Nanostructured hybrid materials for bone-tooth unit regeneration

doi:10.4236/ojrm.2013.23008

Paper Menu >>

Journal Menu >>

Vol.2, No.3, 47-52 (2013) Open Journal of Regenerativ e Medicine

http://dx.doi.org/10.4236/ojrm.2013.23008

Nanostructured hybrid materials for bone-tooth unit

regeneration

Sabine Kuchler-Bopp1,2, Thibault Bécavin1,2,3, Tunay Kökten1,2, Florence Fioretti1,2,

Etienne Deveaux3, Nadia Benkirane-Jessel1,2*, Laetitia Keller1,2*

1Institut National de la Santé et de la Recherche Médicale (INSERM), UMR 1109, Osteoarticular and Dental Regenerative

Nanomedicine, Faculté de Médecine, Strasbourg, France; *Corresponding Authors: [email protected], [email protected]

2Université de Strasbourg, Faculté de Chirurgie Dentaire, 1 Place de l’Hôpital, Strasbourg, France

3Université Lille Nord de France, Faculté de Chirurgie Dentaire, Lille, France

Received 19 April 2013; revised 22 May 2013; accepted 16 June 2013

License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly

cited.

ABSTRACT

As a part of regenerative medicine, biomaterials

are largely used in this field of nanotechnology

and tissue engineering research. We have re-

cently developed a new scaffold using electros-

pun nanofibers of Poly (ε-caprolactone), PCL

which is able to mimic the collagen extracellular

matrix of cells. The aim of this study was to en-

gineer a biological and implantable structure

leading the regeneration of the tooth-bone unit.

For this aim, we have cultured mouse osteo-

blasts embedded in a collagen gel on the nano-

fibrous membrane and coupled this structure

with an embryonic dental germ before implanta-

tion. To follow bone and tooth regeneration, we

have performed RT-PCR, histology and im-

munofluorescence analysis. We showed here

that this leaving implantable structure repre-

sents an accurate strategy for bone-tooth unit

regeneration. We report here the first demon-

stration of bone-tooth unit regeneration by us-

ing a strategy based on a synthetic nanostruc-

tured membrane. This electrospun membrane is

manufactured by using an FDA approved poly-

mer, PCL and functionalized with osteoblasts

before incorporation of the tooth germs at ED14

(the first lower molars) to generate bone-tooth

unit in vivo after implantation in mice. Our tech-

nology represents an excellent platform on

which other sophisticated products could be

based.

Keywords: Bone; Nanostructured Material;

Osteoblast; Tissue Engineering; Tooth

1. INTRODUCTION

Biomaterials play central roles in modern strategies in

regenerative medicine and tissue engineering as design-

able biophysical and biochemical environment that direct

cellular behavior and function. The fibrillar collagens are

the most abundant natural polymers in the body and are

found throughout the interstitial spaces with an essential

function to impart structural integrity and strength to

tissues. In the native tissues, the structural extracellular

matrix (ECM) proteins range in diameter from 50 to 500

nm. In order to create scaffolds or ECM analogues,

which are truly biomimicking at this scale, one must em-

ploy nanotechnology. Recent advances in nanotechnol-

ogy have led to a variety of approaches for the develop-

ment of engineered ECM analogues. To date, three pro-

cessing techniques (self-assembly, phase separation, and

electrospinning) have evolved to allow the fabrication of

nanofibrous scaffolds. With these advances, the long-

awaited and much anticipated construction of a truly “bio-

mimicking” or “ideal” tissue engineered environment, or

scaffold, for a variety of tissues is now highly feasible.

