American Journal of Molecular Biology, 2013, 3, 241-247 AJMB
http://dx.doi.org/10.4236/ajmb.2013.34031 Published Online October 2013 (http://www.scirp.org/journal/ajmb/)
Identification of a SSR marker (TOM-144) linked to
Fusarium wilt resistance in Solanum lycopersicum
Pritesh Parmar1, Ankit Sudhir1, R. Preethi1, Bhaumik Dave1, Ketankumar Panchal1,
Ramalingam Bhagwathi Subramanian1*, Arvind Patel2, K. B. Kathiria2
1B. R. D. School of Biosciences, Sardar Patel University, Vallabh Vidyanagar, India
2Vegetable Research Station, Anand Agricultural University, Anand, India
Received 2 September 2013; revised 30 September 2013; accepted 10 October 2013
Copyright © 2013 Pritesh Parmar et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT
With the discovery of molecular markers and marker
assisted selection technology, the research has entered
into a new era and has made it possible to develop
new and more informative PCR-based markers, in-
cluding SSR, and to further facilitate the use of mark-
ers in tomato breeding. The present study is a step to
introduce a new SSR marker (TOM-144) which was
deduced after evaluation of eight microsatellite loci
amongst the twenty-one different tomato cultivars. The
marker selected was inherited and segregated in men-
delian fashion as demonstrated in successive genera-
tion of a cross between parent cvs. H-24 x GT-2.
Keywords: Fusarium Wilt; Molecular Marker; Tomato
1. INTRODUCTION
Tomato is the world’s second largest vegetable crop
which is consumed all over the world; its production
could not compete with the demand as it is threatened by
lethal diseases. Among these, Fusarium wilt is a vascular
disease, cause the wilt which starts from tender leaves,
then spreading the infection up to the tip of root, leading
to complete destruction of the plant. Fusarium wilt is one
of the devastating causes for the drastic decrease in to-
mato yield in India with the occurrence of race 1 patho-
type. Breeding started way back in 1930 for improve-
ment of overall horticulture characteristic. As market
demand developed for more specific traits, breeding
technology was more specialized, relying solely on PS
(phenotypic selection). It is time consuming and depends
on environmental conditions. Breeding, a new variety,
takes between eight and twelve years and even then the
release of an improved variety cannot be guaranteed.
Field trial methods are also conducted, where the tomato
plants growing in the field are deliberately infected with
the fungus and then breeders select the plants based on
their visible or measurable traits, called phenotypes. But
the phenotypic properties may vary due to changes in the
environment and also conditions of cultivation of varie-
ties. Above all, these practices and experiments are very
much time consuming and labour intensive [1].
Till date, there is no rapid and reliable method avail-
able except molecular makers which can identify the
cultivars. Of course methods like in vitro and in vivo are
being practiced since decades but that itself requires con-
firmation with an efficient method. Hence, breeders are
extremely interested in new technology that could make
this procedure more efficient. Molecular marker tech-
nology offers such a possibility by adopting a wide range
of novel approaches to improve the selection strategies in
tomato breeding. DNA marker technology has been used
in commercial plant breeding programmes since the early
1990s, and has proved helpful for the rapid and efficient
transfer of useful agronomically important traits into
desirable varieties and hybrids. Marker technology can
potentially overcome at least some of the limitations as-
sociated with PS, major that they are “neutral” in phe-
notypic reactions, that is, they do not have any plei-
otropic effect on the phenotype, nor are they influenced
in their segregation and inheritance by the growing con-
ditions of the plant. In advance, molecular markers can
be detected at any growth stages, strengthening the pos-
sibility of selecting plants on the basis of convenience to
the breeder, in contrast to the season-bound nature of PS
[2].
Currently, most of the markers used for tomato genetic
mapping and breeding purposes are PCR-based, includ-
ing RAPD, SSR or microsatellite, AFLP, SCAR, CAPS,
SNP and InDel markers. Co-dominant markers are mark-
ers for which both alleles are expressed when co-occur-
*Corresponding author.
OPEN ACCESS
P. Parmar et al. / American Journal of Molecular Biology 3 (2013) 241-247
242
ring in an individual. Therefore, with co-dominant mark-
ers, heterozygotes can be distinguished from homozy-
gotes, allowing the determination of genotypes and allele
frequencies at loci. In contrast, band profiles of dominant
markers are scored as the presence or absence of frag-
ments of a particular size, and heterozygosity cannot be
determined directly. Co-dominant markers are preferred
for most applications. The majority of co-dominant mar-
kers are single locus markers, and hence the degree of in-
formation per assay is usually lower compared to the
multilocus techniques. Because only small quantities of
template DNA (5 - 100 ng per reaction) are required,
techniques which are based on the PCR are currently
preferred. SSR markers, or microsatellite markers, are
one of the co-dominant markers used in genetic research
today. SSR markers are stretches of DNA, in which the
same short nucleotide sequence is repeated over and over.
