Engineering, 2012, 5, 106-109
doi:10.4236/eng.2012.410B027 Published Online October 2012 (http://www.SciRP.org/journal/eng)
Copyright © 2012 SciRes. ENG
MS-HRM to Detect Serum DNA Methylation of Intrauterine
Growth Ret ardation Children
Yan Du1,2, Youxia Zhou2, Qian Wu3,4*
1Department of Pathology, Maternity and Children's Health Care Centers in Wuxi, Wuxi, China
2Research Cen ter of Learn in g Science, So utheast Uni versity, Na njing, China
3State Key Laboratory of Reproductive Medicine, Department of Hygienic Analysis and Detection,
Sch oo l of P ublic Health, Nanjing Medic al University, Nan jing, China
4State Key Laboratory of Bioel ectron ics, School of Biological Science and Medical Engineering, Southeast University, Nanjing, China
Received 2012
ABSTRACT
Intrauterine growth retardation (IUGR) is also called fetal growth restriction (FGR), which is the major complications in obstetrics
and one of the most important causation from high morbidity and mortality in perinatal. In this study, MS-HRM (Methylation-Sensi-
tive High Resolution Melting Curve Analysis) was used to detect the methylation status of serum DNA. Gene of insulin-like gro wth
factor binding protein 3 (IGFBP-3) was detected in this study. Results showed that the serum DNA methylation level of FGR fetus
were lower th an that of the control grou p; different methylation levels were also fou nd between male and female fetu s; and the me-
thylation level was increased with the birth weight of the newborn. Our results showed that the IGFBP-3 gene methylation level of
serum DNA of newborn could be semi-quantitative detected which guide the early prevention and treatment of IUGR. It also indi-
cated that the methylation status of serum DNA can be conveniently identified and quantified by inspection of the melting curves.
Keywords: MS-HRM; IUGR; IGFBP-3; Serum DNA
1. Introduction
Intrauterine growth retardation (IUGR) is also called fetal
growth restriction (FGR), which is the major complications in
obstetrics and one of the most important causation from high
morbidity and mortality in perinatal. Furthermore, it is also one
of the important reasons for many adult diseases such as
hypertension, type II diabetes, coronary heart disease, kidney
disease and so on [1]in the future.
Insulin like growth factor 1(IGF-1) is a single basic protein
composed of 70 amino acids; and known as one of the key
factors to cellular proliferation and metabolism which plays an
important role in fetal organ maturation and growth and
development of children. The infant health status especially
endocrine status could be indicated by serum IGF-1 level, for
which it is produced by fetus itself because it cannot transfer
through placental from maternal serum. Previous studies
showed that the birth weight of IGF-1 knockout mice were only
60% of the normal mice [2].
Insulin like growth factor binding protein 3(IGFBP-3) is also
an important protein in human serum could form a compound
by binding to IGF-1 which increase the bioactivity of IGF-1.
The compound could prolong the half-life of IGF-1 in serum.
IGFBP3 can also promote the cell division as well as involves
placenta formation and growth and development of the infant
directly. It was reported that umbilical cord blood IGFBP-3
level of IUGR fetus reduced about 50% than that in normal
newborn [3] . Carter et al demonstrated that the serum IGFBP3
level decreased remarkable in IUGR animal model [4].
Therefore, the growth and development of infants was affected
by IGFBP3 directly or indirectly.
Researches have shown that adverse intrauterine
enviro nment might lead t o epigenetic chan ges which regulati ng
the gene expression [5], such as passive smoking, unreasonable
diet, and uterine artery blood supply deficiency. The
methylation status of maternal IGFBP3 had been shown to be
related with IUGR, while few reports revealing the potential
relationship between IUGR and the methylation status of
IGFBP3. The previous studies showed that hyper methylation
of the promoter of IGFBP3 gene was highly associated with
tumor [6], and the gene methylation alteration might be used as
a pot ential di agno sis marker in colo rectal cancer [ 7] . It could be
inferred that the methylation status of IGFBP3 promoter has
certain relation with growth and development. However, no
report clearly indicated whether the changes of methylation
status would affect the development of fetus, infants and even
adult. Investigation of the methylation status especially the
methylation level of IGFBP3 is significantly important to
IUGR.
