American Journal of Plant Sciences, 2013, 4, 1693-1700
http://dx.doi.org/10.4236/ajps.2013.49206 Published Online September 2013 (http://www.scirp.org/journal/ajps)
Auxin Producing Pseudomonas Strains: Biological
Candidates to Modulate the Growth of Triticum aestivum
Beneficially
Atia Iqbal1, Shahida Hasnain1,2
1Department of Microbiology and Molecular Genetics, University of Punjab, Lahore, Pakistan; 2The Women University of Multan,
Multan, Pakistan.
Received May 24th, 2013; revised June 25th, 2013; accepted July 15th, 2013
Copyright © 2013 Atia Iqbal, Shahida Hasnain. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT
The screening of plant growth promoting rhizobacteria is a crucial step for their utilization as beneficial input in im-
proving the crop productivity. This study was carried out to screen and evaluate the auxin producing rhizospheric iso-
lated Pseudomonas strains for their potential to improve growth of Triticum aestivum (wheat) plant under laboratory
and natural conditions. Three strains PNS-4, PNS-6 and PNS-15 were evaluated for auxin production by Salkowski’s
method and further confirmed by high performance liquid chromatography (HPLC). The PNS-4, PNS-6 and PNS-15
strains were identified by I6S rRNA gene sequencing that showed maximum resemblance with Pseudomonas mendo-
cina (99%), Pseudomonas alcaliphila (99%) and Pseudomonas sp. (99%) respectively. Selected strains were found to
produce auxin with and without the amendment of exogenously applied L-tryptophan, a major precursor for auxin bio-
synthesis and an important constituent of plant root exudates. Efficacy of these strains on wheat plant growth was
checked under laboratory and field conditions. All Pseudomonas species were found to improve the % seed germination
and growth parameters (shoot length, root length, fresh weight and dry weight) of the wheat seedlings significantly (P =
0.05) as compared to the un-inoculated seedlings under laboratory condition. The biochemical parameters (total soluble
protein content and endogenous auxin content) of the bacterial inoculated wheat seedling were also increased signifi-
cantly than that of uninoculated ones. Under natural condition, seed bacterization also showed the significant effect (P =
0.05) on yield parameters (shoot length, number of tillers, spike length and weight of seeds in grams) of the wheat
plants when compared with non-inoculated plants. Our results reported the three most promising Pseudomonas candi-
dates and revealed the fact that experiments under laboratory and natural conditions may be helpful in selecting the best
candidates as bio fertilizers for future agricultural practices.
Keywords: Auxin; Pseudomonas; Triticum aestivum; PGPR; Rhizobacteria
1. Introduction
Complex diversity of microbes interacts with plant roots
continuously in rhizospheric soil region. These microbes
can influence the plant growth in various ways that can
be beneficial or detrimental to the plant development
[1,2]. Beneficial rhizospheric microorganisms gained
special attention due to their potential to enhance the
plant growth by variety of mechanisms. Some mecha-
nisms are involved in plant growth promotion directly i.e.
phytohormone [3] and siderophore production [4], phos-
phate solublization [5], nitrogen fixation and denitrifica-
tion [6,7] and 1-amino-cyclopropane-1-carboxylate de-
aminase production [8]. Whereas HCN (and antifungal
metabolite and siderophore production are bacterial char-
acteristics that are involved in plant growth promotion
indirectly [9]. Beneficial rhizobacteria that increase the
plant yield and productivity are considered as plant
growth promoting rhizobacteria (PGPR) [10]. Phytohor-
mone production has been studied as one of the main me-
chanisms by which PGPR may enhance the plant growth
[11]. Several genera of Pseudomonas, Bacillus, Arthro-
bacter, Azospirillum, Klebsiella, and Enterobacter, iso-
lated from rhizospheric region of variety of crops, have
been evaluated for plant growth promoting attributes and
illustrated their synergistic effects on plant growth and
development [12,13].
Copyright © 2013 SciRes. AJPS
Auxin Producing Pseudomonas Strains: Biological Candidates to Modulate the Growth
of Triticum aestivum Beneficially
1694
Auxin especially IAA production by rhizobacteria is
involved in plant microbe signaling, which can lead the
change in root morphology by proliferation and elonga-
tion of adventitious and lateral roots to the plant [14,15].
