Pharmacology & Pharmacy, 2013, 4, 478-483
http://dx.doi.org/10.4236/pp.2013.46069 Published Online September 2013 (http://www.scirp.org/journal/pp)
Changes in mRNA Expression and Activity of Xenobiotic
Metabolizing Enzymes in Livers from Adjuvant-I nduced
Arthritis Rats
Atsushi Kawase, Syoko Wada, Masahiro Iwaki*
Department of Pharmacy, School of Pharmacy, Kinki University, Osaka, Japan.
Received June 26th, 2013; revised August 1st, 2013; accepted August 16th, 2013
Copyright © 2013 Atsushi Kawase et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT
Pathophysiological changes in human patients and in animal models of infection or inflammation are associated with
alterations in the production of numerous liver-derived proteins including metabolizing enzymes. In this study, the ef-
fects of adjuvant-induced arthritis (AA) in rats on the levels of mRNA and activity of hepatic xenobiotic metabolizing
enzymes were determined during the inflammatory response. The mRNA levels of cytochrome P450 (CYP) 1A2,
CYP2C12, CYP2D1, CYP2D2, and CYP3A1 were significantly decreased compared with control levels in almost all
phases of inflammation. A reduction in the activity of CYP2C and CYP3A, which are abundantly expressed in the liver,
was also observed. For phase II metabolizing enzymes, mRNA levels of uridine 5’-diphospho-glucuronosyltransferase
(UGT) 1A1, UGT1A6, sulfotransferase (SULT) 2A1, and glutathione S-transferase 2 were significantly decreased
compared with control levels. However, the mRNA levels of UGT2B and SULT1A1 returned to control levels during
the subacute (7 d after adjuvant treatment) and chronic (21 d after adjuvant treatment) phases although these levels de-
creased during the acute (3 d after adjuvant treatment) phase. These results suggest that the effects of inflammation on
the expression of xenobiotic metabolizing enzymes differ depending on the isoform of the enzyme and could affect the
pharmacokinetics of each substrate.
Keywords: Inflammation; Arthritis; Enzyme; Cytochrome; Metabolism
1. Introduction
Pathophysiological changes in human patients and in
animal models of infection or inflammation are associ-
ated with immediate and often dramatic alterations in the
production of numerous liver-derived proteins, including
metabolizing enzymes such as cytochrome P450s (CYP),
UDP-glucuronosyltransferases (UGT), sulfotransferases
(SULT), and glutathione S-transferases (GST) [1,2]. In-
flammatory conditions such as rheumatoid arthritis and
Crohn’s disease have been shown to reduce hepatic
clearance of several highly cleared drugs [3-5]. Adju-
vant-induced arthritis (AA) in rats has been used as an
animal model for rheumatoid arthritis in the development
of new anti-inflammatory medicines because rats exhibit
a systemic inflammatory disease with similar bone and
cartilage alterations to those observed in rheumatoid ar-
thritis on day 3 (acute), day 7 (subacute) and day 21
(chronic) after adjuvant treatment [6]. Changes in the
pharmacokinetics and pharmacological effects of several
drugs via altered CYP activities and serum protein bind-
ing have been reported in AA rats, including elevated
plasma concentrations of cyclosporine A, acebutolol and
propranolol [4,7], and prolongation of sleeping time with
pentobarbital [8]. We also demonstrated that flurbiprofen
glucuronidation activity and CYP content in liver micro-
somes were reduced [9] and intestinal CYP3A activity
was decreased in AA rats [10]. Inflammatory cytokines,
for example, tumor necrosis factor (TNF)-α, interleukin
(IL)-6, and IL-1 could be involved in the decrease of me-
tabolizing enzymes [11-13]. The nuclear receptor NR1I2,
which is a pregnane X receptor (PXR) and NR1I3, which
is a constitutive androstane receptor (CAR), is involved
in the regulation of CYP transcription by interacting with
xenobiotics and endogenous toxins [14-16].
However, a comprehensive understanding of the chang-
ing profile of xenobiotic metabolizing enzymes in acute
*Corresponding author.