The intricate fibrillar architecture of natural ECM

components has inspired several researchers to produce

materials with similar structure. Upon fibers that are tens

of microns in diameter, cells seem to respond as though

to a 2-D substrate, acquiring an unnatural flat shape,

leading to a nonphysiological, asymmetrical occupation

of adhesion receptors; notwithstanding, such matrices

have already shown remarkable success in tissue engi-

neering applications, such as in the reconstruction of a

dog urinary bladder 1 or as scaffolds for neural stem

cells to facilitate regeneration after brain injury in a

mouse stroke model 2. Polymer processing technolo-

gies such as electrospinning 3 allow fiber formation

S. Kuchler-Bopp et al. / Open Journal of Regenerative Medicine 2 (2013) 47-52

down to the 10 nm scale. One difficulty in nanofiber

technology is placing cells within a nanofibrillar struc-

ture with pore spaces much smaller than a cellular di-

ameter; somehow the network must be formed in situ,

around the cells, without cellular damage.

Tooth organ engineering is an area of regenerative

medicine. One methodology of this field of research is

based on biomimetic. It tries to replace tooth organ by

mimic epithelial-mesenchymal interaction occurring dur-

ing tooth organ development 4. Today, to build an in-

tact and biological tooth-bone unit and regenerate a func-

tional anchoring system (root, peridental, ligament, al-

veolar bone) remains a major challenge in tooth organ

engineering. Indeed, a correct anchoring system is need-

ed for the complete tooth functionality, for avoiding

tooth ankylosis and to prevent bone damage after tooth

loss. It is expected that bioengineering technology will

be developed for the reconstruction of fully functional

organs in vitro through the precise arrangement of sev-

eral different cell species.

Our strategy is based on an active and cellularized hy-

drogel and nanofibers as a matrix. In this study, we have

used electrospun nanofibers of Poly (ε-caprolactone)

(PCL). PCL is degraded by hydrolysis of its ester link-

ages under physiological conditions (such as in the hu-

man body) and has therefore received a great deal of

attention for use as an implantable biomaterial. In par-

ticular it is especially interesting for the preparation of

long-term implantable devices, owing to its degradation,

which is even slower than that of polylactide. PCL is a

Food and Drug Administration (FDA) approved material

that is used in the human body as (for example) a drug

delivery device, suture (sold under the brand name

Monocryl or generically), or adhesion barrier. We report

here the first demonstration that we are able to regenerate

bone-tooth unit by using a FDA approved electrospun

membrane coated by mixed osteoblasts/collagen.

2. MATERIALS AND METHODS

2.1. Chemicals and Electrospinning

PCL, analytical grade, was purchased from Sigma Al-

drich. PCL was dissolved in a mixture of dichlorometh-

ane/dimethylformamide (DCM/DMF 50/50 v/v) at 15%

wt/v and was stirred overnight before use. Rat-tail type I

collagen was purchased from Institut de Biotechnologies

Jacques Boy. A homemade standard electrospinning set-

up was used to fabricate the PCL scaffolds. The PCL

solution was poured into a 5 ml syringe and ejected

through a needle with a diameter of 0.5 mm at a flow rate

of 1.2 ml/h, thanks to a programmable pump (Harvard

Apparatus). A high-voltage power supply (SPELLMAN,

SL30P10) was used to set 15 kV at the needle. Alumi-

num foils (20 × 20 cm2), connected to the ground at a

distance from the needle of 17 cm, were used to collect

the electrospun PCL scaffold.

2.2. SEM Observation

For morphological study, the PCL scaffolds were

gold-coated (Edwards Sputter Coater) and observed with

a Philips XL-30 ESEM scanning electron microscope in

conventional mode (high vacuum) with a Thornley-

Everhart secondary electron detector.

2.3. Cells Culture

Mice primary osteoblasts were obtain from parietal

bone, cut in small pieces, washed in PBS and treated for

40 min at 37˚C with PBS containing collagenase (50

µg/ml) and fungizone (5 µg/ml). After washing in PBS,

bone pieces were cultured in Dulbecco’s modified Ea-

gle’s medium (D-MEM®) containing 50 U/ml penicillin,

50 µg/ml streptomycin, 5 µg/ml fungizone, 1% sodium

pyruvate, 0.1% ascorbic acid and 10% FBS (Life Tech-

nologies, Paisley, UK). The cultures were incubated at

37˚C in a humidified atmosphere of 5% CO2. After 4

days the medium was changed. The generated osteoblasts

were cultured in 75 cm2 flasks and medium was changed

every 3 days.