Therefore, facilitation of plant growth by rhizobacteria
has been ascribed to the auxin production [16]. Barea et
al. [17] reported that about 86% of the bacterial strains,
isolated from the rhizosphere of various plants, produced
auxins. IAA biosynthesis by these bacteria has been cor-
related with promoting of root proliferation [3,18,19]. Ef-
fect of IAA on plant growth mainly depends upon its
concentration. Low concentration enhances the root length
while high concentration retards the plant root length
[20]. In order to select the most promising plant growth
promoting bacteria, effective selection and screening pro-
cedures are considered very important [21]. This selec-
tion helps to assist the development of database of the
microbes essential for plant growth that can be further
used as bio fertilizers. Genera Pseudomonas especially P.
fluorescens and P. putida are the most important kinds of
PGPR. Production of auxin is one of the main reasons to
promote plant yield with these Bacteria [22]. The main
objective of the present study was to screen the most ef-
fective Pseudomonas species on the basis of auxin pro-
duction and their further evaluation in promoting the
growth and development of wheat plant under laboratory
and field conditions.
2. Material and Methods
2.1. Isolation
The root adhering soil samples from the rhizosphere of
Lycopersicon esculentum, Vigna radiate and Corundum
sativum plants, grown in different location of Punjab, Pa-
kistan were collected from the rhizosphere region in ster-
ile bags, carried to the laboratory and stored at 4˚C for
further processing. In order to screen the auxin producing
rhizobacteria, one gram soil from each soil sample was
homogenized in test tube containing 9 ml saline solution
(0.85% NaCl) separately. The suspension was vortexed
and dilutions of autoclaved water were made up to 10–6
by using the serial dilution method. The 0.1 ml of each
dilution was spread on Luria Bertani medium plates. The
plates were incubated at 28˚C ± 2˚C for 24 hours. After
the development of growth, different colonies were se-
lected on the basis of morphology and purified by fur-
ther sub culturing [23].
2.2. Molecular Identification
In order to identify the selected strains, 16S rRNA gene
sequence analysis was done by extraction and ampli-
fication of genomic DNA done by the method of Cui et
al. [24]. DNA extraction was done by extraction kit
(QIAGEN) and amplified by using universal primers
forward primer 27f (5’AGAGTTTGATCCTGGCTCAG3’)
and reverse primer 1522r (5’AAGGAGATGATCCA-
GCC3’). The amplified product was purified and sent for
sequencing at Cancer research Centre, University of Chi-
cago. The obtained sequence was edited and submitted to
BLAST to search phylogentically closely related bacteria
already submitted in the GENBANK. The final sequence
was submitted to GENBANK for accession numbers.
2.3. Auxin Production under in Vitro Condition
For auxin estimation, bacterial cell suspension adjusted
to 106 to 107 CFU ml–1 was inoculated in autoclaved
L-broth supplemented without and with a filter sterilized
solution of 1000 µg L-tryptophan. Inoculated flasks were
incubated at 28˚C for 72 hours. After incubation, bacte-
rial cells were removed from culture medium by centri-
fugation at 14.000 rpm for 15 minutes. After centrifuga-
tion, auxin was detected by taking 1 ml of supernatant
and 2 ml of Salkowski’s reagent, mixed them properly
and placed in dark for 30 minutes. After the color devel-
opment, O.D was taken at 535 nm by spectrophotometer.
A standard curve of synthetic auxin (Oxoid) with differ-
ent concentration was drawn to quantify the auxin pro-
duced by bacteria [25]. The presence of IAA was further
confirmed by thin layer chromatography and HPLC.
2.4. HPLC
Bacterial auxin was extracte by centifugation of the sta-
tionary phase cultue at 10.000 rpm for 20 minutes at 4˚C.
The pH of the supernatent was adjusted to 2.5 with 1.0 M
HCL and extracted three times with three volumes of
ethyl acetate. Extracts were evaporated in rotary evapo-
rator (Heidolph LABOROTA, Cole-Parmer, IL, USA)
and dissolved in absolute methanol. For further confir-
mation of bacterial IAA, HPLC (Sykam Model 203)
equipped with a sykam S1122 solvent delivery system
and Sykam S 3210 uv/vis detector was used for extracted
bacterial samples. Extracted sample (10 µl) dissolved in
methanol was injected into Reverse-phase C 18 column
(4.6 × 15 mm). The mobile phase was methanol: water
80:20 (v/v) at a flow rate of 1 ml/min. Peak was detected
comparable to synthetic IAA.
