Open Journal of Stomatology, 2013, 3, 281-286 OJST
doi:10.4236/ojst.2013.35047 Published Online August 2013 (http://www.scirp.org/journal/ojst/)
Lef1 may contribute to agenesis of the third molars in mice
Takehiko Shimizu1,2, Eri Yokoi1, Takahiro Ichinosawa1, Yuri Kiguchi1, Fusae Ishida1,
Takahide Maeda1,2
1Department of Pediatric Dentistry, Nihon University School of Dentistry at Matsudo, Chiba, Japan
2Nihon University Research Institute of Oral Science, Chiba, Japan
Received 6 June 2013; revised 6 July 2013; accepted 21 July 2013
Copyright © 2013 Takehiko Shimizu et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT
Tooth agenesis is the most common developmental
anomaly of the human dentition. Epilepsy-like disor-
der (EL) mice, which have a 100% incidence of agen-
esis of the third molars, may be a good model for the
genetic study of human tooth agenesis. Our previous
congenic breeding strategy using EL mice confined a
major locus for agenesis of M3, designated am3, with-
in an approximately 1 Mega base pair (Mbp) interval
on chromosome 3, which contains five known genes;
Lef1, Hadh, Cyp2u1, Sgms2 and Papss1. The aim of
this study was to identify the strongest candidate for
am3 among the five genes using real-time PCR analy-
sis. The tooth germs of M3 in the bud stage of EL and
control mice were dissected out, and total RNA was
extracted. In real-time PCR analysis, a significantly
low level of expression of Lef1, which is one of the
essential transcription factors for early tooth devel-
opment, was observed in M3 of EL mice. In addition,
a significantly low level of expression of Fgf4, which
is a direct transcriptional target for LEF1 in early
tooth development, was observed in M3 of EL mice.
Our results suggest that the cause of M3 agenesis of
EL mice may be a low level of Lef1 expression in M3
in the bud stage of EL mice.
Keywords: Hypodontia; Gene Expression; EL Mice
1. INTRODUCTION
Tooth agenesis, the congenital absence of one or more
teeth, is one of the most common craniofacial anomalies
in humans. Its prevalence varies from 1.6% to 9.6%
when the third molars are not considered [1]. The most
frequently missing teeth are the third molars, which are
absent in around 20% of the population, followed by the
mandibular second premolars and maxillary lateral inci-
sors [2]. It appears as both syndromic and non-syndro-
mic/isolated features. The genes SHH [3], PITX2 [4],
IRF6 [5] and p63 [6] have been associated with syn-
dromic tooth agenesis. Mutations in MSX1 [7], PAX9 [8],
AXIN2 [9], WNT10A [10] and the ectodermal dysplasia
genes EDA [11], EDAR [12] and EDARADD [13] have
been associated with non-syndromic tooth agenesis.
However, in the majority of cases of tooth agenesis, the
causes remain unknown [14-18], implying that other
genes must be involved.
Inbred mice with homozygous alleles and a high de-
gree of homology with human genes are frequently used
in studies seeking to identify disease loci. Mice have a
short life cycle that enables easy transgenerational ob-
servation and can be reared under the same conditions so
that environmental factors can be kept almost constant,
making them useful for genetic research. The normal
mouse dentition is composed of one continuously grow-
ing incisor and three molars of limited growth in each
quadrant. Congenital tooth agenesis is rarely observed in
inbred mouse strains. However, the epilepsy-like disor-
der (EL) mouse, which was developed as an animal
model for the study of epilepsy [19], has a 100% inci-
dence of absence of M3 without any generalized cranio-
facial anomalies [20]. EL mice therefore may be a good
model for the genetic study of agenesis of the third molar
or other types of tooth agenesis in humans. Our previous
genome-wide scan using F2 progeny from intercrosses
between EL mice and the wild-type mice identified that
alleles on chromosome 3 contribute to M3 agenesis in
EL mice, suggesting independence from alleles of epi-
lepsy [21]. Previous genes causing isolated tooth agen-
esis; Msx1, Pax9, Axin2, Wnt10a, Eda, Edar and Eda-
radd were clearly ruled out from the candidates for M3
agenesis in EL mice [22].