Copyright © 2013 SciRes. PP
Changes in mRNA Expression and Activity of Xenobiotic Metabolizing Enzymes in Livers
from Adjuvant-Induced Arthritis Rats
479
(3 d after adjuvant treatment), subacute (7 d after adju-
vant treatment) and chronic (21 d after adjuvant treat-
ment) phases of inflammation remains elusive, despite
their importance on the pharmacokinetics of drug-related
substrates. In this study, we examined the influence that
the inflammatory response in an AA rat model has on he-
patic enzymes involved in phase I (CYP1A2, CYP2C11,
CYP2D1, CYP2D2, and CYP3A1) and phase II
(SULT1A1, SULT2A1, UGT1A1, UGT1A6, UGT2B,
and GSTP2) metabolism.
2. Materials and Methods
2.1. Preparation of AA Rats
Female Sprague-Dawley rats (seven weeks old), weigh-
ing 180 - 240 g, were purchased from CLEA Japan, Inc.
(Tokyo, Japan). The animals were housed in a tempera-
ture-controlled room with free access to standard labora-
tory chow and water. Adjuvant was prepared from 100
mg heat-killed Mycobacterium butyricum (Difco Labo-
ratories, Detroit, MI, USA) suspended in 10 mL of Bayol
F oil. Hindpaw volumes were measured by liquid
plethysmometry. Animals were studied 5, 10, 24 and 3 d
(acute phase), 7 d (subacute phase), and 14 and 21 d
(chronic phase) after the injection of adjuvant or Bayol F.
AA rats in the acute phase exhibit local inflammation at
the treated site. In the chronic phase, severe inflamma-
tion was observed in local and systemic sites. The ex-
periments were approved by the Committee for the Care
and Use of Laboratory Animals at Kinki University
School of Pharmacy.
2.2. Measurement of mRNA
After the animals were anesthetized with diethyl ether,
the liver was perfused with ice-cold saline and then re-
moved. After flash freezing in liquid nitrogen, each sam-
ple was preserved at 80˚C until used for RNA extrac-
tion.
Determination of mRNA levels was performed using
real-time reverse transcriptase polymerase chain reaction
(RT-PCR) as previously described [17]. Total RNA (500
ng) was extracted from each liver and reverse-transcribed
to complementary DNA (cDNA) using a PrimeScript-RT
reagent Kit (TaKaRa, Shiga, Japan). Reactions were in-
cubated for 15 min at 37˚C and 5 sec at 85˚C. The re-
verse-transcribed cDNA was used as a template for real-
time RT-PCR. Amplification was performed in 50 μL
reaction mixtures containing 2 × SYBR Premix Ex Taq
(TaKaRa) and 0.2 mM of each primer set shown in Ta-
ble 1. PCRs were incubated at 95˚C for 10 sec, and then
amplified at 95˚C for 5 sec, 55˚C for 20 sec, and 72˚C for
31 sec for 40 cycles. Data was normalized to the amount
of 18S rRNA in each sample. The data were analyzed
Table 1. Primer sequence s use d in P CR assays.
Gene Primer sequence (5’-3’)
Forward: ACGTGAGCAAAGAGGCTAACCA
CYP1A2 Reverse:ATTAGCCACCGATTCCACCAC
Forward:CGCACGGAGCTGTTTTTGTT
CYP2C11 Reverse:GCAAATGGCCAAATCCACTG
Forward:GCAAAGTCTTCCCCAAGCTCA
CYP2D1 Reverse:GGAAGGCATCAGTCATGTCTCG
Forward:GCCTTTTTTTGGCACTGTGCT
CYP3A1 Reverse:GCATTTGACCATCAAACAACCC
Forward:GCCCGAAATGCAAAGGATG
SULT1A1 Reverse:TGCAGCTTGGCCATGTTGT
Forward:CAGTAGCCCAAGCTGAAGCCTT
SULT2A1 Reverse:CGGCCATTTTCTCCTGGAAA
Forward:CGGAGTTATTCAGCAGCTCCAG
UGT1A1 Reverse:GGTGCTATGACCACCACTTCGT
Forward: AACCTAGAAGAGTTGCGGACCC
UGT1A6 Reverse:CAGCAAAGTGGTTGTTCCCAA
Forward:TCCCCACCCAACATTACCAA
UGT2B Reverse:AGCAGGTTTGCAATGGAGTCC
Forward: GCAGCTCCCCAAGTTTGAAGA
GSTP2 Reverse:GGTGCCTCAAGATGGCATTAGA
Forward:CGCCGCTAGAGGTGAAATTC
18S rRNAReverse:CCAGTCGGCATCGTTTATGG
with ABI Prism 7000 SDS Software (Applied Biosys-
tems) using the multiplex comparative method.