2.5. Plant Microbe Experiment
2.5.1. A xe ni c /Labora tory Condition
Effect of auxin producing rhizobacteria was checked on
plant growth by providing the natural system of soil
under the controlled conditions in the laboratory. Effect
of bacterial auxin on wheat plant was done by the me-
Copyright © 2013 SciRes. AJPS
Auxin Producing Pseudomonas Strains: Biological Candidates to Modulate the Growth
of Triticum aestivum Beneficially
1695
thod of Ali et al. [23]. Bacterial culture was grown in LB
broth for 24 hour at 28˚C and centrifuged at 10.000 rpm
for 10 minutes to get the pellet. Washing of bacterial
pellet was done with I ml of phosphate buffer (PBS, 20
mM sodium phosphate, 150 mM NaCl, pH 7.4) and sus-
pended in the same buffer. Cell density of 107 CFU ml–1
was achieved by taking the O.D at 600 nm of suspension.
Certified Seeds of wheat var Uqab-2000 were obtained
from Punjab seed corporation Lahore Pakistan and sur-
face sterilized with 0.1% HgCl2 followed by several
washings (7 times) of water. After incubating the seeds
in bacterial inoculum for 30 minutes, they were sown in
plastic pots having 200 gm autoclaved soil, at the depth
of 2 - 2 cm. Same process was done with the seeds
dipped in un-inoculated broth for control setup. The
whole experiment was set in five replicates. Soil was
moistened with autoclaved water equally in all experi-
mental and control pots respectively. The pots were
placed at 22˚C in growth chamber with 16:8 daylight
(with light intensity of 200 μE·m–2·s–1) regime. The per-
centage germination was calculated in treated and control
plants soon after germination. After 15 days wheat seed-
lings were taken out and root length, shoot length, fresh
weight, dry weight were measured. Bio chemical para-
meters were also calculated. Experiment was performed
three times to check the validity of the results.
2.5.2. N at ural Condit ion
In order to check the effect of auxin producing Pseudo-
monas strains on the yield of wheat plants, sterilized
seeds treated with PGPR strains for 30 minutes as men-
tioned above were sown in large pots containing 10 kg of
unfertilized garden soil. Initially, 15 sterilized seeds were
inoculated in each pot in five replicates. After germina-
tion, seedlings were thinned to 10 per pot. After 6 weeks,
further thinning was carried out by keeping 5 seedlings
per pot, which were grown till maturity. All pots were
arranged in a completely randomized design in the wire
house of Department of Microbiology and Molecular Ge-
netics, University of the Punjab, Lahore, Pakistan. Ex-
periment was conducted between December, 2009 to
June, 2010 under ambient light and temperature. Plants
were irrigated with tap water when required. At full ma-
turity, growth parameters including shoot length, number
of tillers, spike length, and grain yield were recorded.
Experiments were repeated three times to check the va-
lidity of the results [16].
2.6. Statistical Analysis
The data obtained were evaluated statistically by using
SPSS (version 16; SPSS Inc, Chicago, USA) software for
windows. Data were analyzed by ANOVA and mean val-
ues of different strains were compared by Duncan’s mul-
tiple test (P < 0.05).
3. Results and Discussion
Plant growth promoting bacteria have gained the world
wide attention, as an alternative of chemical fertilizers
that can improve the plant growth by direct or indirect
ways. The rhizobacteria have great potential to enhance
the growth promotion of wheat crop [26,27].
3.1. Identification
Three Pseudom ona s strains PNS-4, PNS-6 and PNS-15
showed 99% homology to P. mendocina, P. alcaliphila
and Pseudomonas sp. (already submitted sequences in
GENBANK). The nucleotide sequences have been sub-
mitted in GENBANK under accession number of JF
905443.1, JF905444.1 and JQ218449 for PNS-4, PNS-6
and PNS-15 respectively (Table 1).
3.2. Auxin Biosynthesis by Pseudomonas Isolates
In vitro auxin production and screening of rhizobacterial
isolates for plant growth promotion under gontobiotic
conditions are considered as useful approach for select-
ing PGPR [28]. In the present study, all strains were
found to produce auxin significantly in LB medium which
were increased by addition of precursor L-tryptophan.