Recently, a major locus for agenesis of M3 (allele
symbol am3) was defined in approximately the 1 Mbp
region of chromosome 3 using a congenic breeding strat-
egy [23]. The region contained five known genes; Lef1,
Published Online August 2013 in SciRes. http://www.scirp.org/journal/ojst
T. Shimizu et al. / Open Journal of Stomatology 3 (2013) 281-286
282
Hadh, Cyp2u1, Sgms2 and Papss1. The purpose of this
study was to identify the strongest candidate for am3
among the five genes by gene expression analysis.
2. MATERIALS AND METHODS
2.1. Mice
EL mice were purchased from the Laboratory Animal
Resource Bank at National Institute of Biomedical In-
novation (Osaka, Japan) and MSM/Msf mice, a wild-
type strain derived from Mus musculus molossinus pro-
genitors, were obtained from the animal facilities at the
National Institute of Genetics (Mishima, Japan). All ani-
mals were maintained and used in accordance with the
guidelines of the Nihon University Intramural Animal
Use. The experimental protocol was approved by the
Institutional Animal Experiment Committee (No. AP11
MD029).
2.2. Microdissection of Tooth Germ of M3 and
Total RNA Isolation
Ten EL mice and ten MSM mice were sacrificed under
anesthesia on postnatal Day 3 (P3) when the tooth germ
of M3 is in the bud stage. The heads were immediately
embedded in Tissue-Tek OCT compound (Sakura Fi-
neteck Japan, Tokyo, Japan). Serial sections of 30 μm
thickness were prepared using a Leica cryostat (Leica
Microsystems, Wetzlar, Germany). Sections were dehy-
drated in 70% ethanol for 15 sec and stained with 0.25%
toluidine blue for 15 sec. The upper and lower tooth
germs of M3 were dissected out using a needle under a
dissection microscope, avoiding the tissues surrounding
the tooth follicle (Figure 1). A total of 40 M3s from each
strain were collected and stored in RNAlaterTM RNA
Stabilization Reagent (Qiagen, Tokyo, Japan) and total
P3 P4 P5
MSM
EL
Figure 1. The third molar (M3) in EL and MSM/ms
(MSM) at postnatal 3-day (P3), P4 and P5 (frontal sec-
tion). *M3s were dissected out and collected from the
sections for total RNA extraction. Bar indicates 100 μm.
RNA from sections was isolated using an RNeasy Total
RNA kit (Qiagen, Tokyo, Japan), in accordance with the
manufacturer’s instructions. The quality and integrity of
the RNA were checked by means of spectrophotometry
and agarose-gel electrophoresis.
2.3. Reverse-Transcriptase Polymerase
Chain-Reaction (RT-PCR)
Total RNA (100 ng) from tooth germs of M3 of EL mice
and MSM mice was reverse-transcribed with the
PrimeScript® High Fidelity RT-PCR kit (Takara, Tokyo,
Japan). The reverse-transcribed cDNA was amplified
with nine pairs for the nine genes of the PCR primers
listed in Table 1. The 130.73 - 131.69 Mbp region on
chromosome 3 for am3 defined in EL congenic mice [23]
contains five known genes; Lef1, Hadh, Cyp2u1, Sgms2
and Papss1, according to the information from Ensembl
(http://asia.ensembl.org/index.html). In addition to these
five genes, Wnt10a, which is upstream signaling mole-
cule for Lef1 in early tooth development, and Fgf4 and
Fgf3, which are downstream signaling molecules for
Lef1 [24], were included in the analysis. Glyceralde-
hyde-3-phosphate dehydrogenase (Gapdh) was used as
control. cDNAs were amplified by 30 cycles at 95˚C for
30 sec, 60˚C for 30 sec, and 72˚C for 30 sec in the Ge-
neAmp® PCR System 9700 (Applied Biosystems) and
were analyzed by agarose gel electrophoresis. Products
spanned at least one intron, so that cDNA products could
be distinguished from potential genomic DNA products.