2.4. Immunocytochemistry and Osteoblasts

Mineralization Staining

Cells were cultured for 14 days on electrospun PCL

membrane, fixed with paraformaldehyde (PFA) 4% dur-

ing 1 h, permeabilized with 0.1% PBS-Triton X-100 for

1 h, saturated with BSA 0.1% and incubated for 20 min

with Alexa Fluor 546-conjugated phalloidin (Molecular

Probes) for F-actin labeling and 5 min with 200 nM

DAPI (Sigma) for nuclear staining. After saturation, cells

were also incubated with the primary antibodies: Osteo-

calcin, Osteonectin, Osteopontin and Collagen I. After rin-

sing with PBS, cells were incubated with secondary an-

tibodies; anti-goat alexa fluor 488 for Osteocalcin and

Osteonectin and anti-rabbit alexa fluor 488 for Collagen I

and Osteopontin. For hematoxylin staining, cells were fix-

ed with PFA and then stained with hematoxylin 10%

(w/v) for 15 min, rinsed with water and observed. For red

alizarin staining, cells were fixed with ethanol 70% and

stained with red alizarin 1% (w/v), dried and observed.

2.5. RNA Isolation and RT-PCR Analysis

RT-PCR was performed on osteoblasts cultured for 7

and 14 days. Total RNA was isolated by affinity chro-

matography using the RNeasy® Minikit (Qiagen Inc.,

Hilden, Germany) and reverse-transcribed with oligo (dT)

12 and Superscript III (Invitrogen), according to the

manufacturer protocols. In each experiment 1 μg of total

S. Kuchler-Bopp et al. / Open Journal of Regenerative Medicine 2 (2013) 47-52

RNA was used for RT-PCR amplification was carried out

with the Go Taq Hot Start kit (Promega, France) ac-

cording to the manufacturer’s instructions, using the spe-

cific primers (Table 1). PCR conditions were as fol-

lowed: initial denaturation of 3 min at 94˚C followed by

35 cycles at 94˚C for 1 min, annealing for 1 min at 58˚C

and elongation for 1 min at 72˚C, with a final extension

of 10 min at 72˚C. PCR products were separated by elec-

trophoresis on 1.5% agarose gels.

2.6. Molar ED14 Culture

The first lower molars were dissected from ICR mouse

(Charles River Laboratories), embryos at Embryonic Day

(ED) 14. All procedures were in compliance with the

recommendations of the European Economic Commu-

nity (86/609/CEE) on use and care of laboratory animals.

Molars have been cultured for 5 days on the electrospun

PCL membrane and on a semi-solid medium as previ-

ously described 5,6.

2.7. Implant Preparation and in Vivo

Implantation

For the Collagen preparation, 3 ml of Rat Tail Type I

Collagen (Institut de Biotechnologies Jacques Boy) were

mixed with 5.5 ml of medium containing 10% FBS, 0.5

ml of a 0.1 M NaOH and 1 ml of osteoblasts suspension

at 2 × 105 cells/ml. 0.1 ml of osteoblasts suspension/ col-

lagen preparation were deposited on the top of the elec-

trospun PCL membrane. After adding the ED14 tooth

germs, the construct was incubated at 37˚C for 30 min

before implantation. For in vitro analysis, the osteoblasts

were cultured for 7 and 14 days on electrospun PCL

membrane. For in vivo analysis, the samples were im-

planted between skin and muscles behind the ears in

mice (8 weeks old ICR) for 2 weeks. For histology, sam-

ples were fixed in Bouin-Hollande, embedded in paraffin

and 5 µm serial sections were stained with Mallory. Im-

planted samples were demineralized in 15% EDTA be-

fore embedding in paraffin. For immunofluorescence,

implants were embedded in Tissue-Tek and frozen at

−20˚C. Sections (10 μm) were stained with anti-CD31

(BD Pharmingen) for the detection of vascular endothe-

lial cells, and with Osteopontin for the detection of bone.