The most popular approaches of methylation detection rely
on treatment of DNA samples with sodium bisulfate and
subsequent amplification by PCR [8,9]. However, MSP
(Meth ylation Specific PCR) is a non-quantitative measurement,
which limited its field of application. MS-HRM (Methylation-
Sensitive High Resolution Melting Curve Analysis), has been
shown a simple and cost-effective post-PCR technique for
routine clinical diagnosis, which is capable of analyzing
methylation in a semi-quantitative manner [10]. All of the
CpGs flanked by the primers binding to the target sequence can
*Corresponding author.
Y. DU ET AL.
Copyright © 2012 SciRes. ENG
107
be scanned by HRM regardless of the methylation status of
CpGs in the primer-binding site, with no post-PCR handling
and no separation step, characteristics that improve analysis
time [11]. HRM might be a good choice for the detection of
IGFBP3 methylation status in this study.
The aim of th is stud y was to det ect the seru m DNA meth yla-
tion level of IUGR infants. Results generated by HRM were
also validated with traditional MSP assays. The serum IGFBP-3
was me asu red with ELISA.
2. Materials and Methods
2.1. Participants
Serum samples were obtained from new-born baby between
June, 2009 to July, 2011 in Maternity and Children's Health
Care Centers in Wuxi. All the baby was born between 37 weeks
to 40 weeks of gestation ages and the birth weight were ten
percent lower than the newborn at the same gestation age.
Mothers were at the age of 21-35 years old in this study, no
basic disease, the weight gain during pregnancy is normal, and
the gestational hypertension, diabetes, preeclampsia, polyhy-
dramnios and pregnancy bile acid increased disease were all
excluded. Fifty IUGR infants (thirty male and twenty female)
and thirty normal controls (fourteen male and sixteen female)
were selected in this experiment. This proj ect was approved by
the Ethics Committee of Wuxi Maternity and Children's Health
Care Centers, Southeast University and Nanjing Medical Uni-
versity Clin ical Research Ethics Committee, N anjing, China.
2.2. Extraction of DNA a nd Sodium Bisulfate
Modif ication
DNA from serum was extracted with a QIAamp DNA Blood
Midi Kit (Qiagen, Hilden, Germany) according to the manu-
facturer’s recommen dations. D NA was extracted from 2 mL of
serum and eluted in 50μl of TE buffer. About One microgram
of DNA was subjected to bisulfite conversion with the EZ
DNA methylation kit (Zymo Research, USA). DNA quantity
was assessed spectrophotometrically. The eluted DNA was
used for the HRM analysis and MSP validation.
2.3. HRM Analysis
PCR amplification and HRM were performed on the ABI 7500
fast (Life Technology, USA) as adapted from the published
protocol [10]. The primers were designed as outlined, not more
than 1 to 2 CpG sites and were placed at or adjacent to the 5’-
end. The sequences of primers for IGFBP3 were as follows:
forward: GGGTTAAGGTTAGAGGTGGTGTTAT; reverse:
AAAAAAATTTACAATTTACAAAAACTC. PCR was
performed in a 20 μl volume containing: 1× buffer, 2 U
Hotstar tTaq DNA pol ymerase (Takar a), 25 0 nM of each p rimer,
2.5 mM SYTO-9, 10 ng bisulfite treated DNA template, and 3
mM MgCl2.
The cycling conditions were as follows: 1 cycle of 95°C for 5
min, 40 cycles o f 95°C for 10 s, 58°C for 20 s, and 72°C for 30
s; followed by an HRM step of 95°C for 1 min, 40°C for 1 min,
70°C for 15 s, and continuous acquisition to 95°C at 1 acquisition
per 0.1°C. A standard curve with known methylation ratios was
includ ed in each assay and was used t o deduce th e methylation
ratio of each fetal and maternal sample. Differences between
and among groups were compared using Pearson’s chi-square
test for qualitative variables and using Student’s t test or
analysis of varian ce for continuous variables.
Methylation- sensitive PCR was performed through BioRad
PCR system as described previously [12]. 2.5 μL (approxi-
mately 50 ng) of bisulfite-treated DNA was amplified using 2
pmol of forward primer and reverse primer. PCR conditions
were 95 °C for 10 min followed by 40 cycles of 95 °C for 30 s,
60 °C for 30 s, and 72 °C for 50 s and 1 cycle at 72 °C for 8
min.
3. Results
3.1. HRM Assay and Dilution M atr ix
We validated the correlation between Tm value and methyla-
tion level by analyzing different sets of methylation level stan-
dards (0%, 1%, 10%, 25%, 50%, 75%, 100%) firstly. All HRM
assays were able to d etect rep roduci bly 1% meth ylated DN A in
a background of unmethylated DNA. Linear regression analysis
(Figure 1) revealed that methylation levels were highly corre-
lated with Tm value, th at Tm value can be used as the s tandards
of methylation.