The presence/absence and intensity of the PCR products
for each gene were compared using the KODAK Mo-
lecular Imaging System (Kodak).
2.4. Quantitative Real-Time PCR
PCR amplification of cDNA was performed using Thermo
Table 1. Primer sets for RT-PCR and real-time PCR.
Gene Forward/ Reverse Primer (5’-3’) Size (bp)
Lef1
Hadh
Cyp2u1
Sgms2
Papss1
Wnt10a
Fgf4
Fgf3
Gapdh
aaggcgatccccagaaggag
agggtgttctctggccttgt
ttgcgctccatgtcctcctc
gactctcctcaattcccttc
ggctgaagtgttcagtgacc
cgtatgcaaactcctcgatg
tcgaccgggtcaaatgggca
gcattccgggcacaggtaac
gggatgcagagagcaaccaa
gtgtagcacggaatgccgtg
tggagactcggaacaaagtc
agcttccgacggaaagcttc
gctgggcctcaaaaggcttc
ctgctcatggccacgaagaa
ctggccatgaacaagagagg
tgccattcaccgacacgtac
ggaagcccatcaccatcttc
cgtggttcacacccatcaca
190
194
188
190
194
193
192
190
203
Copyright © 2013 SciRes. OJST
T. Shimizu et al. / Open Journal of Stomatology 3 (2013) 281-286
Copyright © 2013 SciRes.
283
Scientific DyNAmo SYBR Green qPCR kits (Thermo
Fisher Scientific, Kanagawa, Japan). The primers for
real-time RCR were the same as those used for RT-PCR.
The PCR program was as follows: initial denaturation at
95˚C for 5 min, followed by 40 cycles at 95˚C for 30 sec,
60˚C for 30 sec, and 72˚C for 30 sec in the DNA Engine
OPTICON® Continuous Fluorescence Detector (BioRad).
Gene expression levels were normalized according to the
level of Gapdh expression. Relative amounts of Gapdh
mRNA in each sample were calculated from standard
curves obtained by sequential dilution of total RNA pre-
pared from M3 at P3. We used the Mann-Whitney test to
compare the expression levels of five experiments in EL
and MSM mice.
OJST
3. RESULT
Significant decreases in the quantity of Lef1 mRNA in
M3 of EL mice compared to that of MSM mice were
detected in both RT-PCR and real-time PCR analysis
(Figure 2). Significantly lower level of expression of
Fgf4 and Fgf3 from M3 of EL mice than that of MSM
mice was detected in both RT-PCR and real-time PCR
analysis (Figure 3).
4. DISCUSSION
In a previous study, to determine the location of the am3
locus in vivo, we produced EL congenic strains for am3
in which the restricted interval on chromosome 3 of EL
mice was replaced by a wild-type-derived homologue.
The congenic mice that were either heterozygous or ho-
mozygous for the wild-type-derived interval exhibited a
significant decrease in the incidence of M3 agenesis. The
results confined the am3 locus to an approximately 1
Mbp region flanked by AC114668.1 at 130.73 Mbp and
Dkk2 at 131.69 Mbp on chromosome 3, demonstrating
the five candidate genes for am3; Lef1, Hadh, Cyp 2u1,
Sgms2 and Papss1 based on Ensembl information [23].
Lef1 is a cell-type-specific transcription factor that
participates in the Wnt signaling pathway and Lef1 has a
critical role in regulating tooth morphogenesis [25,26].
Lef/ mouse embryos exhibited that the absence of LEF1
resulted in complete lack of tooth development [24].