After washing with PBS, sections were incubated with

secondary anti-rabbit antibodies conjugated to Alexa 594

and anti-rat antibodies conjugated to Alexa 488 (Mo-

lecular Probes, Invitrogen).

3. RESULTS AND DISCUSSION

3.1. In Vitro Bone Induction Analysis

For bone induction analysis, we have currently analyz-

ed the biocompatibility of our electrospun PCL mem-

brane after incubation of primary mice osteoblasts by

SEM analysis (Figure 1). Moreover, our results indicated

clearly that after 4 hours, the adhesion of cells growing

on the surface of the membrane become comparable to

the positive control including plastic support (data not

shown).

We have also studied the behavior of mice osteoblasts

growing on nanofibrous PCL membrane by histology

(Figures 2(A)-(C)) and immunofluorescence (Figures

2(D)-(H)). After 14 days in vitro, these cells expressed

some bone specific proteins: collagen I, Osteonectin, Os-

teocalcin and Osteopontin (Figures 2(E)-(H)). Further-

more we showed a nice mineralization by red alzarin in

these cells after 14 days in vitro (Figure 2 (C)) and nor-

mal actin distribution (Figure 2 (D)). Gene expression of

these molecules was also analyzed by RT-PCR (Figure 3)

in 7 and 14 days cultured osteoblasts on the electrospun

PCL membrane. Our results demonstrated clearly that the

nanofibrous PCL membrane could be considered as a

suitable scaffold for bone tissue engineering.

3.2. In Vivo Analysis of the Engineering

Tooth-Bone Unit

Recently, there has been an increasing interest and

awareness of the importance of the sub-tooth bone for its

role in the pathogenic processes. It’s necessary to care-

fully consider this structure in the treatment of tooth

damage, in the evaluation of the results over time and in

the determination of the patient prognosis. In fact, the

conditions of teeth and its supporting bone are tightly

coupled and should be viewed as a connected bone-tooth

unit.

For the in vivo tooth-bone unit regeneration, we ana-

Table 1. Forward and reverse primers used for RT-PCR.

Primers Forward Reverse

GAPDH CCATGGAGAAGGCCGGGG CAAAGTTGTCATGGATGACC

Collagen1 AATGGTGAGACGTGGAAACCCGAG CGACTCCTACATCTTCTGAGTTTGG

Osteopontin GACCATGAGATTGACAGTGATTTG TGATGTTCCAGGCTGGCTTTG

Osteocalcin GACAAAGCCTTCATGTCCAAGC AAAGCCGAGCTGCCAGAGTTTG

Osteonectin TGAGAATGAGAAGCGCCTGGA AAGGGGGTAATGGGAGGGGTG

S. Kuchler-Bopp et al. / Open Journal of Regenerative Medicine 2 (2013) 47-52

Figure 1. SEM observation of the nanofibrous PCL scaffolds

(A, B). Bar = 1 μm.

Figure 2. Behaviour of mice osteoblasts growing

on PCL nanofibrous membrane during 14 days.

Hematoxylin staining for histology ((A), (B)),

red alizarin staining for mineralization (C), alexa

fluor 546-conjugated phalloidin for F-actin la-

beling (D) and immunofluorescence ((E)-(H)).

Collagen I (E), Osteonectin (F), Osteocalcin (G),

Osteopontin (H). Bar = 50 μm.

Figure 3. RT-PCR performed on mice osteoblasts cultured for 7

and 14 days on PCL membrane. The genes specifically

observed were: Collagen I (1), Osteopontin (2), Osteocalcin (3),

Osteonectin (4) and GADPH (5) for a control.

lyzed the subcutaneous implantation of the ED14 first

lower molars cultured during 5 days on the nanofibrous

PCL membrane (Figure 4 (A)). We observed a correct

development of the crown, including functional odonto-

blasts and ameloblasts secreting dentin and enamel re-

spectively. Furthermore, the gradients of odontoblast

differentiation were maintained in the root portion.