The result showed that auxin production was not the
same among all rhizobacterial strains. PNS-6 produced
the highest amount of IAA (15.6 µg/ml) followed by
PNS-15 (13.3 µg/ml) and PNS-4 (12.6 µg/ml) in the ab-
sence of L-tryptophan. But this production was increased
by the amendment of L-tryptophan, which were highest
in PNS-15 (114 µg/ml) while production in PNS-6 and
PNS-4 reached up to 110 µg/ml and 105 µg/ml respec-
tively (Figure 1). The result showed that selected isolates
produced auxin through tryptophan dependent pathway,
which could be helpful while interaction with plants as
plants exudates contains tryptophan that may assist the
auxin production ability of the colonized bacteria [9,16,
29]. Our work was in accordance with Ali et al. [23] who
isolated the auxin producing rhizobacteria and have be-
neficial impact on plant growth promotion.
3.3. Identification of Auxin by HPLC
HPLC is a useful tool to identify and confirm the me-
tabolites that were screened by manually method and not
very reliable [30]. All strains showed a peak comparable
with the peak of standard IAA on HPLC system. That in-
dicated the bacterial ability to synthesize the IAA (Fig-
re 2). u
Copyright © 2013 SciRes. AJPS
Auxin Producing Pseudomonas Strains: Biological Candidates to Modulate the Growth
of Triticum aestivum Beneficially
Copyright © 2013 SciRes. AJPS
1696
Table 1. Isolation and molecular identification of Pseudomonas strains.
Strains Plant source Sequence length% homologyIdentified as Accession number
PNS-4 Lycopersicon esculentum1445 99 Pseudomonas mendocina strain PNS-4 JF905443.1
PNS-6 Vigna radiata 1457 99 Pseudomonas alcaliphila strain PNS-6 JF905444.1
PNS-15 Coriandrum sativum 1537 99 Pseudomonas sp. PNS-15 JQ218453
L-trptophan (0%) L-trptophan (0.1%)
Control PNS-4 PNS-6 PNS-15
Rhizobacterial strains
140
120
100
80
60
40
20
0
Auxin production (μg/ml)
Figure 1. Auxin quantification of most effective strains by colorimetric method with and without the presence of L-tryp-
tophan.
IAA
5 101520
-5
0
10
20
30
40
50
mAU
(a)
IAA
5 101520
-5
0
10
20
30
25
mAU
(b)
Figure 2. HPLC chromatogram of (a) standard IAA and (b) PNS-15 extract.
Auxin Producing Pseudomonas Strains: Biological Candidates to Modulate the Growth
of Triticum aestivum Beneficially
1697
3.4. Effect on Growth Parameters under
Laboratory Condition
Auxin producing strains were evaluated for their poten-
tial to enhance the wheat growth under laboratory condi-
tion. Induction in seed emergence has been considered as
a very important step towards better growth promotion of
plant, and the PGPRs are involved in plant growth pro-
motion by enhancing the seed germination. All selected
strains showed significant (P = 0.05) increase in percen-
tage germination. PNS-15 showed maximum increase in
% germination (42.8%) of wheat seedlings followed by
PNS-6 (38%) and NS-4 (33.2%). The root length, shoot
length, fresh weight and dry weight of the Pseudomonas
inoculated seedlings were also increased significantly (P
= 0.05) when compared than that of uninoculated ones
(Table 2). Strain PNS-15 showed the 45.8% increase in
shoot length followed by PNS-4 and PNS-6 that showed
the 26.5 and 20.3% increases over control. It was found
that PNS-6 showed maximum promoting effect on root
length (53.7%) followed by PNS-15 (53.1%) and PNS-4
(46.2%) as compared to control. Same was the case with
fresh and dry weight of inoculated seedling biomass.
Fresh and dry biomass of Pseudomonas inoculated wheat
seedlings were significantly (P = 0.05) increased than that
of non-inoculated plant seedlings. Strain PNS-15 showed
increase in weight of fresh (77%) and dry (90%) biomass
as compared to control (Table 2). Whereas increase fresh
and dry weight of PNS-6 inoculated seedlings were found
49.6 and 61.2% respectively. Our results were in agree-
ment with Hameeda et al. [31], Cakmakci et al. [32] and
Shaharoona et al. [33] who demonstrated that auxin pro-
ducing rhizobacterial Pseudomonas have the ability to in-
crease the biomass of wheat seedlings in laboratory con-
ditions. The Pseudomonas strains also have significant (P
= 0.05) beneficial effect on total soluble protein and en-
dogenous auxin of wheat seedlings. PNS-15 strain was
found to be most efficient that caused 85 and 12.2% in-
crease in auxin and soluble protein content when com-
pared to non-inoculated ones (Figure 3). The results
showed that bacterial auxin plays an important role in
changing the endogenous auxin pool that is involved in
root proliferation and more absorption of nutrients that
may leads to better development of the plant.