2.3. Preparation of Hepatic Microsomes
Livers were perfused with ice-cold saline and chopped
into small pieces. A 25% (w/v) homogenate was made in
ice-cold 1.15% KCl solution using a Physcotron ho-
mogenizer. The homogenate was centrifuged at 12,000 g
for 20 min, and the supernatant was further centrifuged at
105,000 g for 60 min to obtain a microsomal pellet. The
microsomal pellet was washed by resuspending it in 3
mL of 1.15% KCl, and the suspension was centrifuged at
105,000 g for 30 min to obtain the final microsomal pel-
let, which was resuspended in 1.5 mL of 1.15% KCl and
stored at 80˚C until use. All procedures were carried out
at 4˚C. Protein concentrations were determined using a
BCA protein assay kit (Pierce Biotechnology, Rockford,
IL, USA).
2.4. CYP Activity Measurements
CYP3A activity was determined using a P450-Glo
CYP3A4 assay (Promega, Madison, WI, USA). P450-
Glo CYP3A4 was used to determine CYP3A1 and
Copyright © 2013 SciRes. PP
Changes in mRNA Expression and Activity of Xenobiotic Metabolizing Enzymes in Livers
from Adjuvant-Induced Arthritis Rats
480
CYP3A2 activities in rats and CYP3A4 activity in hu-
mans as per the manufacturer’s instructions. In brief,
CYP3A reactions were performed in a 96-well plate (Op-
tiPlate-96 (PerkinElmer, Waltham, MA, USA)). An in-
cubation mixture (50 μL total volume) was prepared,
containing 200 mM potassium phosphate buffer (pH 7.4),
NADPH regeneration system (Promega), 20 μg rat liver
microsomes and 50 μM of luciferin 6’ benzyl ether
(luciferin-BE) as a substrate for CYP3A1 and CYP3A2.
The concentrations of luciferin-BE were around the Km
values (50 μM). After preincubation for 10 min at 37˚C,
the reaction was initiated by addition of the NADPH re-
generation system and then incubated for 30 min at 37˚C
with constant shaking. The reconstituted luciferin detec-
tion reagent (50 μL) was then added to stop the reaction
and to generate chemiluminescence. CYP3A converts
luciferin-BE to luciferin by a debenzylation reaction and
the production of luciferin by CYP3A1 and CYP3A2
was determined using a luciferase assay. Luminescence
was measured using the FLUOstar Optima (Moritex,
Tokyo, Japan). CYP2C9 activity was determined using a
P450-Glo CYP2C9 assay (Promega). 100 μM of 6’-de-
oxyluciferin (luciferin-H) was used as a substrate for
CYP2C9. All other conditions were the same as for the
CYP3A assay. CYP2C9 converts 6’-deoxyluciferin (luci-
ferin-H) to luciferin and the production of luciferin by
CYP2C9 was determined using a luciferase assay. All
CYP isoform activity determinations were performed in
duplicate.
2.5. Statistical Analysis
Separate control groups were made for acute, subacute
and chronic phases. The differences between the AA and
control groups for (each of) the three phases were esti-
mated using the Student’s unpaired t-test.
3. Results and Discussion
Changes in mRNA levels of various xenobiotic metabo-
lizing enzymes from the CYP, UGT and SULT families
and GSTP during each response phase of inflammation
were determined. CYP1A2, CYP2C12, CYP2D1, CYP2-
D2, and CYP3A1 mRNA levels are shown in Figure 1.
The mRNA level of all examined CYPs exhibited sig-
nificant decreases 24 h after adjuvant treatment. Sanada
et al. demonstrated that the hepatic mRNA and protein
levels of inflammatory cytokines such as TNF-α, IL-6,
and IL-1 significantly increased by 24 h after adjuvant
treatment in rats [18]. The increased cytokines in the
early stage of inflammation could cause a reduction in
CYP mRNA levels. It is reported that IL-1β inhibits the
expression of various hepatic CYP isoforms [19]. The
recovery of CYP1A2, CYP2C12, and CYP2D1 mRNA
occurred by day 3. All examined CYP mRNAs were re-
duced to approximately half of control levels by day 21
(chronic phase).