Eukaryotic genomes contain a large number of SSRs.
This abundance allows their use for the construction of
high-density genetic maps and enables the molecular
tagging of genes polymorphism, or variation. Among
SSR markers, it is determined by the number of times
and the base sequence repeats (e.g. AGTTAGTT vs.
AGTTAGTTAGTTAGTT). “This variation in DNA se-
quence can be used just like other types of DNA se-
quence variation to locate nearby gene”. SSR markers
are considered highly polymorphously as the number of
re- peats can vary greatly among plants. The nature of
SSRs gives them a number of advantages over other mo-
lecular markers: 1) multiple SSR alleles may be detected
at a single locus using a simple PCR-based screen; 2)
SSRs are evenly distributed all over the genome; 3) they
are co-dominant; 4) very small quantities of DNA are re-
quired for screening; and 5) analysis may be semi-auto-
mated.
The present study focuses on the introduction of new
SSR marker which is being inherited and segregated in
mendelian fashion for the application of MAS against
Fusarium wilt resistance in tomato.
2. MATERIALS AND METHODS
2.1. Plant Material
A total of twenty one tomato cultivars were used in this
study. Among them, seventeen cultivars, LSVT-4, LSVT-
6, LSVT-7, LSVT-1, Gujarat Tomato-2, LSVT-2, LSVT-
3, LSVT-5, JT-3, AT-3, H-24, Junagadh ruby, KS-17,
Pusa ruby, NDT-96, Wild, Gujarat Tomato-1 were col-
lected and maintained at vegetable section of Anand Ag-
riculture University, Anand; and four cultivars, Heam-
sona, Namdhari, Hemsikhar, Saktiman from the local
fields of Bakrol and Anand, Gujarat state, India.
2.2. Disease Evaluation
Tomato cultivars used in the study was categorised into
susceptible, partial resistant and resistant as per the
method of [3].
2.3. DNA Extraction
Tomato genomic DNA were extracted as the method of
Oza et al. [4] and fungal genomic DNA was as the pro-
tocol of Sambrook et al. [5].
2.4. Race Identification
Race of the fungal culture used in the study was identi-
fied as per the direction of Parmar et al. [6].
2.5. SSR Genotyping
Tomato specific microsatellite containing sequences
from chromosome 7 and 11 were obtained from SGN
and other literatures [7,8]. A total of eight primer pairs
(Table 1) were used to evaluate genetic polymorphism
among the twenty one selected cultivars and to identify a
marker linked to Fusarium wilt resistance.
Table 1. Microsatellite markers, sequence information, repeat motifs and allele size used for the genetic diversity analysis in tomato
(Solanum lycopersicum).
Locus Size Motif Annealing temperaturePrimer pairs 5’-3’
SSR-45 246 (AAT)n 50 TGTATCCTGGTGGACCAATG TCCAAGTATCAGGCACACCA
SSR-52 202 (AAC)n 50 TGATGGCAGCATCGTAGAAG GGTGCGAAGGGATTTACAGA
SSR-67 900 (AGA)2
(AAG)7 58 GCACGAGACCAAGCAGATTA
GGGCCTTTCCTCCAGTAGAC
SSR-108 217 (TC)n 50 TGTGTTGGATGTTTGGCACT GCCATTGAAACTTGCAGAGA
SSR-136 148 (CAG)n 50 GAAACCGCCTCTTTCACTTG CAGCAATGATTCCAGCGATA
SSR-637 200 (GATA)24, (AT)9, (GT)25 50 AATGTAACAACGTGTCATGATTC AAGTCACAAACTAAGTTAGGG
Tom-144 144 (TAT)15
(TGT)4 45 CTGTTTACTTCAAGAAGGCTG
ACTTTAACTTTATTATTGCGACG
Tom-196 196 (AAT)6 45 CCTCCAAATCCCAAAACTCT TGTTTCATCCACTATCACGA
Copyright © 2013 SciRes. OPEN ACCESS
P. Parmar et al. / American Journal of Molecular Biology 3 (2013) 241-247 243
Amplification was carried out in 12.5 μl of reaction
mixture, containing 3.9 distilled water, 1.3 μl of 10 x
assay buffer with 15 mM MgCl2, 2 μl of 100ng template
DNA, 2 μl of primer (both forward and reverse), 1 μl
dNTP mix and 0.3 μl Taq DNA polymerase (3 U/µl).