Table 2. Auxin producing effect of rhizobacterial strains on bioactive parameters of wheat seedlings in pot experiment.
Rhizobacterial isolates Germination (%) Root length (cm)Shoot length (cm)Fresh weight (mg/plant) Dry weight (mg/plant)
Control 70 ± 2.44 (a) 13.03 ± 0.84 (a) 15.06 ± 0.91 (a) 1350 ± 0.06 (a) 310 ± 0.009 (a)
PNS-4 94 ± 2.12 (b) 19.06 ± 0.97 (b) 19.06 ± 0.87 (c) 1970 ± 0.1 (b) 470 ± 0.006 (b)
PNS-6 98 ± 3.14 (c) 20.03 ± 0.98 (c) 18.13 ± 0.78 (b) 2020 ± 0.12 (b) 500 ± 0.01 (c)
PNS-15 100 ± 0.00 (d) 19.96 ± 0.95 (b) 21.96 ± 1.06 (d) 2390 ± 0.10 (c) 590 ± 0.05 (d)
Values shows mean of 25 replicates ± SE. The different letters showed significant differences between values of different strains by using Duncan’s multiple
range test (P = 0.05).
Total soluble protein content Auxin content
Control PNS-4PNS-6PNS-15
Pseudomonas strains
140 1.7
1.6
1.5
1.4
1.3
1.2
1.1
Auxin content (μg/g of fresh weight)
b
a
c
1.8
1
0.9
0.8 560
580
600
620
640
660
680
700
Protein content (μg/g of fresh weight)
b
a
c
d
Figure 3. Effect of Pseudomonas strains on biochemical parameters (auxin content and total soluble protein content) of wheat
seedlings under laboratory conditions. Values shows mean of 10 replicates ± SE. The different letters showed significant
differences between values of different strains by using Duncan’s multiple range test (P = 0.05).
Copyright © 2013 SciRes. AJPS
Auxin Producing Pseudomonas Strains: Biological Candidates to Modulate the Growth
of Triticum aestivum Beneficially
1698
Table 3. Impact of Pseudomonas inoculations on growth and yield of T. aestivum at full maturity under natural condition.
Rhizobacterial strain Percentage germination Shoot length (cm)No. of tillers/plantSpike length (cm) weight of 100 seeds (g)
Control 86.63 ± 4.13 (a) 51.9 ± 0.78 (a) 2.2 ± 0.24 (a) 8.06 ± 0.72 (a) 3.04 ± 0.32 (a)
PNS-4 98.8 ± 4.76 (b) 60.2 ± 0.91 (c) 3.13 ± 0.22 (b) 9.36 ± 0.73 (b) 3.87 ± 0.19 (b)
PNS-6 98.8 ± 5.12 (b) 58.5 ± 0.76 (b) 3.16 ± 0.21 (c) 9.53 ± 0.89 (c) 3.91 ± 0.18 (c)
PNS-15 100 ± 5.14 (c) 65.1 ± 1.05 (d) 4.03 ± 0.15 (d) 10.7 ± 0.92 (d) 4.07 ± 0.24 (d)
Values shows mean of 25 replicates ± SE. The different letters showed significant differences between values of different strains by using Duncan’s multiple
range test (P = 0.05).
3.5. Effect on Growth Parameters under Natural
Condition
The efficiency of PGPR inoculation in plant growth pro-
motion depends upon its survival and propagation rate in
diversified environmental conditions, including soil type,
environmental conditions and Plant age [34]. The poten-
tial of bacterial strains may never be fruitful in natural
condition as lot of environmental factors (indigenous mi-
croflora, survival rate, environmental conditions) are in-
volved that may interfere their capability as plant growth
promoters. After the laboratory trials, the strains were
checked under natural environment. The results of bacte-
rial effect on plant growth under natural condition re-
vealed that PNS-4 PNS-15 and PNS-6 significantly (P =
0.05) increased all growth parameters in field condition.
PNS-15 increased percentage up to 15.4%, shoot length
up to 25.4% than that of uninoculated ones (Table 3).
While PNS-4 exhibited 15.9% enhancement in the shoot
length of the plant as compared to the control. Similarly
number of tillers and spike length in PNS-15 inoculated
strains were also increased up to 83.1% and 32.9% than
that of non-inoculated ones (Figure 4 and Table 3).