These results showed that almost all examined CYP
isoforms significantly decreased in the acute, and sub-
acute and the chronic phases in the arthritic (rats) com-
pared with control rats. In particular, CYP3A1 mRNA
decreased to low levels 24 h after adjuvant treatment. It
is possible that the diminished expression of CYP3A1
could affect the pharmacokinetics of substrates because
CYP3A participates mainly in the metabolism of various
drugs. Figure 2 shows the alterations in the activities of
CYP2C and CYP3A, which have relatively high protein
content in the liver in each phase of inflammation. The
activity of CYP2C decreased going from the acute to the
chronic phase of inflammation and was less than 10% of
control levels in the subacute and chronic phases of in-
flammation. The activity of CYP3A also significantly de-
creased at 3, 14 and 21 d, suggesting that both protein
and mRNA levels had decreased. Total CYP2C metabo-
lizing activity showed a further decrease compared with
the mRNA level of CYP2C12 in AA rats. It could be that
the changes in expression of these other CYP2C isoforms,
such as CYP2C6 and CYP2C7, accounted for this dif-
ference between activity and mRNA level.
These results could be interpreted to mean that the ex-
pression of all examined CYP isoforms were suppressed
during inflammation and this decreased activity could
affect the pharmacokinetics of various drugs. The tran-
scription of CYPs is regulated by nuclear receptors such
as PXR and CAR. For example, the transcription of
CYP2B and CYP3A is known to be regulated through
CAR and PXR, respectively [20,21]. CAR and PXR
show overlapping regulation of transcription of CYPs
and transporters [22]. The effects of the phases of in-
flammation on the expression of nuclear receptors are
unclear but warrant examination.
To further clarify the effects of AA on other metabo-
lizing enzymes, we examined the alterations of SULTs,
UGTs and GSTP involved in the phase II metabolic
pathway. The changes in mRNA of three isoforms of
UGTs (UGT1A1, UGT1A6, and UGT2B) are shown in
Figure 3. UGT1A1 and UGT1A6 mRNAs exhibited
significant decreases in the acute, subacute, and chronic
phases of inflammation. On the other hand, UGT2B
showed little change from control levels except on day
one (acute phase). Interestingly, the distinct effects of
AA on the mRNA levels of UGT unlike CYP isoforms
were presented. The UGT1 locus is located on chromo-
some 2q37 and the UGT2 family is located on chromo-
some 4q13. UGT1A participates in the metabolism of
endobiotic substrates such as bilirubin and estrogens and
drug substrates such as irinotecan, imipramine and cy-
proheptadine [23]. It is possible that the metabolism of
substrates by UGT1A was affected by the inflammatory
Copyright © 2013 SciRes. PP
Changes in mRNA Expression and Activity of Xenobiotic Metabolizing Enzymes in Livers
from Adjuvant-Induced Arthritis Rats
Copyright © 2013 SciRes. PP
481
Figure 1. Changes in relative mRNA levels of CYP1A2, 2C12, 2D1, 2D2, and 3A1 in the liver of AA rats. The results are
expressed as the mean ± S.D. (n = 4). There were significant differences between control and AA rats (*p < 0.05).
Figure 2. Changes in relative metabolic activities of CYP2C and 3A in the liver of AA rats. The results are expressed as the
mean ± S.D. (n = 4). There were significant differences between control and AA rats (*p < 0.05).
Figure 3. Changes in relative mRNA levels of UGT1A1, 1A6, and 2B in the liver of AA rats. The results are expressed as the
mean ± S.D. (n = 4). There were significant differences between control and AA rats (*p < 0.05).
response in AA rats. It has been reported that UGT1A
and UGT2B are regulated by the aryl hydrocarbon re-
ceptor and NF-E2-related factor 2, respectively [24,25].
These different mechanisms in transcriptional regulation
could lead to differences in the expression of UGT iso-
forms. Our future research will be focused on investigat-
ing alterations between UGTs and transcription factors.
The changes in mRNA of SULT1A1, SULT2A1 and
GSTP2 are shown in Figure 4. The SULTs are catego-
rized into two major groups, the arylsulfotransferases
(SULT1 family) and the hydroxysteroid sulfotransferases
(SULT2 family) [26]. Although both SULT1A1 and
Changes in mRNA Expression and Activity of Xenobiotic Metabolizing Enzymes in Livers
from Adjuvant-Induced Arthritis Rats
482
Figure 4. Changes in relative mRNA levels of SULT1A1, 2A1, and GSTP2 in the liver of AA rats. The results are expressed as
the mean ± S.D. (n = 4). There were significant differences between control and AA rats (*p < 0.05).