LEF1 directly regulates Fgf4 gene expression, and FGF4
regulates the expression of Fgf3 in the dental mesen-
chyme to mediate the critical epithelial-mesenchymal
interaction [27]. In the present study, significant de-
creases in the quantity of Lef1 mRNA in M3 of EL mice
compared to that of MSM mice were found. In addition,
a significantly lower level of expression of Fgf4 and
Fgf3 from M3 of EL mice than that of MSM mice was
detected, while there was no difference between EL and
MSM mice in expression of Wnt10a, which is a direct
upstream signaling molecule for Lef1 in the bud stage.
(a)
(b)
Figure 2. mRNA expression of Lef1, Hadh, Cyp2u1, Sgms2 and Papss1 in the third molar
(M3) in the bud stage at postnatal 3-day. (a) RT-PCR analysis; (b) Real-time PCR analysis. The
relative amounts of Lef1, Hadh, Cyp2u1, Sgms2 and Papss1 mRNA were divided by that of
Gapdh. Results are expressed as the means of five experiments ±SD. Significantly lower level
of expression of Lef1 from M3 of EL mice than that of MSM mice was detected. *p < 0.05.
T. Shimizu et al. / Open Journal of Stomatology 3 (2013) 281-286
284
(a)
(b)
Figure 3. mRNA expression of Wnt10a, Fgf4 and Fgf3 in the third molar (M3) in the
bud stage at postnatal 3-day. (a) RT-PCR analysis; (b) Real-time PCR analysis. The
relative amounts of Wnt10a, Fgf4 and Fgf3 mRNA were divided by that of Gapdh.
Results are expressed as the means of five experiments ±SD. Significantly lower
level of expression of Fgf4 and Fgf3 from M3 of EL mice than that of MSM mice
was detected. *p < 0.05.
Interestingly, expression of these genes encoding signal-
ing molecules in M3 of EL mice in the bud stage was
reported to be very similar to that in the first molar (M1)
in the bud stage of Lef1/ mice. M1s in the late bud
stage of Lef1/ embryos showed absence of expression
of Fgf4 and Fgf3, but showed expression of Wnt10a [24].
This resemblance with previous findings suggested that
Fgf4 might not be activated by LEF1 from M3 of EL
mice, similar to the failure of Fgf4 activation in M1s of
Lef1/ embryos. The decrease in Lef1 may inhibit the
activation of Fgf4 and Fgf3 in M3 in the bud stage of EL
mice. Fgf4 and Fgf3, which are located on chromosome
7, had been excluded from the list of potential candidates
for am3 based on the results of previous linkage analysis
[21]. Our previous mutation analysis for the candidate
genes did not find any mutation in the coding sequence
of the five candidate genes from EL mice, and suggested
that gene mutation is not responsible for M3 agenesis in
EL mice [23]. Polymorphism in the other region of Lef1
may be the cause of the decreased expression of Lef1 in
M3 of EL mice.
Other candidates for am3 including Hadh (hydroxya-
cyl-coenzyme A dehydrogenase), Sgms2 (sphingomyelin
synthase 2), Papss1 (3’-phosphoadenosine 5’-phospho-
sulfate synthase 1) and Cyp2u1 (cytochrome P450, fam-
ily 2, subfamily u, polypeptide 1), show no evidence of
association with hypodontia or early odontogenesis.
Hadh plays a critical role in the mitochondrial beta-oxi-
dation of short chain fatty acids and the gene mutation
causes familial hyperinsulinemic hypoglycemia [28].
Sgms2 catalyzes the synthesis of sphingomyelin and dia-
cylglycerol from phosphatidylcholine and ceramide, and
Sgms2/ mice exhibited difficulty of this conversion [29].
Papss1 is a bifunctional enzyme with both adenosine
triphosphate sulfurylase and adenosine 5’-phosphosulfate
kinase activity [30]. Cyp2u1 catalyzes the hydroxylation
of arachidonic acid, docosahexaenoic acid and other long
chain fatty acids [31]. In present study, we detected no
significant difference in mRNA expression for Hadh,
Sgms2, Cyp2u1 and Papss1 in M3 between EL and wild-
type mice, suggesting no association with M3 agenesis.