PNS-15 efficiently increased the grain weight of 100
seeds (34%) followed by PNS-6 (28.6%) and PNS-4
(27.5%) as compared to control ones. studies done by
Hussain and Hasnian [35] showed the increase in yield of
the wheat plant by Pseudomonas strains. Similarly Ab-
baspoor et al. [36] showed that Pseudomonas species en-
hanced the wheat grain yield by 26%. Furthermore, Pseu-
domonas species have the ability to colonize the plant
roots efficiently and causes the significant increase in the
plant yield [34].
4. Conclusion
The selected three most promising Pseudomonas species
were evaluated as PGPR on the basis of in vitro and
laboratory screening procedures. All strains enhanced the
plant growth in laboratory by utilizing phytohormones
producing ability. The strains were able to retain their
growth promoting trait under natural condition as well
that can be further utilized in enhancing the wheat crop
Figure 4. Effect of rhizobacterial inoculation on the spike
length of wheat plants under natural conditions.
productivity as an alternative of chemical fertilizers.
5. Acknowledgements
Higher education commission of Pakistan is highly ac-
knowledged for providing the funding to Miss Atia Iqbal
to complete this work
REFERENCES
[1] F. Ahmad, I. Ahmad and M. S. Khan, “Screening of Free-
Living Rhizospheric Bacteria for Their Multiple Plant
Growth Promoting Activities,” Microbiological Research,
Vol. 163, No. 2, 2008, pp. 173-181.
doi:10.1016/j.micres.2006.04.001
[2] S. Taghavi, C. Garafola and S. Monchy, “Genome Survey
and Characterization of Endophytic Bacteria Exhibiting a
Beneficial Effect on Growth and Development of Poplar
Trees,” Applied Environmental Microbiology, Vol. 75,
No. 3, 2009, pp. 748-757.
doi:10.1016/j.micres.2006.04.001
[3] S. Spaepen, J. Vanderleyden and R. Remans, “Indole-3-
Acetic Acid in Microbial and Microorganism-Plant Sig-
naling,” FEMS Microbiological Review, Vol. 31, No. 4,
2007, pp. 425-448.
Copyright © 2013 SciRes. AJPS
Auxin Producing Pseudomonas Strains: Biological Candidates to Modulate the Growth
of Triticum aestivum Beneficially
1699
doi:10.1111/j.1574-6976.2007.00072.x
[4] C. Dimkpa, A. Svatos, D. Merten, G. Buchel and E.
Kothe, “Hydroxamate Siderophores Produced by Strep-
tomyces acidiscabies E13 Bind Nickel and Promote
Growth in Cowpea (Vigna unguiculata L.) under Nickel
Stress,” Canadian Journal of Microbiology, Vol. 54, No.
3, 2008, pp. 163-172. doi:10.1139/W07-130
[5] S. M. Nadeem, Z. A. Zahir, M. Naveed, M. Arshad and S.
M. Shahzad, “Variation in Growth and Ion Uptake of
Maize Due to Inoculation with Plant Growth Promoting
Rhizobacteria under Salt Stress,” Soil and Environment,
Vol. 25, No. 2, 2006, pp. 78-84.
[6] S. C. Kang, C. G. Ha, T. G. Lee and D. K. Maheshwari,
“Solubilization of Insoluble Inorganic Phosphate by a
Soil Inhabiting Fungus Fomitopsis sp. PS102,” Current
Science, Vol. 82, No. 4, 2002, pp. 439-442.
[7] N. Pradhan and L. B. Sukla, “Solubilization of Inorganic
Phosphate by Fungi Isolated from Agriculture Soil,” Af-
rican Journal of Biotechnology, Vol. 5, No. 10, 2005, pp.
850-854.
[8] J. D. Correa, M. L. Barrios and R. P. Galdona, “Screening
for Plant Growth-Promoting Rhizobacteria in Chamae-
cytisus proliferus (tagasaste), a Forage Tree-Shrub Leg-
ume Endemic to the Canary Islands,” Plant Soil, Vol. 266,
2004, pp. 75-84.
[9] F. Ahmad, I. Ahmad and M. S. Khan, “Indole Acetic
Acid Production by the Indigenous Isolates of Azotobac-
ter and Fluorescent Pseudomonas in the Presence and
Absence of Tryptophan,” Turkish Journal of Biology, Vol.
29, 2005, pp. 29-34.
[10] J. K. Vessey, “Plant Growth Promoting Rhizobacteria as
Biofertilizers,” Plant and Soil, Vol. 255, No. 2, 2003, pp.