PCR was performed in a thermal cycler (Eppendorff)
with profile: initial denaturation at 95˚C for 1 min, fol-
lowed by 35 cycles of denaturation at 95˚C for 30 sec.,
annealing as per the primers for 45 sec., extension at
72˚C for 45 sec. and finally extension at 72˚C for 5 min.
The amplified products were size separated by electro-
phoresis in 2% (w/v) Agarose (Sigma type IV) gel with 1
X TAE buffer, stained with ethidium bromide and ob-
served with a UV transilluminator. In all cases, step up
100 bp (Merck make) was used as molecular size marker.
2.6. Mapping Population
An F1 mapping population was developed from the cross
between parents Gujarat tomato cultivar GT-2 and H-24
that is widely grown in local fields of Gujarat, India. The
cultivated parent GT-2 represents a pure line selection
from a landrace and was used as a female in the cross
and H-24 as a donor. The F1 populations of 10 plants
were used for mapping.
2.7. Bulk Segregation Analysis
To identify inheritance and segregation pattern of se-
lected SSR markers, bulks were made from the basic
mapping population of hybridization between cvs. H-24
x GT-2 on the basis of phenotypic evaluation through in
vitro bioassay. The F1 population consisted of 10 indi-
viduals were scrutinized for segregation.DNA was ex-
tracted as described earlier. Aliquots (2.5 µg of DNA) of
each individual homozygous for one or the other allele of
the targeted gene were bulked together. The bulks were
screened with TOM 144 primer for the segregation pat-
tern.
2.8. Data Analysis
The data obtained from the individuals of first generation
(F1) after the crossing for Fusarium wilt reaction of de-
tached-leaflet assays were tested for its significance from
the expected Mendelian ratio of 1:1 using chi-square (x2)
test using software SPSS version 8.0.
3. RESULTS
3.1. Race Identification of Fusarium oxysporum
f. sp. lycopersici
According to Parmar et al. [6] both the isolates were be-
long to Race 1 type of Fusarium oxysporum f. sp. ly-
copersici.
3.2. Disease Evaluation
As per the direction of Parmar et al. [3], the in vitro reac-
tion of tomato cultivars were identified. The cultivars that
showed symptoms after 24 hrs of treatment were LSVT-4,
LSVT-6, LSVT-7, Namdhari. After 48 hrs, cultivars
LSVT-1, GT-2, Heamsikhar, showed chlorosis at pe-
riphery while the cultivars LSVT-2, LSVT-3, LSVT-5,
JT-3, Heamsona, Saktiman, AT-3, H-24, SL-120, KS-118,
Maha-2, Feb-4 remained asymptomatic. Phenotypic
evaluation of twenty one tomato cultivars by bioassay led
to the identification of three specific groups of genotypes
based on identical characteristics. The three groups are, 1)
susceptible with LSVT-4, LSVT-6, LSVT-7, and Namd-
hari; 2) Tolerant with LSVT-1, GT-2, and Heamsikhar; 3)
Resistant with twelve varieties LSVT-2, LSVT-3, LSVT-
5, JT-3, Heamsona, Saktiman, AT-3, H-24, SL-120, KS-
118, Maha-2, Feb-4.
3.3. SSR Genotyping
In the present study, a total of eight primers were analysed,
which were dispersed on chromosome 7 and 11 of tomato.
Of the eight primers used, two loci were observed to be
polymorphic. The polymorphic markers include SSR 67
and Tom 144. These two markers clearly showed the
discrimination between the susceptible and resistant cul-
tivars which were grouped phenotypically by conven-
tional in vitro and in vivo bioassay.
The TOM 144 revealed different sized allele in sus-
ceptible and resistant cultivars. The profile showed both
199 + 299 bp band for all the twelve resistant cultivars
that are LSVT-2, LSVT-3, LSVT-5, JT-3 (Figures 1-3),
Figure 1. Polymorphic profile obtained with Tom144 primer.
Resistant cultivars JT-3, Lsvt-2, Lsvt-3, Lsvt-5 show bands
for allele of 299bp and 199bp, sensitive cultivar Lsvt-4
shows band for allele of 199bp, and no amplicon with toler-
ant variety Lsvt-1.