We then test the possibility to regenerate bone-tooth

unit by using a hybrid nanostructured and living material.

After in vivo implantation of the tooth germs at ED14,

cultured 5 days on the membrane without adding os-

teoblasts (Figure 4 (A)), no bone induction was detected.

Interestingly, by adding mixed osteoblasts/collagen as a

coating of the membrane (nanostructured living mem-

brane) and after incubation of the tooth germs at ED14

and implantation, we have shown bone induction (Figure

4 (B)). In these conditions, the developed tooth exhibited

correct epithelial histogenesis (Figure 4 (B)) and allow-

ed the functional differentiation of odontoblasts (Figure

4 (D)) and ameloblasts (Figures 4 (E)-(H)). Induced

bone was observed around the tooth (Figures 4 (B),

(F)-(H)) and especially near the root (Figures 4 (G) and

(H)). Cementoblasts are in contact with the root dentin

and begin to secrete cement (Figure 4 (H)). At this stage

of development, orientation of the future fibers of the

peridental ligament can be yet observed (Figure 4 (H)).

For more characterization of the induced bone-tooth unit

growing on this nanofibers membrane, the blood vessels

in the dental pulp and in the peripheral tissue were

stained with an anti-CD31 antibody and the bone was

visualized with anti-Osteopontin antibody (Figure 4 (I)).

We then controlled that collagen had no effect on teeth

development after implantation under skin (Figure 4

(C)). We attempt to implant ED14 molar with mixed

murine osteoblasts/collagen without PCL membrane,

with no results. Based on these results, we have reported

here the first demonstration of a unique nanostructured

material for bone-tooth unit regeneration in vivo. Thus,

PCL nanofibrous membrane coated by mixed osteo-

blasts/collagen could represent a promising strategy of

nanostructured living membrane for in vivo bone-tooth

unit regeneration.

In the last years, more intentions are carrying on func-

tionalization of different scaffold 3,7-18. Multi layers

film is one of the multiple technologies used to incorpo-

rate bioactives molecules 8-10 . Leading to a nanoar-

chitecture, these new generation of delivery molecules

scaffold can provide the control of cell differentiation,

inflammation 11,12 by the diffusion of growth factors,

nucleic acids 13,15 in a controlled period of time and in

a restricted localization. For example, the layer-by-layer

technology can embedded active molecules into the mul-

tilayered films. Recently, we have designed an in vitro

culture system based on an active film functionalized by

S. Kuchler-Bopp et al. / Open Journal of Regenerative Medicine 2 (2013) 47-52 51

Figure 4. Bone-tooth unit regeneration in vivo. In vivo implantation for 2 weeks of ED14 first

lower molars cultured 5 days on electrospun PCL membrane (A), on mixed murine os-

teoblasts/collagen coated electrospun PCL membrane ((B), (D)-(I)) or on PCL membrane in

the presence of collagen (C). The explants were stained with Mallory ((A)-(H)). The blood

vessels in the dental pulp and in the peridental tissue were stained with the anti-CD31 anti-

body (green) and the regenerated bone with the anti-Osteopontin antibody (red) (I). Am:

ameloblasts, BV: blood vessel, Cb: cementoblasts, D: dentin, DP: dental pulp, E: enamel, Mb:

membrane, Od: odontoblasts, Pd: predentin. Bars = 100 μm ((A), (B)), 50 μm ((C), (I)), 25 μm

(G) and 12.5 μm ((D)-(F), (H)).

BMP-4 and/or Noggin. Our results demonstrated clearly

the possibility to control in situ apoptosis during tooth

development mediated by both BMP-4 and Noggin in-

corporated into our active films 19. We have also

shown that BMP-2 functionalized PCL membrane was

able to increase bone tissue regeneration after implanta-

tion 20. To increase the regeneration of this complex

bone-tooth unit, it could be relevant to combine these

two strategies (membrane functionalization and tooth

regeneration). Particular attention has to be done to un-

derstand the interaction between the new bone and the

tooth root. To regenerate of real functional bone-tooth

unit, the periodontal ligament formation must be also

achieved.

