Engineering, 2012, 5, 121-123
doi:10.4236/eng.2012.410B031 Published Online October 2012 (http://www.SciRP.org/journal/eng)
Copyright © 2012 SciRes. ENG
Leptin Receptor in Ram Epididymal Spermatozoa
Mohammad Roostaei-Ali Mehr, Reza Rajabi-Toustan i , Ras ool Motamedi -Mojdehi
Department of Anim al Science, Faculty of Agricultural Sciences, University of Guilan, Rasht, Iran
Received 2012
ABSTRACT
This experi ment was des i gned to investi gate lep ti n recep to rs ( Ob-R and Ob-Rb) mRNA in ram epididymal spermatozoa by RT-PCR.
Ten testes were obtained from abattoir and epididymal spermatozoa recovery was performed. To purify spermatozoa, motile sperm
were isolated by the swim-up procedure. Total RNA was isolated from epididymal spermatozoa and placental cotyledon, as a posi-
tive control, and then they were purified. Specific bands (98 and 308 bp) for Ob-R and Ob -Rb were detected a fter RT-P CR in bo th
epididymal spermatozoa and placental cotyledon. We may conclude that Ob-R and Ob-Rb mRNA are present in ram epididymal
spermatozoa and leptin perhaps exerts physiological effects, as already de mon strated in hum a n.
Keywords: Epididymal Spermat ozoa; mRNA; Ob-R; Ob-Rb
1. Introduction
Leptin is a 16 kDa protein and mainly secreted by white adi-
pose tissue [1]. Leptin modulates different systems via neu-
roendocrine regulation, including adrenal, thyroid and gonadal
axes. Other functions of leptin have been suggested recently in
peripheral organs that leptin independently interacts with leptin
recepto r in peri pheral ti ssue, as wel l as repr oducti ve organs [2] .
Recent o bservation s in female suggest th at leptin is involved in
relaying energy status to reproduction [3-7]. Various studies
have also pointed out a direct role of leptin in the control of
testicular function, but its actual role in the regulatory network
controlling male reproduction is still a matter of debate [3,6,8].
To date, at least five Ob-R isoforms (Ob-Ra-e) have been
cloned from rodents and exhibit widespread distribution both in
central and peripheral tissues [6,9]. Alternative splicing of the
Ob-R transcript results in the various products that vary in the
length of the cytoplasmic region [10]. Three Ob-R isoforms, the
long form (Ob-Rb), the middle form (Ob-Ra) and the short
form (Ob-Rc) were cloned and sequenced in bovine and ovine
[11,12]. Ob-Rb was repo rted i n most o f the farm ani mal tissues
[10,13].
It is known that animal and human models of leptin resis-
tance and deficiency show a severe impairment of the repro-
duct ive functio n [6]. Leptin recepto rs are presen t in several cel l
types in the human, bovine and porcine male and female re-
productive system [6,14]. Therefore, it is seemed that leptin
could exert a direct effect on the gonads [2]. There is little in-
formation about the expression of leptin and leptin receptor in
ruminant such as sheep. To fully understand the peripheral
effects of leptin as a local factor, it is necessary to study the
structure and peripheral tissue distribution of its receptors
(Ob-R and Ob-Rb).
The aim of this experiment was to determine the expression
of Ob-R and Ob-Rb mRNA in ram epididymal spermatozoa,
providing evidence for a role of leptin in sperm physiology.
2. Materials and Methods
Ten testes were obtained from abattoir. In the laboratory, the
caudal epididymis was isolated from testis. Epididymal sper-
matozoa were obtained by slicing and suspending of the caudal
epididymal tissue in Petri dish containing 5 ml Tris (300 mM
tris (hydroxymethyl) aminomethane, 95 mM citric acidmono-
hydrate, 28 mM D-(+)-Glucose, 2000 IU/ml penicillin G and
0.4 mg/ml streptomycin, pH 7.0). The samples were agitated
and incubated at room temperature for 10 min; liquid phase
containing epididymal spermatozoa was collected. A complete
semen analysis was performed on each sample: sperm motility
was >65% with normal morphology >65% and viability >70 %.