SULT2A1 mRNAs decreased in the acute phase, the
mRNA level of SULT1A1 but not SULT2A1 recovered
to control levels in the subacute and chronic phases. It
has been reported that SULT2A1 is predominantly regu-
lated by PXR [27,28]. In our previous report, we demon-
strated that the mRNA level of PXR but not CAR was
significantly decreased in AA rats [29]. Therefore, it is
possible that the inflammatory response could lead to the
inhibition of transcription of SULT2A1 through regula-
tion of PXR levels. Further research is needed to better
understand the differences in regulation between SULT1-
A1 and SULT2A1. The mRNA level of GSTP2 de-
creased by close to 50% in all phases. These results sug-
gest that phase II enzymes could have more distinct pat-
terns of changes in mRNA for each isoform compared
with CYPs.
In conclusion, the mRNA level of almost all metabo-
lizing enzymes examined were decreased in all three
response phases in AA rats, suggesting that the inflame-
matory condition could affect the pharmacokinetics of
substrates used by these enzymes, most likely as a result
of decreased protein expression. However, some en-
zymes such as UGT2B and SULT1A1 showed a rela-
tively quick recovery to control mRNA levels, indicating
that the effects of inflammation on mRNA levels of me-
tabolizing enzymes differ depending on the isoform.
4. Acknowledgements
This work was supported in part by the “High-Tech Re-
search Center” Project for Private Universities: matching
fund subsidy from MEXT (Ministry of Education, Cul-
ture, Sports, Science and Technology), 2007-2011.
REFERENCES
[1] A. E. Aitken, T. A. Richardson and E. T. Morgan, “Regu-
lation of Drug-Metabolizing Enzymes and Transporters in
Inflammation,” Pharmacology and Toxicology, Vol. 46,
2006, pp. 123-149.
doi:10.1146/annurev.pharmtox.46.120604.141059
[2] K. W. Renton, “Cytochrome P450 Regulation and Drug
Biotransformation during Inflammation and Infection,”
Current Drug Metabolism, Vol. 5, No. 3, 2004, pp. 235-
243. doi:10.2174/1389200043335559
[3] F. M. Belpaire, F. D. Smet, B. F. Chidavijak, N. Fraey-
man and M. G. Bogaert, “Effect of Turpentine-Induced
Inflammation on the Disposition Kinetics of Propranolol,
Metoprolol, and Antipyrine in the Rat,” Fundamental &
Clinical Pharmacology, Vol. 3, No. 2, 1989, pp. 79-88.
doi:10.1111/j.1472-8206.1989.tb00667.x
[4] M. Piquette-Miller and F. Jamali, “Selective Effect of
Adjuvant Arthritis on the Disposition of Propranolol En-
antiomers in Rats Detected Using a Stereospecific HPLC
Assay,” Pharmaceutical Research, Vol. 10, No. 2, 1993,
pp. 294-299. doi:10.1023/A:1018907431893
[5] M. E. Laethem, F. M. Belpaire, P. Wijnant, M. T. Rosseel
and M. G. Bogaert, “Influence of Endotoxin on the Ste-
reoselective Pharmacokinetics of Oxprenolol, Propranolol,
and Verapamil in the Rat,” Chirality, Vol. 6, No. 5, 1994,
pp. 405-410. doi:10.1002/chir.530060508
[6] R. O. Williams, M. Feldmann and R. N. Maini, “Anti-
Tumor Necrosis Factor Ameliorates Joint Disease in Mur-
ine Collagen-Induced Arthritis,” Proceedings of the Na-
tional Academy of Sciences of the United States of Amer-
ica, Vol. 89, No. 20, 1992, pp. 9784-9788.
doi:10.1073/pnas.89.20.9784
[7] N. Shibata, H. Shimakawa, T. Minouchi and A. Yamaji,
“Pharmacokinetics of Cyclosporin A after Intravenous
Administration to Rats in Various Disease States,” Bio-
logical & Pharmaceutical Bulletin, Vol. 16, No. 11, 1993,
pp. 1130-1135. doi:10.1248/bpb.16.1130
[8] G. Dipasquale, P. Welaj and C. L. Rassaert, “Prolonged
Pentobarbital Sleeping Time in Adjuvant-Induced Pol-
yarthritic Rats,” Research Communications in Chemical
Pathology and Pharmacology, Vol. 9, No. 2, 1974, pp.
253-264.