3.2. Methylation Level of IGFBP3 in Serum of IUGR
Infants
In this present study, the serum DNA methylation level of
IGFBP-3 was measured by MS-HRM.The analysis of all
samples was repeat ed twice b y HR M an d part sample ran d oml y
selected were measured by MSP. We also tested whether
varying amounts of bisulfite treated target DNA would
influence HRM results. We found no differences in methylation
ratios when using two different DNA amounts (50 ng versus 10
ng).
Results showed that lower methylation level of found in
IUGR infants compared with normal control baby (P < 0.01,
T-test). It could be inferred that certain relation might exist
between the IGFBP-3 methylation and the development of
IUGR. Different methylation level was also found in different
gender of newborn. It can b e s een t hat the methylation level of
Figure 1. Correlation between Tm value and methylation level
measured by MS-HRM.
Y. DU ET AL.
Copyright © 2012 SciRes. ENG
108
IGFBP-3 in female new-born baby was lower than that male
ones (P<0.01, T-test) (Figure 2).The detection results by MSP
in part sample was consistent with that of MS-HRM (data not
shown).
Lower birth weight is one of the important indicators in
IUGR infant’s diagnosis. The IGFBP-3 methylation level was
also assayed according to the different birth weight of new-born
baby (Figure 3A). The results showed that the IGFBP-3 me-
thylation level was increased with the birth weight (Figure 3B).
4. Discussion and Conclusion
Several reported studies have investigated that IUGR is
correlation with mother's nutrition, placenta, umbilical cord
dysplasia, intrauterine hypoxia ischemia, disease and so on.
Recently, the function of IGF-1 and IGFBP-3 in regulation of
growth and development was more and more concerned in the
study of IUGR. Epigenetic changes such as DNA methylation
play an important role in gene expression and development of
many diseases. The aim of this study is to investigate whether
the methylation status of IGFBP-3 gene promoter was related
with IUGR. The results indicated that the serum DNA
methylation of IGFBP-3 promoter was strongly correlated with
IUGR. It is consistent with the finding of previous study that
gene mutation of IGFBP-3 resulted in Silver-Russell syndrome
(SRS) , a severe IUGR, and also lead to hypo-methylation[13].
It is said that DNA methylation play key roles in X-
inactivation which may lead to methylation difference between
male and female[14]. Just as the result obtained in this study,
some research also indicated that DNA methylation level was
different between male and female ones. While inconsistent
results were found in other studies. In this study, higher
methylati on l evel was foun d in male fet us may ind icate th at th e
development of IUGR was different between male and female
fetus.
Previous studies reported that the promoter methylation of
certain gene was related with birth weight of newborn [15,16].
In this study, we found that DNA methylation of IGFBP-3 was
positive correlation to birth weight of newborn, the other
possible factor such as the age of mother and nutrition, twin
pregnancy etc. exclu ded. It is consistent with the fact th at IUGR
will more likely result in low birth weight of newborn.
Figure 2. Methylation level of IGFBP-3 in serum of I UG R infants.
A
B
Figure 3. Correlation between methyla tio n le ve l and birth weight of
IUGR infants.
In this present study, cell free DNA separated from serum
was used to study the gene methylation level in IUGR infants
and controls, and hypo-methylation of IGFBP-3 promoter was
detected in IUGR infants comparing with the controls. It is
suggested that DNA methylation affect the development of
IUGR which pro vides t he theo retical basi s an d reference for t he
prevention and treatment of IUGR.
5. Acknowledgements
This work was supported by Wu, Q. from National Natural
Science Foundation of China (Grant No.81102182) and the
Priority Academic Program Development of Jiangsu Higher
Education Institutions (PAPD).
REFERENCES
[1] W. E. Hoy, R. N. Douglas-Denton, M. D. Hughson, A. Cass, K.
John son, and J. F. B ertram, "A stereologi cal stud y of glomerular
number and volume: preliminary findings in a multiracial study
of kidneys at autopsy," Kidney Int Suppl, pp. S31-7, Feb 2003.
Y. DU ET AL.
Copyright © 2012 SciRes. ENG
109
[2] K. A. Woods, C. Camacho-Hubner, D. Barter, A. J. Clark, and M.
O. Savage, "Insulin-like growth factor I gene deletion causing
intrauterine growth retardation and severe short stature," Acta
Paediatr Supp l, vol. 423, pp. 39-45, Nov 1997.