Motility, viability, normal morphology and sperm concentra-
tion were evaluated by microscopic visual method, one-step
eosin -nigrosin staining and hematocytometer method, respec-
tively. Recovered epididymal spermatozoa were pooled and
centrifuged for 10 min at 700 × g at room temperature; the su-
pernatant was removed. To purify spermatozoa, motile sperm
were isol ated by the s wim-up procedure; 250 µl of semen were
layered under 1 ml of Tris diluent in each of 15 ml centrifuge
tubes. After incubation for 1 h at 37 °C in an atmosphere with
5% CO2, 750 µl were removed from the top of each tube. The
purity of spermatozoa was checked under a phase contrast mi-
crosco pe. Sperm were concen trated b y centrifugation at 800 ×g
for 10 min, the top of suspension was removed frozen in liquid
nitrogen vapor and held in liquid nitrogen until RNA extrac-
tion.
Total RNA from placental cotyledon and epididymal sper-
matozoa were extracted according to Chomczynski and Saachi
[15]. RNA samples were treated by DNAase I at 37 °C for 30
min and then the enzyme was inactivated at 75 °C for 15 min.
After that Purity of RNA were determined by Biophotometer
(Eppendorf, Germany) (OD 260/280 and 260/230 ratio) and
visu a lized b y electroph oresis on a 2% agaro se gel, stai ned with
0.5 μg/ml ethidium bromide. RNA samples with no DNA bands
M. R.-A. MEHR ET AL.
Copyright © 2012 SciRes. ENG
122
after DNaseI treatment were used in RT-PCR reactions. Treat ed
RNA was reverse transcribed to cDNA in a 20 µl final volume
containing 1 µg of extracted RNA, 200 ng random hexamer and
0.5 mM Deoxyribonucleotide triphosphate (dNTP) Mix. The
mixture was heated at 65 °C for 5 min. 4 U (in 1 µl) RNase
inhibitor, RT buffer (50 mM Tris-HCL, 75 mM KCL, 3 mM
MgCL2), 10 mM DTT and 200 units M-MuLV Reverse tran-
scriptase (Fermentas, Germany) was added. This mixture was
incubated for 60 min at 37 °C. The prepared cDNA was incu-
bated at 75 °C for 15 min to denature the M-MuLV-RT and
then stored at -20 °C.
Aliquots of 3 µl of the first standard cDNA reaction were
amplified in a 50 µl reaction volume contain ing a final concen-
tration of 1 X PCR buffer, 2.5 mM MgCl2, 0. 2 mM dN TP mix,
2 U of recombinant Taq DNA polymerase (Fermentas) and 0.4
mM of primers. The cDNA primers to the leptin receptor se-
quen ce which recognizes all known splice variants of the leptin
receptor (Ob-R) were 5-TGCCACCAAA TACAACATAT-
GACT-3′ (182 to 205) and 5′-CTTAGTTTCA ACAACTGCC-
TCAGA-3′ (256 to 279, Genbank AY278244), 98 bp product
(Table 1). The cDNA primers to the long form of the ovine
leptin receptor, Ob-Rb, were 5-GATGAGATGGTG CCAA-
CA ACTA-3′ (121 to 142) and 5′-TGGGTTTCTATTTC
CCATGATC-3′ (407 to 428, Genbank OAU62124), 308 bp
product (Table 1).
PCR was performed o n a Eppendorf th ermal cycler (Master-
cycler® personal, Eppendorf, Germany using the following
conditions: 94 °C (4 min) 1 cycle; 94 °C (1 min), 55 °C (1 min),
72 °C (1 min) 45 cycles; 72 °C (10 min) 1 cycle. 15 µl of each
PCR product were subjected to electrophoresis in 1.5% aga-
rosegel and stained with 0.5 µg/ml ethidium bromide.
3. Results
RT-PCR results are shown in Figure 1. Since t he primers used
for the amplification of Ob-R and Ob-Rb were designed from
nucleotide sequences within one specific exon of gene, the
isolated RNA samples were directly used in RT-PCR after
DNaseI treatmen t to d emonst rate the absen ce of genomic DN A
contamination in the RNA probes (Figure 1, lanes 3 and 4).
The 98 and 308 bp cDNA was never detected in RNA samples
under study.