4. CONCLUSION

With this strategy it should be possible to fabricate a

combination cell-therapy implant capable of robust and

durable tooth regeneration in large bone defects, when

adding cells from patients become needed, to generate

bone-tooth unit. We believe that our results make a sig-

nificant contribution to the area of regenerative medi-

cine and more precisely to bone and tooth related bio-

materials. The concepts discovered here are applicable to

a broad class of tissues and may serve to design sophis-

ticated implants.

5. ACKNOWLEDGEMENTS

This work was supported by the project NEOTISSAGE from the

“Agence Nationale de la Recherche, ANR” and “Alsace contre le Can-

cer”, N. J. thanks the Faculté de Chirurgie Dentaire de Strasbourg for

financial support. N. J. is indebted to CHU de Nancy, Hôpital Central,

“Chirurgie Orthopédique et Traumatologie” (Contrat d’interface IN-

SERM vers l’hôpital). We are indebted to Hervé Gegout for his help

and nice work on histology and Mathieu Erhardt for SEM.

REFERENCES

[1] Oberpenning, F., Meng, J., Yoo, J.J. and Atala, A. (1999)

De novo reconstitution of a functional mammalian uri-

nary bladder by tissue engineering. Nature Biotechnology,

17, 149-155. doi:10.1038/6146

[2] Park, K.I., Teng, Y.D. and Snyder, E.Y. (2002) The in-

jured brain interacts reciprocally with neural stem cells

supported by scaffolds to reconstitute lost tissue. Nature

Biotechnology, 20, 1111-1117. doi:10.1038/nbt751

[3] Kenawy, el R., Layman, J.M., Watkins, J.R., Bowlin, G.L.,

Matthews, J.A., Simpson, D.G. and Wnek, G.E. (2003).

Electrospinning of poly(ethylene-co-vinyl alcohol) fibers.

S. Kuchler-Bopp et al. / Open Journal of Regenerative Medicine 2 (2013) 47-52

Biomaterials, 24, 907-913. doi:10.1155/2011/201834

[4] Nait Lechguer, A., Couble, M.L., Labert, N., Kuchler-

Bopp, S., Keller, L., Magloire, H., Bleicher, F. and Lesot,

H. (2011) Cell differentiation and matrix organization in

engineered teeth. Journal of Dental Research, 90, 583-

589. doi:10.1177/0022034510391796

[5] Nait Lechguer, A., Kuchler-Bopp, S., Hu, B., Haikel, Y.

and Lesot, H. (2008) Vascularization of engineered teeth.

Journal of Dental Research, 87, 1138-1143.

doi:10.1177/154405910808701216

[6] Hu, B., Nadiri, A., Bopp-Kuchler, S., Perrin-Schmitt, F.

and Lesot, H. (2005) Dental epithelial histomorphogene-

sis in vitro. Journal of Dental Research, 84, 521-525.

doi:10.1177/154405910508400607

[7] Zhang, S. (2003) Fabrication of novel biomaterials through

molecular self-assembly. Nature Biotechnology, 21, 1171-

1178. doi:10.1038/nbt874

[8] Lynn, D.M. (2006) Layers of opportunity: Nanostruc-

tured polymer assemblies for the delivery of macromo-

lecular therapeutics. Soft Matter, 2, 269-273.

doi:10.1039/b517860f

[9] Decher, G. (1997) Fuzzy nanoassemblies: Toward layered

polymeric multicomposites. Science, 277, 1232-1237.