Copyright © 2013 SciRes. OPEN ACCESS
P. Parmar et al. / American Journal of Molecular Biology 3 (2013) 241-247
244
199 bp
Figure 2. Polymorphic profile obtained with Tom144
primer. Both sensitive cultivars Lsvt-6, Lsvt-7 show band
for allele of 199 bp.
Figure 3. Polymorphic profile obtained with Tom144 primer.
Resistant cultivars heamsona, saktiman, AT-3 show bands for
allele of 299 bp and 199 bp, sensitive cultivar namdhari shows
band for allele of 199 bp, and no amplicon with tolerant varie-
ties heamsikhar, GT-2.
Heamsona, Saktiman, AT-3, H-24, SL-120, KS-118,
Maha-2, Feb- 4, only 199 bp band for the four sensitive
cultivars (Figures 2-4), LSVT-4, LSVT-6, LSVT-7, and
Namdhari and no band was seen for the tolerant varieties,
LSVT-1, GT-2, and Heamsikhar (Figures 1-3).
With ssr 67 a single allele of 900 was reported only in
susceptible cultivars where as resistant cultivars showed
900 + 900 bands. In order to discriminate the two alleles
of same size image J software (NIH, USA) was used to
justify the intensity variation between the two. Analysis
revealed a clear cut difference between the two alleles
with twice the intensity in resistant cultivars compared to
susceptible cultivars. (Figure 4) [9].
Figure 5 shows the profile of eight cultivars with ap-
plication of SSR-45. In this an allele of size 246 bp was
observed in all eight cultivars generating a monomorphic
profile. Six of the eight SSR primer sets were found to be
monomorphic amongst the cultivars used some of the
primer reported occurrence of null alleles. (Figures 6-10).
Occurrence of null allele was taken in to consideration
rather than discarding it to produce important finding that
it can be used to produce a group with implication that
there some relatedness and relationship among the culti-
vars.
Amongst the two polymorphic primer sets, Tom 144
primer set was selected for the further studies as it is not
being reported as a molecular marker.
3.4. Inheritance of Marker
Once polymorphic marker was identified, a group of 10
Figure 4. A highly polymorphic profile obtained with use
of SSR 67 marker. Resistant cultivars like wild, NDT-96
and Heamsona show alleles of 900 + 900 bp in comparison
to KS-17, GT-1, and GT-2 with 900 bp allele and null al-
lele with JR and PR.
Figure 5. Monomorphic profile obtained with
SSR-45 marker. Allele of size 246 was com-
monly observed in all the cultivars.
Figure 6. Monomorphic profile obtained from
eight tomato cultivars after amplication with
Tom 196. Three cultivars showed occurrence
of null allele with no amplicons.
Copyright © 2013 SciRes. OPEN ACCESS
P. Parmar et al. / American Journal of Molecular Biology 3 (2013) 241-247 245
Figure 7. Monomorphic profile obtained from eight
tomato cultivars after amplification with primer SSR-
108. Three cultivars showed occurrence of null allele
with no amplicon.
Figure 8. Monomorphic profile obtained from eight
tomato cultivars after amplification with primer SSR-
136. Three cultivars showed occurrence of null allele
with no amplicon.
Figure 9. Monomorphic profile obtained from eight
tomato cultivars after amplification with primer SSR-
52. Three cultivars showed occurrence of null allele
with no amplicon.
Figure 10. Monomorphic profile obtained from eight
tomato cultivars after amplification with primer
SSR-637. Three cultivars showed occurrence of null
allele with no amplicon.
F1 plants from each population was assayed to identify
the loci that deviated significantly 1:1 (homozygous for
the SSR allele contributed by the female parent: het-
erozygous: homozygous for the SSR allele contributed
by the male parent). Bulk segregation analysis was per-
formed with two bulks, a resistant and tolerant bulks
produced at F1 level. Figure 11 shows the amplification
pattern of two bulks along with parents obtained through
the application of TOM 144 as a marker. The results
show a clear-cut segregation pattern of 1:1 at F1 level
(Figure 12).
4. DISCUSSION
Classically, plant pathogens have been identified on the
basis of morphological features and growth characteris-
tics on specific media. However, because of their specific
limitations, these techniques are increasingly being com-
Figure 11. Bulk segregation analysis of resistant and
tolerant bulks with parents GT-2(P1) and H-24(P2)
using marker TOM 144. R = Resistant, T = Tolerant,
M = Marker.