Based on our gene expression analysis, we conclude
that Lef1 is the strongest candidate for am3, although the
cause of the decrease of Lef1 expression in M3 of EL
mice is still unclear. Unknown genes must be involved in
various types of human tooth agenesis; therefore, Lef1
might contribute to a form of tooth agenesis. Mutational
analysis of LEF1 in non-syndromic tooth agenesis will
Copyright © 2013 SciRes. OJST
T. Shimizu et al. / Open Journal of Stomatology 3 (2013) 281-286 285
be needed in subsequent experiments. The identification
of am3 in EL mice may provide clues to understanding a
new mechanism of hypodontia, especially agenesis of the
third molars, in humans. In the future, it may also be
possible to apply the mechanism to the field of tooth
regeneration.
5. ACKNOWLEDGEMENTS
This study was supported by JSPS KAKENHI Grant Number 2546
3199.
REFERENCES
[1] Boeira Jr., B.R. and Echeverrigaray, S. (2012) Polymor-
phism in the MSX1 gene in a family with upper lateral
incisor agenesis. Archives of Oral Biology, 57, 1423-
1428. doi:10.1016/j.archoralbio.2012.04.008
[2] Mostowska, A., Biedziak, B. and Jagodzinski, P.P. (2012)
Novel MSX1 mutation in a family with autosomal-
dominant hypodontia of second premolars and third mo-
lars. Archives of Oral Biology, 57, 790-795.
doi:10.1016/j.archoralbio.2012.01.003
[3] Belloni, E., Muenke, M., Roessler, E., Traverso, G.,
Siegel-Bartelt, J., Frumkin, A., Mitchell, H.F., Donis-
Keller, H., Helms, C., Hing, A.V., Heng, H.H., Koop, B.,
Martindale, D., Rommens, J.M., Tsui, L.C. and Scherer,
S.W. (1996) Identification of Sonic hedgehog as a candi-
date gene responsible for holoprosencephaly. Nature Ge-
netics, 14, 353-356. doi:10.1038/ng1196-353
[4] Semina, E.V., Reiter, R., Leysens, N.J., Alward, W.L.,
Small, K.W., Datson, N.A., Siegel-Bartelt, J., Bierke-
Nelson, D., Bitoun, P., Zabel, B.U., Carey, J.C. and Mur-
ray, J.C. (1996) Cloning and characterization of a novel
bicoidrelated homeobox transcription factor gene, RIEG,
involved in Rieger syndrome. Nature Genetics, 14, 392-
399. doi:10.1038/ng1296-392
[5] Kondo, S., Schutte, B.C., Richardson, R.J., Bjork, B.C.,
Knight, A.S., Watanabe, Y., Howard, E., de Lima, R.L.,
Daack-Hirsch, S., Sander, A., McDonald-McGinn, D.M.,
Zackai, E.H., Lammer, E.J., Aylsworth, A.S., Ardinger,
H.H., Lidral, A.C., Pober, B.R., Moreno, L., Arcos-Bur-
gos, M., Valencia, C., Houdayer, C., Bahuau, M., Mor-
etti-Ferreira, D., Richieri-Costa, A., Dixon, M.J. and
Murray, J.C. (2002) Mutations in IRF6 cause Van der
Woude and popliteal pterygium syndromes. Nature Ge-
netics, 32, 285-289. doi:10.1038/ng985
[6] Celli, J., Duijf, P., Hamel, B.C., Bamshad, M., Kramer,
B., Smits, A.P., Newbury-Ecob, R., Hennekam, R.C.,
Van Buggenhout, G., van Haeringen, A., Woods, C.G.,
van Essen, A.J., de Waal, R., Vriend, G., Haber, D.A.,
Yang, A., McKeon, F., Brunner, H.G. and van Bokhoven,
H. (1999) Heterozygous germline mutations in the p53
homolog p63 are the cause of EEC syndrome. Cell, 99,
143-153. doi:10.1016/S0092-8674(00)81646-3
[7] Vastardis, H., Karimbux, N., Guthua, S.W., Seidman, J.G.
