants by Arabidopsis thaliana cDNAs. Plant Journal,
2, 417-422.
[19] Cerigini, E., Palma, F., Barbieri, E., Buffalini, M. and
Stocchi, V. (2008) The Tuber borchii fruiting
body-specific protein TBF-1, a novel lectin which inter-
acts with associated Rhizobium species. FEMS Microbi-
ology Letters, 284, 197-203.
doi:10.1111/j.1574-6968.2008.01197.x
[20] Palma, F., Cerigini, E. and Stocchi, V. (2007) Yeast ex-
pression of the Tuber borchii fruiting body specific pro-
tein, TBF-1: identification of a noncanonical signal pep-
tide. FEMS Microbiology Letters, 272, 114-119.
doi:10.1111/j.1574-6968.2007.00748.x
[21] Polidori, E., Ceccaroli, P., Saltarelli, R., Guescini, M.,
Menotta, M., Agostini, D., Palma, F. and Stocchi, V.
F. Palma et al. / Advances in Bioscience and Biotechnology 2 (2011) 13-19
Copyright © 2011 SciRes. ABB
19
(2007) Hexose uptake in the plant symbiotic ascomycete
Tuber borchii Vittadini: biochemical features and expres-
sion pattern of the transporter TBHXT1. Fungal Genetics
and Biology, 44, 187-198.
doi:10.1016/j.fgb.2006.08.001
[22] De Bellis, R., Agostini, D., Piccoli, G., Vallorani, L.,
Potenza, L., Polidori, E., Sisti, D., Amoresano, A., Pucci,
P., Arpaia, G., Macino, G., Balestrini, R., Bonfante, P. and
Stocchi, V. (1988) The tbf-1 gene from the white truffle
Tuber borchii codes for a structural cell wall protein spe-
cifically expressed in fruitbody. Fungal Genetics and Bi-
ology, 25, 87-99. doi:10.1006/fgbi.1998.1092
[23] Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983)
Transformation of intact yeast cells treated with alkali
cations. Journal of Bacteriology, 153, 163-168.
[24] Hill, J., Donald, K.A. and Griffiths, D.E. (1991) DMSO-
enhanced whole cell yeast transformation. Nucleic Ac-
ids Research, 19, 5791. doi:10.1093/nar/19.20.5791
[25] Grignani, F., Kinsella, T., Mencarelli, A., Valtieri, M.,
Riganelli, D., Grignani, F., Lanfrancone, L., Peschle, C.,
Nolan, G. P. and Pelicci, P. G. (1998) High-efficiency
gene transfer and selection of human hematopoietic pro-
genitor cells with a hybrid EBV/retroviral vector ex-
pressing the green fluorescence protein. Cancer Research,
58, 14-19.
[26] R.Higuchi "Recombinant PCR," In: Innis, M.A., Gelfand,
D.H., Sninsky, J.J. and White T.J. Ed., (1990) PCR Pro-
tocols: A Guide to Methods and Applications, Academic
Press, Inc., San Diego.
[27] Laemmli, U.K. (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature, 227, 680-685. doi:10.1038/227680a0
[28] Rothman, J.E. (1994) Mechanisms of intracellular pro-
tein transport. Nature, 372, 55-63.
doi:10.1038/372055a0
[29] Palade, G. (1975) Intracellular Aspects of the Process of
Protein Synthesis. Science, 189, 867.
doi:10.1126/science.189.4206.867-b
[30] Nombela, C., Gil, C., and Chaffin, W.L. (2006)
Non-conventional protein secretion in yeast. Trends in
Microbiology, 14, 15-21. doi:10.1016/j.tim.2005.11.009
[31] Kozak, M. (1987) An analysis of 5'-noncoding sequences
from 699 vertebrate messenger RNAs. Nucleic Acids
Research, 15, 8125-8148. doi:10.1093/nar/15.20.8125
[32] Kozak, M. (1999) Initiation of translation in prokaryotes
and eukaryotes. Gene, 234, 187-208.
[33] Gingras, A.C., Raught, B. and Sonenberg, N. (1999) eIF4
initiation factors: effectors of mRNA recruitment to ri-
bosomes and regulators of translation. Annual Review of
Biochemistry, 68, 913-963.
doi:10.1146/annurev.biochem.68.1.913
[34] Kozak, M. (1980) Influence of mRNA secondary struc-
ture on binding and migration of 40S ribosomal subunits.
Cell, 19, 79-90.
[35] Kozak, M. (1986) Influences of mRNA secondary struc-
ture on initiation by eukaryotic ribosomes. Proceedings
of the National Academy of Sciences of the United States
of America, 83, 2850-2854. doi:10.1073/pnas.83.9.2850
[36] Kozak, M. (1989) Circumstances and mechanisms of
inhibition of translation by secondary structure in eu-
caryotic mRNAs. Molecular and Cellular Biology, 9,
5134-5142.
[37] Ishii, J., Izawa, K., Matsumura, S., Wakamura, K., Tan-
ino, T., Tanaka, T., Ogino, C., Fukuda, H. and Kondo, A.
(2009) A simple and immediate method for simultane-
ously evaluating expression level and plasmid mainte-
nance in yeast. Journal of Biochemistry, 145, 701-708.
doi:10.1093/jb/mvp028