571-586. doi:10.1023/A:1026037216893
[11] D. Egamberdieva, “Plant Growth Promoting Properties of
Rhizobacteria Isolated from Wheat and Pea Grown in
Loamy Sand Soil,” Turkish Journal of Biology Vol. 32,
No. 1, 2008, pp. 9-15.
[12] D. S. Thuler, E. I. S. Floh, W. Handro and H. R. Barbosa,
“Plant Growth Regulators and Amino Acids Released by
Azospirillum sp. in Chemically Defined Media,” Letters
in Applied Microbiology, Vol. 37, No. 2, 2003, pp. 174-
178. doi:10.1046/j.1472-765X.2003.01373.x
[13] D. Perrig, M. L. Boiero, O. A. Masciarelli, C. Penna, O.
A. Ruiz, F. D. Cassan and M. V. Luna, “Plant Growth
Promoting Compounds Produced by Two Agronomically
Important Strains of Azospirillum brasilense and Implica-
tions for Inoculant Formulation,” Applied Journal of Mi-
crobiology and Biotechnology, Vol. 75, No. 5, 2007, pp.
1143-1150.
[14] H. Bertrand, R. Nalin, R. Bally and J. C. Cleyet-Marel,
“Isolation and Identification of the Most Efficient Plant
Growth Promoting Bacteria Associated with Canola (Bras-
sica napus),” Biology Fertility Soils, Vol. 33, No. 2, 2001,
pp. 152-156. doi:10.1007/s003740000305
[15] J. K. Vessey and T. J. Buss, “Bacillus cereus UW85 In-
oculation Effects on Growth, Nodulation and N Accumu-
lation in Grain Legumes: Controlled Environment Stud-
ies,” Canadian Journal of Microbiology, Vol. 82, 2002,
pp. 283-290.
[16] S. Akhtar and B. Ali, “Evaluation of Rhizobacteria as
Non-Rhizobial Inoculants for Mung Beans,” Australian
Journal of Crop Sciences, Vol. 5, No. 13, 2011, pp.
1723-1729.
[17] J. M. Barea and E. Navarro, “Montoya Production of
Plant Growth Regulators by Rhizosphere Phosphate-So-
lubilizing Bacteria,” Journal of Applied Bacteriology, Vol.
40, No. 2, 1976, pp. 129-134.
doi:10.1111/j.1365-2672.1976.tb04161.x
[18] F. Persello-Cartieaux, L. Nussaume and C. Rosalie, “Tales
from the Underground: Molecular Plant-Rhizobacteria In-
teractions,” Plant and Cell Environment, Vol. 26, No. 2,
2003, pp. 189-199.
doi:10.1046/j.1365-3040.2003.00956.x
[19] A. Iqbal and S. Hasnain, “Aeromonas punctata PNS-1: A
Promising Candidate to Change the Root Morphogenesis
of Arabidopsis thaliana in MS and Sand System,” Acta
Physiologia, 2012. doi:10.1007/s11738-012-1106-8
[20] M. Arshad and W. T. Frankenberger, “Soil Microbial
Ecology,” In: F. B. Metting, Ed., Microbial Production of
Plant Growth Regulators, Marcel Dekker, Inc., New
York, 1992.
[21] L. M. Nelson, “Plant Growth Promoting Rhizobacteria
(PGPR): Prospects for New Inoculants,” Crop Manage-
ment, 2004. doi:10.1094/CM-2004-0301-05-RV
[22] N. Khakipour, K. Khavazi, H. Mojallali, E. Pazira and H.
Asadirahmani, “Production of Auxin Hormone by Fluo-
rescent Pseudomonads,” American-Eurasian Journal of
Agriculture and Environmental Science, Vol. 4, No. 6,
2008, pp. 687-692.
[23] B. Ali, A. N. Sabri, K. Ljung and S. Hasnain, “Quantifi-
cation of Indole-3-Acetic Acid from Plant Associated Ba-
cillus spp. and Their Phytostimulatory Effect on Vigna
radiata (L.),” World Journal of Microbiology and Bio-
technology, Vol. 25, No. 3, 2009, pp. 519-526.
doi:10.1007/s11274-008-9918-9
[24] X. L. Cui, P. H. Mao, M. Zeng, W. J. Li, L. P. Zhang, L.
H. Xu and C. L. Jiang, “Streptomonospora salina gen.
nov., sp. nov., a New Member of the Family Nocardiop-
saceae,” International Journal of Systematic and Evolu-
tionary Microbiology, Vol. 51, No. 2, 2001, pp. 357-363.