and Seidman, C.E. (1996) A human MSX1 homeodomain
missense mutation causes selective tooth agenesis. Nature
Genetics, 13, 417-421. doi:10.1038/ng0896-417
[8] Stockton, D.W., Das, P., Goldenberg, M., D’Souza, R.N.
and Patel, P.I. (2000) Mutation of PAX9 is associated
with oligodontia. Nature Genetics, 24, 18-19.
doi:10.1038/71634
[9] Lammi, L., Arte, S., Somer, M., Jarvinen, H., Lahermo,
P., Thesleff, I., Pirinen, S. and Nieminen, P. (2004) Mu-
tations in AXIN2 cause familial tooth agenesis and pre-
dispose to colorectal cancer. American Journal of Human
Genetics, 74, 1043-1050. doi:10.1086/386293
[10] Kantaputra, P. and Sripathomsawat, W. (2011) WNT10A
and isolated hypodontia. American Journal of Medical
Genetics Part A, 155A, 1119-1122.
doi:10.1002/ajmg.a.33840
[11] Tao, R., Jin, B., Guo, S.Z., Qing, W., Feng, G.Y., Brooks,
D.G., Liu, L., Xu, J., Li, T., Yan, Y. and He, L. (2006) A
novel missense mutation of the EDA gene in a Mongolian
family with congenital hypodontia. Journal of Human
Genetics, 51, 498-502. doi:10.1007/s10038-006-0389-2
[12] Azeem, Z., Naqvi, S.K., Ansar, M., Wali, A., Naveed,
A.K., Ali, G., Hassan, M.J., Tariq, M., Basit, S. and
Ahmad, W. (2009) Recurrent mutations in functionally-
related EDA and EDAR genes underlie X-linked isolated
hypodontia and autosomal recessive hypohidrotic ecto-
dermal dysplasia. Archives of Dermatological Research,
301, 625-629. doi:10.1007/s00403-009-0975-1
[13] Bergendal, B., Klar, J., Stecksén-Blicks, C., Norderyd, J.
and Dahl, N. (2011) Isolated oligodontia associated with
mutations in EDARADD, AXIN2, MSX1, and PAX9
genes. American Journal of Medical Genetics Part A,
155A, 1616-1622. doi:10.1002/ajmg.a.34045
[14] Nieminen, P., Arte, S., Pirinen, S., Peltonen, L. and Thes-
leff, I. (1995) Gene defect in hypodontia: Exclusion of
MSX1 and MSX2 as candidate genes. Human Genetics,
96, 305-308. doi:10.1007/BF00210412
[15] Arte, S., Nieminen, P., Pirinen, S., Thesleff, I. and Pelto-
nen, L. (1996) Gene defect in hypodontia: Exclusion of
EGF, EGFR, and FGF-3 as candidate genes. Journal of
Dental Research, 75, 1346-1352.
doi:10.1177/00220345960750060401
[16] Goldenberg, M., Das, P., Messersmith, M., Stockton,
D.W., Patel, P.I. and D’Souza, R.N. (2000) Clinical, ra-
diographic, and genetic evaluation of a novel form of
autosomal-dominant oligodontia. Journal of Dental Re-
search, 79, 1469-1475.
doi:10.1177/00220345000790070701
[17] Scarel, R.M., Trevilatto, P.C., Di Hipolito Jr., O., Ca-
margo, L.E. and Line, S.R. (2000) Absence of mutations
in the homeodomain of the MSX1 gene in patients with
hypodontia. American Journal of Medical Genetics, 92,
346-349.
doi: 1 0.1002/1096 -8628(20000619)92:5<346::AID-AJMG
10>3.0.CO;2-A
[18] Gerits, A., Nieminen, P., De Muynck, S. and Carels, C.