Figure 12. Chi square test analysis to validate the segrega-
tion pattern.
Copyright © 2013 SciRes. OPEN ACCESS
P. Parmar et al. / American Journal of Molecular Biology 3 (2013) 241-247
246
plemented or replaced by molecular technologies, of
which those based on detection of pathogen DNA or
RNA are the most predominant [10]. In general, the mo-
lecular techniques are faster, more specific, more sensi-
tive and more accurate than the traditional methods, and
can be performed and interpreted by personnel with no
taxonomical specialized expertise. In addition and per-
haps, even more importantly, these techniques allow de-
tection of microorganisms that cannot be cultivated in
vitro [10].
In the present study, SSRs were selected as they are
relatively abundant with uniform genome coverage,
co-dominant, robust and reproducible, and the method is
PCR based. In addition, a number of workers have dem-
onstrated that these markers often cosegregated along
with the disease resistance gene. In the present study, the
TOM 144 is found to be polymorphic molecular marker
and is associated with resistance against race 1 of Fol.
The present investigation also revealed the occurrence
of “Null alleles” in various cultivars possibility as a re-
sult of non-amplification because of mutation/s at a
primer binding site or insertion or deletion of the genetic
segment. Dropping data from problem loci may then
prove to be an impractical option, as any omission of loci
would substantially reduce inferential and discriminatory
power of the study [11]. Consequently, many studies
have simply included loci with null alleles in their
analyses [12] without explicitly considering the conse-
quences. A better option for correcting for errors caused
by null alleles would be to accommodate them in data
analysis [13]. In this study, the null alleles have been
taken into consideration to show the relationship and
relatedness among the accessions of tolerant class.
Several approaches have been suggested to saturate ge-
nomic regions of interest with molecular markers. Theses
include preselection using NILs, preparative pulse field
gel electrophoresis and chromosome walking and jump-
ing. Bulk segregation analysis provides a rapid, techni-
cally simple alternative for identifying a marker linked to
the specific gene. Bulk segregation analysis overcomes
several problems inherent in using NILs or cytogenetic
stocks to identify markers linked to particular genes.
There is a minimal chance that regions unlinked to the
target region will differ between the bulked samples of
many individuals [14]. In this study, bulked segregation
analysis was successfully employed to identify the seg-
regation pattern of a molecular marker linked to a gene
for resistance in tomato against Fol.
Bulked segregation analysis overcomes several prob-
lems inherent in using NILs or cytogenetic stocks to
identify markers linked to particular genes. There is a
minimal chance that regions unlinked to the target region
will differ between the bulked samples of many indi-
viduals. In contrast, even after five backcrosses, only half
of the polymorphic loci between NILs are expected to
map to the selected region [14].
A locus to be used as an efficient marker for the iden-
tification of a specific trait should be co-segregating in
the subsequent generation. Few reports have examined
the segregation ratios of microsatellite alleles in plants.
Eileen et al. [15] found two of hundred SSR loci linked
to tomato colour were co-segregated with expected pat-
tern 1:2:1 at F2 generation. Similar pattern was also
achieved at F2 generation by Cregan et al. [16], while
looking at linkage analysis of markers in soyabean. In
the present study, an identical co-segregation ratio was
achieved at F1 generation (1:1) which implies that it is a
reliable marker which can be employed efficiently in
identification and classification of resistant cultivars.
Parmar et al. [9] reported the primer set SSR-67, a
molecular marker linked to the disease resistance which
could be employed for the discrimination of susceptible
and resistant entity amongst the tomato population. The
marker was also used in the present investigation and it
worked efficiently but it was noticed that it requires the
expertise with good eyesight or extra software for the
discrimination of 900 + 900 allele. In addition to this, it
also needs special care of application of equal quantity of
DNA from all the samples to be used in amplification
reaction, without it that the output will be misinterpreted
by software or professional. In order to simplify it in
present study, TOM-144 primer set was recommended to
be used as a marker for the discrimination of susceptible
and resistant entity amongst the tomato population as it
has different allele size that is 199 + 299 base pair that
can be amplified in resistant only in comparison to sensi-
tive one with only 199 base pair allele.
In conclusion, the molecular marker TOM 144 linked
to Fusarium wilt resistance against race 1 can be exe-
cuted for the discrimination of resistant, susceptible and
partial resistant amongst the tomato population.
5. ACKNOWLEDGEMENTS
This work was supported under University Grants commission (UGC)
scheme for Identification of molecular markers linked to resistant in
tomato, Government of India. We would like to thank Indian type
culture collection for providing us the fungal culture F-1322.