[9] T. Nagao, T. Tanino and M. Iwaki, “Stereoselective
Pharmacokinetics of Flurbiprofen and Formation of Co-
valent Adducts with Plasma Protein in Adjuvant-Induced
Arthritic Rats,” Chirality, Vol. 15, No. 5, 2003, pp. 423-
428. doi:10.1002/chir.10227
[10] S. Uno, A. Kawase, A. Tsuji, T. Tanino and M. Iwaki,
“Decreased Intestinal CYP3A and P-Glycoprotein Activi-
ties in Rats with Adjuvant Arthritis,” Drug Metabolism
and Pharmacokinetics, Vol. 22, No. 4, 2007, pp. 313-321.
Copyright © 2013 SciRes. PP
Changes in mRNA Expression and Activity of Xenobiotic Metabolizing Enzymes in Livers
from Adjuvant-Induced Arthritis Rats
483
doi:10.2133/dmpk.22.313
[11] G. W. Warren, S. M. Poloyac, D. S. Gary, M. P. Mattson
and R. A. Blouin, “Hepatic Cytochrome P-450 Expres-
sion in Tumor Necrosis Factor-Alpha Receptor (p55/p75)
Knockout Mice after Endotoxin Administration,” Journal
of Pharmacology and Experimental Therapeutics, Vol.
288, No. 3, 1999, pp. 945-950.
[12] E. Siewert, R. Bort, R. Kluge, P. C. Heinrich, J. Castell
and R. Jover, “Hepatic Cytochrome P450 Down-Regula-
tion during Aseptic Inflammation in the Mouse Is Inter-
leukin 6 Dependent,” Hepatology, Vol. 32, No. 1, 2000,
pp. 49-55. doi:10.1053/jhep.2000.8532
[13] E. T. Morgan, “Regulation of Cytochrome P450 by In-
flammatory Mediators: Why and How?” Drug Metabo-
lism and Disposition, Vol. 29, No. 3, 2001, pp. 207-212.
[14] P. Honkakoski, I. Zelko, T. Sueyoshi and M. Negishi,
“The Nuclear Orphan Receptor CAR-Retinoid X Recep-
tor Heterodimer Activates the Phenobarbital-Responsive
Enhancer Module of the CYP2B Gene,” Molecular and
Cellular Biology, Vol. 18, No. 10, 1998, pp. 5652-5658.
[15] S. A. Kliewer, J. T. Moore, L. Wade, J. L. Staudinger, M.
A. Watson, S. A. Jones, D. D. McKee, B. B. Oliver, T. M.
Willson, R. H. Zetterstrom, T. Perlmann and J. M. Leh-
mann, “An Orphan Nuclear Receptor Activated by Preg-
nanes Defines a Novel Steroid Signaling Pathway,” Cell,
Vol. 92, No. 1, 1998, pp. 73-82.
doi:10.1016/S0092-8674(00)80900-9
[16] D. J. Waxman, “P450 Gene Induction by Structurally Di-
verse Xenochemicals: Central Role of Nuclear Receptors
CAR, PXR, and PPAR,” Archives of Biochemistry and
Biophysics, Vol. 369, No. 1, 1999, pp. 11-23.
doi:10.1006/abbi.1999.1351
[17] A. Kawase, A. Fujii, M. Negoro, R. Akai, M. Ishikubo, H.
Komura and M. Iwaki, “Differences in Cytochrome P450
and Nuclear Receptor mRNA Levels in Liver and Small
Intestine between SD and DA Rats,” Drug Metabolism
and Pharmacokinetics, Vol. 23, No. 3, 2008, pp. 196-206.
doi:10.2133/dmpk.23.196
[18] H. Sanada, M. Sekimoto, A. Kamoshita and M. Degawa,
“Changes in Expression of Hepatic Cytochrome P450
Subfamily Enzymes during Development of Adjuvant-
Induced Arthritis in Rats,” Journal of Toxicological Sci-
ences, Vol. 36, No. 2, 2011, pp. 181-190.
doi:10.2131/jts.36.181
[19] E. Assenat, S. Gerbal-Chaloin, D. Larrey, J. Saric, J. M.
Fabre, P. Maurel, M. J. Vilarem and J. M. Pascussi, “In-
terleukin 1β Inhibits CAR-Induced Expression of Hepatic
Genes Involved in Drug and Bilirubin Clearance,” Hepa-
tology, Vol. 40, No. 4, 2009, pp. 951-960.