doi:10.1126/science.277.5330.1232

[10] Jessel, N., Atalar, F., Lavalle, P., Mutterer, J., Decher, G.,

Schaaf, P., Voegel, J.-C. and Ogier, J. (2003) Bioactive

coatings based on a polyelectrolyte multilayer architec-

ture functionalized by embedded proteins. Advanced Ma-

terials, 15, 692-695. doi:10.1002/adma.200304634

[11] Benkirane-Jessel, N., Lavalle, P., Meyer, F., Audouin, F.,

Frisch, B., Schaaf, P., Ogier, J., Decher, G. and Voegel,

J.-C. (2004) Control of monocyte morphology on and re-

sponse to model surfaces for implants equipped with

anti-inflammatory agents. Advanced Materials, 16, 1507-

1511. doi:10.1002/adma.200306613

[12] Benkirane-Jessel, N., Schwinte, P., Falvey, P., Darcy, R.,

Haikel, Y., Schaaf, P., Voegel, J.-C. and Ogier, J. (2004)

Build-up of polypeptide multilayer coatings with anti-in-

flammatory properties based on the embedding of piroxi-

cam-cyclodextrin complexes. Advanced Functional Ma-

terials, 14, 174-182. doi:10.1002/adfm.200304413

[13] Jessel, N., Oulad-Abdeighani, M., Meyer, F., Lavalle, P.,

Haikel, Y., Schaaf, P. and Voegel, J.-C. (2006) Multiple

and time-scheduled in situ DNA delivery mediated by

beta-cyclodextrin embedded in a polyelectrolyte multi-

layer. Proceedings of the National Academy of Sciences,

103, 8618-8621. doi:10.1073/pnas.0508246103

[14] Kim, B.S., Park, S.W. and Hammond, P.T. (2008) Hydro-

gen-bonding layer-by-layer-assembled biodegradable po-

lymeric micelles as drug delivery vehicles from surfaces.

ACS Nano, 2, 386-392. doi:10.1021/nn700408z

[15] Benkirane-Jessel, N., Lavalle, P., Hubsch, E., Holl, V.,

Senger, B., Haikel, Y., Voegel, J.C., Ogier, J. and Schaaf,

P. (2005) Short-time timing of the biological activity of

functionalized polyelectrolyte multilayers. Advanced Fun-

ctional Materials, 4, 648-654.

doi:10.1002/adfm.200400129

[16] Dierich, A., Le Guen, E., Messaddeq, N., Stoltz, J.F.,

Netter, P., Schaaf, P., Voegel, J.-C. and Benkirane-Jessel,

N. (2007) Bone formation mediated by synergy-acting

growth factors embedded in a polyelectrolyte multilayer

film. Advanced Materials, 19, 693-697.

doi:10.1002/adma.200601271

[17] Facca, S., Cortez, C., Mendoza-Palomares, C., Messadeq,

N., Dierich, A., Johnston, A.P., Mainard, D., Voegel, J.-C.,

Caruso, F. and Benkirane-Jessel, N. (2010) Active multi-

layered capsules for in vivo bone formation. Proceedings

of the National Academy of Sciences, 107, 3406-3411.

doi:10.1073/pnas.0908531107

[18] Krogman, K.C., Lowery, J.L., Zacharia, N.S., Rutledge,

G.C. and Hammond, P.T. (2009) Spraying asymmetry into

functional membranes layer-by-layer. Nature Materials, 8,

512-518. doi:10.1038/nmat2430

[19] Nadiri, A., Kuchler-Bopp, S., Mjahed, H., Hu, B, Haikel,

Y., Schaaf, P., Voegel, J.-C. and Benkirane-Jessel, N.

(2007) Cell apoptosis control using BMP4 and noggin

embedded in a polyelectrolyte multilayer film. Small, 9,

1577-1583. doi:10.1002/smll.200700115

[20] Mendoza-Palomares, C., Ferrand, A., Facca, S., Fioretti,

F., Ladam, G., Kuchler-Bopp, S., Regnier, T., Mainard, D.

and Benkirane-Jessel, N. (2012) Smart hybrid materials

equipped by nanoreservoirs of therapeutics. ACS Nano, 6,

483-490. tdoi:10.1021/nn203817t