RNA isolated from placental cotyledon cells was used as
positive control. RT-PCR with specific primers for Ob-R and
Ob-Rb r evealed a predi cted RT-PCR product of 98 bp in length
(Figure 1, lanes 1 and 2). RT-PCR products were comparable
in all examined sperm materials. Amplification of cDNA pre-
pared with RNA isolated from epididymal spermat ozo a sh owed
the same predicted RT-PCR products of 98 and 308 bp for
Ob-R and Ob-R b (Figure 1, lanes 5 and 6).
4. Discussion
A growing interest is directed towards the presence of mRNA
in mammalian ejaculated spermatozoa. Originally, these tran-
scripts were h ypothesi zed to be carri ed over fro m earlier stag es
of spermatogenesis. However new findings suggest that some
of these transcripts can code for proteins essential in early
embryo development [10]. Moreover, recent studies have
shown that mRNA of leptin receptor is in human, swine and
bovine spermatozoa [14,16,17].
Tabl e 1. Sequence of the Primer Set Used for PCR.
Gene Primer3 Fragment si ze (bp) AT Cycles GenBank Reference
Ob-R1 F: tgccaccaaatacaacatatgact
R: cttagtttcaacaactgcctcaga 98 55 ˚C 45 AY278244 Thomas et al., 2001 [12]
Ob-Rb2 F: gatgagatggtgccaacaacta
R: tgggtttctatttcccatgatc 308 55 ˚C 45 OAU62124 Thomas et al., 2001 [12]
1Ob-R: total isoform of leptin receptor; 2Ob-Rb: long isoform of leptin receptor; 3F: Forward and R: Reverse prime r.
Fig ure 1 . Representative Ob-R a nd O b-Rb transcri pts in epididymal spermatozoa and placental cotyledon. M = molecular weight standards
(100 bp DNA ladder, Fermentas). The numbers in the Figure i ndicate: (1) and (2) RT-PCR res ults of total RNA of placen tal cot yledo n used
as a positive control for Ob-R and Ob-Rb, respectively; (3) and (4) PCR results of sperm and placental cotyledon cell RNA, respectively; (5)
and (6) RT-PCR results of total RNA of epididymal sperm for Ob-R and Ob -Rb, respectively; (7) blank.
M. R.-A. MEHR ET AL.
Copyright © 2012 SciRes. E NG
123
However, to our knowledge, this is the first time that the
presence of mRNA of Ob-R and Ob-Rb in ram epididymal
spermatozoa has been demonstrated. A recent study in pig has
suggested that leptin receptor may induce transduction and
molecular changes associated with sperm capacitation and sur-
vival [18]. These findings suggest that leptin, through leptin
receptor, may play an important role in both sperm function and
male fertility. Furthermore, as leptin interacts with insulin to
regulate glycogen synthesis in mature spermatozoa, it might
affect sperm motility, as already demonstrated in humans [8].
The presence of Ob-R mRNA in ram epididymal spermatozoa
might suggest that leptin acts through leptin receptor to regulate
spermatozoa energy expenditure in this species. At present, we
do not have any information on the possible actions of leptin on
ram spermatozoa.
REFERENCES
[1] L. A. Campfield, F. J. Smith, and P. Burn, “The OB protein
(leptin) pathway. A link between adipose tissue mass and central
neu ra l net work s, ” Hor m. Met ab . R es. , vol . 2 8 , pp . 619 63 1, Dec .
1996.
[2] I. J. Clarke, and B. A. Henry, “Leptin and reproduction,” Rev.
Reprod., vol. 4 , pp. 48–55, Jan. 1 99 9 .
[3] D. P. Shalev, Y. Soffer, and L. M. Lewin, “Investigation on the
motili ty of hu man spermat ozoa in a defined medium in the pres-
ence of metabolic inhibitors and of carnitine,” Andrologia, vol.
18, pp. 368375, Aug. 1986.
[4] C. Cunningham, D. K. Clifton, and R. A. Steiner, “Leptin’s
actions on t he reproduct ive axis: persp ectives and mechanisms,”
Biol. Reprod. , vol. 60, pp. 216222, Feb. 1999.
[5] K. Laud, I. Gourdou, L. Be Iair, D. H. Keisler, and J. Djinane,
“Detection and regulation of leptin receptor mRNA in ovine
mammary epithelial cells during pregnancy and lactation,” FEBS.