REFERENCES
[1] Tanksley, S.D. and McCouch, S.R. (1997) Seed banks
and molecular maps: Unlocking genetic potential from
the wild, Science, 277, 1063-1066.
http://dx.doi.org/10.1126/science.277.5329.1063
[2] Foolad, M.R. and Panthee, D.R. (2012) Marker-assisted
selection in tomato breeding. Critical Reviews in Plant
Sciences, 31, 93-123.
http://dx.doi.org/10.1080/07352689.2011.616057
Copyright © 2013 SciRes. OPEN ACCESS
P. Parmar et al. / American Journal of Molecular Biology 3 (2013) 241-247
Copyright © 2013 SciRes.
247
OPEN ACCESS
[3] Parmar, P.P., Oza, V.P., Patel, A.D., Kathiria, K.B. and
Subramanian, R.B. (2011) Development of a rapid and
reliable bioassay to discriminate between susceptible and
resistant cultivars of tomato against Fusarium wilt. Inter-
national Journal of Biosciences Agriculture and Tech-
nology, 3, 6-11.
[4] Oza, V., Trivedi, S., Parmar, P. and Subramanian, R.B.
(2008) A simple, rapid and efficient method for isolation
of genomic DNA from plant tissue. Journal of Cell and
Tissue Research, 8, 1383-1386.
[5] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Mo-
lecular cloning: A laboratory manual, 2nd Edition, Cold
Spring Harbor Lab. Press, New York.
[6] Parmar, P., Gandhi, M. and Subramanian, R.B. (2012)
Isolation and molecular characterization of avirulence
gene from Indian isolates of Fusarium oxysporum f. sp.
Lycopersici. Journal of Cell and Tissue Research, 12,
3061-3067.
http://dx.doi.org/10.1139/g98-155
[7] Areshchenkova, T. and Ganal, M.W. (1999) Long tomato
microsatellites are predominantly associated with cen-
tromeric regions. Genome, 42, 536-544.
[8] Suliman-Pollatschek, S., Kashkush, K., Shats, H. and
Lavi, U. (2002) Generation and mapping of AFLP, SSRs
and SNPs in Lycopersicon esculentum. Cellular Molecu-
lar Biology Letters, 7, 583-597.
[9] Parmar, P., Bhatt, K., Oza, V., Kathiria, K. B. and Subra-
manan, R.B. (2009) Microsatellite marker associated with
Fusarium wilt resistance in tomato. World Journal of Ag-
ricultural Sciences, 5, 389-393.
[10] Lievens, B., Rep, M. and Thomma, B.P. (2008) Recent
developments in the molecular discrimination of formae
speciales of Fusarium oxysporum. Pest Management
Science, 64, 781-788.
http://dx.doi.org/10.1002/ps.1564
[11] Marshall, T.C., Slate, J., Kruuk, L.E.B. and Pemberton,
J.M. (1998) Statistical confidence for likelihood based
paternity inference in natural populations. Molecular
Ecology, 7, 639-655.
http://dx.doi.org/10.1046/j.1365-294x.1998.00374.x
[12] Dakin, E.E. and Avise, J.C. (2004) Microsatellite null
alleles in parentage analysis. Heredity, 93, 504-509.
http://dx.doi.org/10.1038/sj.hdy.6800545
[13] Sobel, E., Papp, J.C. and Lange, K. (2002) Detection and
integration of genotyping errors in statistical genetics.
American Journal of Human Genetics, 70, 496-508.
http://dx.doi.org/10.1086/338920
[14] Michelmore, R.W., Paran, I. and Kesseli, R.V. (1991)
Identification of markers linked to disease resistance
genes by bulked segregation analysis: A rapid method to
detect markers in specific genomic regions by using seg-
regating populations. Proceedings of the national acad-
emy of sciences, 88, 9828-9832.
http://dx.doi.org/10.1073/pnas.88.21.9828
[15] Eileen, K., Wencai, Y. and Francis, D.M. (2004). Im-
proved tomato fruit color within an inbred backcross line
derived from lycopersicion esculentum and L. hirsutum
involves the interaction of loci. Journal of the American
Society for Horticultural Science, 129, 250-257.
[16] Cregan, P., Van Berkum, P., Sloger, C. and Orellana, R.G.
(1989) Heterosis of interspecific soybean hybrids for
traits related to N2 fixation. Euphytica, 40, 89-96.