[3] L. C. Giudice, F. de Zegher, S. E. Gargosky, B. A. Dsupin, L. de
las Fuentes, R. A. Crystal, R. L. Hintz, and R. G. Rosenfeld,
"Insulin-like growth factors and their binding proteins in the term
and preterm human fetus and neonate with normal and extremes
of intrauterine growth," J Clin Endocrinol Metab, vol. 80, pp.
1548-55, May 1995.
[4] A. M. Carter, M. J. Kingston, K. K. Han, D. M. Mazzuca, K.
Nygard, and V. K. Han, "Altered expression of IGFs and
IGF-binding proteins during intrauterine growth restriction in
guinea pigs," J Endocrin ol, vol. 184, pp. 179-89, Jan 2005.
[5] M. Faxen, J. Nasiell, A. Blanck, H. Nisell, and N. O. Lunell,
"Altered mRNA expression pattern of placental epidermal
growth factor receptor (EGFR) in pregnancies complicated by
preec lampsi a and/or intrau terin e growth ret ardat ion," Am J Per i-
nat o l , vol. 15, pp. 9-13, Jan 199 8.
[6] A. Lorente, W. Mueller, E. Urdangarin, P. Lazcoz, A. von
Deimling, and J. S. Castresana, "Detection of methylation in
promoter sequences by melting curve analysis-based semiquan-
titative real time PCR," BMC Cancer, vol. 8, p. 61, 2008.
[7] S. E. Cottrell, "Molecular diagnostic applications of DNA me-
thylation technology," Clin Biochem, vol. 37, pp. 595-604, Jul
2004.
[8] C. T. Wittwer, G. H. Reed, C. N. Gundry, J. G. Vandersteen, and
R. J. Pryor, "High-resolution genotyping by amplicon melting
analysis using LCGreen," Clin Chem, vol. 49, pp. 853-60, Jun
2003.
[9] M. Frommer, L. E. McDonald, D. S. Millar, C. M. Collis, F.
Watt, G. W. Grigg, P. L. Molloy, and C. L. Paul, "A genomic
sequencing protocol that yields a positive display of
5-me thyl cytosi ne resid ues in individua l DNA strand s," P roc Natl
Acad Sci U S A, vol. 89, pp. 1827-31, Ma r 1 1992.
[10] T. K. Wojdacz and A. Dobrovic, "Methylation-sensitive high
resolution melting (MS-HRM): a new app roach f or sensi tive and
high-throughput assessm ent of methylation," Nucleic Acids Res,
vol. 35, p. e 4 1, 2 007.
[11] H. Nakagawa, R. B. Chadwick, P. Peltomaki, C. Plass, Y. Na-
kamura, and A. de La Chapelle, "Loss of imprinting of the insu-
lin-like growth factor II gene occurs by biallelic methylation in a
core region of H19-associated CTCF-binding sites in colorectal
cancer," Proc Natl Acad Sci U S A, vol. 98, pp. 591-6, Jan 16
2001.
[12] J. Worm, A. Aggerholm, and P. Guldberg, "In-tube DNA me-
thylation profiling by fluorescence melting curve analysis," Clin
Chem, vol. 47, pp. 1183-9, 2001.
[13] I. C. Beserra, M. G. Ribeiro, P. F. Collett-Solberg, M. Vaisman,
and M . M . Gu i ma ra es, " IGF-I and IGF Binding Protein-3 Gener-
ation Tests and Response to Growth Hormone in Children with
Silver-Russell Syndrome," Int J Pediatr Endocrinol, vol. 2010, p.
546854.
[14] A. D. Riggs, "X inactivation, differentiation, and DNA methyla-
tion," Cytogenet Cell Genet, vol. 14, pp. 9-25, 1975.
[15] A. C. Filiberto, M. A. Maccani, D. Koestler, C. Wil-
helm-Benartzi, M. Avissar-Whiting, C. E. Banister, L. A. Gagne,
and C. J. Marsit, "Birthweight is associated with DNA promoter
methylation of the glucocorticoid receptor in human placenta,"
Epigenetics, vol. 6, pp. 566-72, May .
[16] J. C. Ferreira, S. Choufani, D. Grafodatskaya, D. T. Butcher, C.
Zhao, D. Chitayat, C. Shuman, J. Kingdom, S. Keating, and R.
Weksberg, "WNT2 promoter methylation in human placenta is
associated with low birthweight percentile in the neonate," Epi-
genetics, vol. 6, pp. 440-9, Apr.