[20] S. A. Kliewer, J. T. Moore, L. Wade, J. L. Staudinger, M.
A. Watson, S. A. Jones, D. D. McKee, B. B. Oliver, T. M.
Willson, R. H. Zetterstrom, T. Perlmann and J. M. Leh-
mann, “An Orphan Nuclear Receptor Activated by Preg-
nanes Defines a Novel Steroid Signaling Pathway,” Cell,
Vol. 92, No. 1, 1998, pp. 73-82.
doi:10.1016/S0092-8674(00)80900-9
[21] B. Goodwin, E. Hodgson and C. Liddle, “The Orphan
Human Pregnane X Receptor Mediates the Transcrip-
tional Activation of CYP3A4 by Rifampicin through a
Distal Enhancer Module,” Molecular Pharmacology, Vol.
56, No. 6, 1999, pp. 1329-1339.
[22] J. M. Maglich, C. M. Stoltz, B. Goodwin, D. Hawkins-
Brown, J. T. Moore and S. A. Kliewer, “Nuclear Preg-
nane x Receptor and Constitutive Androstane Receptor
Regulate Overlapping but Distinct Sets of Genes Involved
in Xenobiotic Detoxification,” Molecular Pharmacology,
Vol. 62, No. 3, 2002, pp. 638-646.
doi:10.1124/mol.62.3.638
[23] T. Izukawa, M. Nakajima, R. Fujiwara, H. Yamanaka, T.
Fukami, M. Takamiya, Y. Aoki, S. Ikushiro, T. Sakaki
and T. Yokoi, “Quantitative Analysis of UDP-Glucuro-
nosyltransferase (UGT) 1A and UGT2B Expression Lev-
els in Human Livers,” Drug Metabolism and Disposition,
Vol. 37, No. 8, 2009, pp. 1759-1768.
doi:10.1124/dmd.109.027227
[24] R. L. Yeager, S. A. Reisman, L. M. Aleksunes and C. D.
Klaassen, “Introducing the TCDD-Inducible AhR-Nrf2
Gene Battery,” Toxicological Sciences, Vol. 111, No. 2,
2009, pp. 238-246. doi:10.1093/toxsci/kfp115
[25] S. Chen, D. Beaton, N. Nguyen, K. Seneko-Effenberger,
E. Brace-Sinnokrak, U. Argikar, R. P. Remmel, J. Trottier,
O. Barbier, J. K. Ritter and R. H. Tukey, “Tissue-Specific,
Inducible, and Hormonal Control of the Human UDP-
Glucuronosyltransferase-1 (UGT1) Locus,” Journal of Bio-
logical Chemistry., Vol. 280, 2005, pp. 37547-37557.
doi:10.1074/jbc.M506683200
[26] T. P. Dooley, R. Haldeman-Cahill, J. Joiner and T. W.
Wilborn, “Expression Profiling of Human Sulfotrans-
ferase and Sulfatase Gene Superfamilies in Epithelial Tis-
sues and Cultured Cells,” Biochemical and Biophysical
Research Communications, Vol. 277, No. 1, 2000, pp.
236-245. doi:10.1006/bbrc.2000.3643
[27] M. Runge-Morris, W. Wu and T. A. Kocarek, “Regula-
tion of Rat Hepatic Hydroxysteroid Sulfotransferase
(SULT2-40/41) Gene Expression by Glucocorticoids: Evi-
dence for a Dual Mechanism of Transcriptional Control,”
Molecular Pharmacology, Vol. 56, No. 6, 1999, pp. 1198-
1206.
[28] J. Sonoda, W. Xie, J. M. Rosenfeld, J. L. Barwick, P. S.
Guzelian and R. M. Evans, “Regulation of a Xenobiotic
Sulfonation Cascade by Nuclear Pregnane X Receptor
(PXR),” Proceedings of the National Academy of Sci-
ences of the United States of America, Vol. 99, No. 21,
2002, pp. 13801-13806. doi:10.1073/pnas.212494599
[29] S. Uno, M. Uraki, A. Ito, Y. Shinozaki, A. Yamada, A.
Kawase and M. Iwaki, “Changes in mRNA Expression of
ABC and SLC Transporters in Liver and Intestines of the
Adjuvant-Induced Arthritis Rat,” Biopharmaceutics &
Drug Disposition, Vol. 30, No. 1, 2009, pp. 49-54.
doi:10.1002/bdd.639
Copyright © 2013 SciRes. PP