[25] E. Glickman and Y. Dessaux, “A Critical Examination of
the Specificity of the Salkowski’s Reagent for Indolic
Compounds Produced by Phytopathogenic Bacteria,” Ap-
plied and Environmental Microbiology, Vol. 61, No. 2,
1995, pp. 793-796.
[26] S. Afrasayab and S. Hasnain, “Synergistic Growth Stimu-
latory Effects of Mixed Culture Bacterial Inoculations on
the Early Growth of Triticum aestivum Var Inqalab-91
under NaCl Stress,” Pakistan Journal of Biological Sci-
ence, Vol. 3, 2000, pp. 1016-1023.
doi:10.3923/pjbs.2000.1016.1023
[27] A. Khalid, M. Arshad and Z. A. Zahir, “Screening Plant
Growth Promoting Rhizobacteria for Improving Growth
and Yield of Wheat,” Journal of Applied Microbiology,
Copyright © 2013 SciRes. AJPS
Auxin Producing Pseudomonas Strains: Biological Candidates to Modulate the Growth
of Triticum aestivum Beneficially
Copyright © 2013 SciRes. AJPS
1700
Vol. 96, No. 3, 2004, pp. 473-480.
doi:10.1046/j.1365-2672.2003.02161.x
[28] H. N. Asghar, Z. A. Zahir and M. Arshad, “Screening
Rhizobacteria for Improving the Growth, Yield, and Oil
Content of Canola (Brassica napus L),” Australian Jour-
nal of Agriculture Research, Vol. 55, No. 2, 2004, pp.
187-194. doi:10.1071/AR03112
[29] F. Kamilova, L. V. Kravchenko, A. I. Shaposhnikov, T.
Azarova, N. Makarova and B. Lugtenberg, “Organic Ac-
ids, Sugars, and L-Tryptophan in Exudates of Vegetables
Growing on Stonewool and Their Effects on Activities of
Rhizosphere Bacteria,” Molecular Plant Microbe Interac-
tion, Vol. 19, 2006, pp. 250-256.
doi:10.1094/MPMI-19-0250
[30] M. Ahmed, L. J. Stal and S. Hasnain, “Production of Phy-
tohormone Auxin by Rhizospheric Cyanobacterium Lep-
tolyngbya sp. MMG-1,” Planta Medica, Vol. 77. No. 12.
2011. doi:10.1055/s-0031-1282266
[31] R. Cakmakci, F. Donmez, A. Aydin and F. Sahin, “Growth
Promotion of Plants by Plant Growth-Promoting Rhizo-
bacteria under Greenhouse and Two Different Field Soil
Conditions,” Soil Biology and Biochemistry, Vol. 38, No.
7, 2006, pp. 1482-1487.
doi:10.1016/j.soilbio.2005.09.019
[32] B. Shaharoona. G. M. Jamro, Z. A. Zahir, M. Arshad and
K. S. Memon, “Effectiveness of Various Pseudomonas
spp. and Burkholderia caryophylli Containing ACC De-
aminase for Proving Growth and Yield of Wheat (Triti-
cum aestivum L.),” Journal of Microbiology and Bio-
technology, Vol. 17, 2007, pp. 1300-1307.
[33] B. Hameeda, G. Harini, O. P. Rupela, S. P. Wani and G.
Reddy, “Growth Promotion of Maize by Phosphate Solu-
bilizing Bacteria Isolated from Composts and Macro-
fauna,” Microbiological Research, Vol. 163, No. 2, 2008,
pp. 234-242. doi:10.1016/j.micres.2006.05.009
[34] B. S. Saharan and V. Nehra, “Plant Growth Promoting
Rhizobacteria: A Critical Review,” Life Sciences and Me-
dicine Research, Vol. 21, 2011, pp. 1-30.
[35] A. Hussain and A. Hasnain, “Cytokinin Production by
Some Bacteria: Its Impact on Cell Division in Cucumber
Cotyledons,” African Journal of Microbiological Re-
search, Vol. 3, No. 11, 2009, pp. 704-712
[36] H. Abbaspoor, R. Zabihi, S. Movafegh and M. H. Akbari
Asl, “The Efficiency of Plant Growth Promoting Rhizo-
bacteria (PGPR) on Yield and Yield Components of Two
Varieties of Wheat in Salinity Condition,” Am-Eurasian
Journal of sustainable Agriculture, Vol. 3, 2009, pp. 824-
828.