Lett., vol. 463, pp. 194–198, Dec. 1999.
[6] M. Caprio, E. Fabrini, G. Ricci, S. Basciani, L. Gnessi, M. Arizzi,
A. R. Carta, M. U. De Martino, A. M. Isidori, G. V. Frajese, and
A. Fabbri, “Ontogenesis of leptin receptor in rat leydig cells,”
Biol. Reprod. , vol. 68, pp. 11991207, Apr. 2003.
[7] S. C. Liefers, R. F. Veerkamp, M. F. W. Te Pas, Y. Chilliard and
T. van der Lende. “Genetics and physiology of lept in in peripar-
turi ent dairy,” Domest. Ani m. E ndocrin ol., vol. 29, pp. 227238,
Jul. 2 0 0 5.
[8] S. Aquila, M. Gentile, E. Middea, S. Catalano, and S. Andò,
“Autocrine regulation of insulin secretion in human ejaculated
sperma tozoa,” Endocrinology, vol. 146, pp. 552557, Feb. 2005.
[9] L. A. Tartaglia, M. Dembski, X. Weng, N. Deng, J. Culpepper, R.
Devos, G. J. Rich ards , L. A. Camp field , F. T. C lark, J . Deeds , C.
Muir, S. Sanker, A. Moriarty, K. J. Moore, J. S. Smutko, G. G.
Mays, E. A. Wool, C. A. Monroe, and R. I. Tepper, “Identifica-
tion and express ion c lonin g of a leptin recep t or, OB-R,” C ell, vol.
83, pp. 1263–1271, Dec. 1995.
[10] M. Haniu, T. Arakawa, E. J. Bures, Y. Young, J. O. Hui, M. F.
Rohde, A. A. Welcher, and T. Horan, “Human leptin receptor.
Determin ation of disulfid e struct ure and N-glycosylation sites of
the extracellular domain,” J. Biol. Chem., vol. 273, pp.
28691–28699, Oct. 1998.
[11] H. Kawachi, S. H. Yang, A. Hamano, T. Matsui, S. B. Smith,
and H. Yano, “Molecu lar cloning an d expression of bovine (B os
taurus) leptin receptor isoform mRNAs,” Comp. Biochem. Phy-
siol., vol. 148, pp. 167–173, Oct. 2007.
[12] L. Thomas, J. M. Wallace, R. P. Aitken, J. G. Mercer, P. Tray-
hurn, and N. Hoggard, “Circulating leptin during ovine pregnan-
cy in relation to maternal nutrition, body composition and preg-
nancy outcome,” J. Endocrinol., vol. 169, pp. 465476, Jun.
2001.
[13] L. A. Tartaglia, “The leptin receptor,” J. Biol. Chem., vol. 272,
pp. 6093–6099, Mar. 1997.
[14] G. Nikbakht, M. Roostaei Ali Mehr, A. Baghbanzadeh, P. Tajik,
C. Tamanini, and M. Emam, “Leptin receptor mRNA in bull
ejaculated spermatozoa,” Reprod. Dom. Anim., vol. 45, pp.
237242, Apr. 2010.
[15] P. Chomczynski, and N. Sacchi, “Single step method of RNA
isolation by acid guanidinium hiocyanate-phenol-choloroform
extraction,” Anal. Biochem., vol. 16 2, pp. 156159 , Apr. 1987.
[16] T. Jope, A. Lammert, J. Kratzsch, U. Paasch, and H. J. Glander,
“Leptin and leptin receptor in human seminal plasma and in hu-
man spermatozoa,” Int. J. Androl, vol. 26, pp. 335341, Dec.
2003.
[17] M . De Ambrogi, M. Spinaci, G Galeati, and C. Tamanini, “Lep-
tin receptor in boar spermatozoa,” Int. J. Androl, vol. 30, pp.
458461, Oct. 2007.
[18] S. Aquila, V. Rago, C. Guido, S. Zupo, I. Casaburi, and A. Car-
pin o, “Lep ti n and lep t in rec ep t or in p ig sp er ma t ozoa : evid en c e of
their involvement in sperm capacitation and survival,” Repro-
ducti on, vol. 136, pp. 23–32. Epub.