(2006) Exclusion of coding region mutations in MSX1,
PAX9 and AXIN2 in eight patients with severe oligodon-
tia phenotype. Orthodontics & Craniofacial Research, 9,
129-136. doi:10.1111/j.1601-6343.2006.00367.x
[19] Imaizumi, K. and Nakano, T. (1964) Mutant stocks, strain
El. Mouse News Letter, 31, 57.
Copyright © 2013 SciRes. OJST
T. Shimizu et al. / Open Journal of Stomatology 3 (2013) 281-286
Copyright © 2013 SciRes.
286
OJST
[20] Asada, Y., Shimizu, T., Matsune, K., Shimizu, K., Suzuki,
Y., Takamori, K. and Maeda, T. (2000) Absence of the
third molars in strain EL mice. Pediatric Dental Journal,
10, 19-22.
[21] Nomura, R., Shimizu, T., Asada, Y., Hirukawa, S. and
Maeda, T. (2003) Genetic mapping of absence of the
third molars in EL mice to chromosome 3. Journal of
Dental Research, 82, 786-790.
doi:10.1177/154405910308201005
[22] Shimizu, T., Han, J., Asada, Y., Okamoto, H. and Maeda,
T. (2005) Localization of am3 using EL Congenic Mouse
Strains. Journal of Dental Research, 84, 315-319.
doi:10.1177/154405910508400404
[23] Shimizu, T., Morita, W. and Maeda, T. (2013) Genetic
mapping of agenesis of the third molars in mice. Bio-
chemical Genetics. doi:10.1007/s10528-013-9602-0
[24] Kratochwil, K., Galceran, J., Tontsch, S., Roth, W. and
Grosschedl, R. (2002) FGF4, a direct target of LEF1 and
Wnt signaling, can rescue the arrest of tooth organogene-
sis in Lef1(-/-) mice. Genes & Development, 16, 3173-
3185. doi:10.1101/gad.1035602
[25] van Genderen, C., Okamura, R.M., Fariñas, I., Quo, R.G.,
Parslow, T.G., Bruhn, L. and Grosschedl, R. (1994) De-
velopment of several organs that require inductive epithe-
lial-mesenchymal interactions is impaired in LEF-1-de-
ficient mice. Genes & Development, 8, 2691-2703.
doi:10.1101/gad.8.22.2691
[26] Chen, J., Lan, Y., Baek, J.A., Gao, Y. and Jiang, R. (2009)
Wnt/beta-catenin signaling plays an essential role in ac-
tivation of odontogenic mesenchyme during early tooth
development. Developmental Biology, 334, 174-185.
doi:10.1016/j.ydbio.2009.07.015
[27] Sasaki, T., Ito, Y., Xu, X., Han, J., Bringas, P. Jr., Maeda,
T. Slavkin, H.C., Grosschedl, R. and Chai, Y. (2005)
LEF1 is a critical epithelial survival factor during tooth
morphogenesis. Developmental Biology, 278, 130-143.
doi:10.1016/j.ydbio.2004.10.021
[28] Clayton, P.T., Eaton, S., Aynsley-Green, A., Edginton,
M., Hussain, K., Krywawych, S., Datta, V., Malingre,
H.E., Berger, R. and van den Berg, I.E. (2001) Hyperin-
sulinism in short-chain L-3-hydroxyacyl-CoA dehydro-
genase deficiency reveals the importance of beta-oxida-
tion in insulin secretion. Journal of Clinical Investigation,
108, 457-465.
[29] Liu, J., Zhang, H., Li, Z., Hailemariam, T.K., Chakra-
borty, M., Jiang, K., Qiu, D., Bui, H.H., Peake, D.A., Kuo,
M.S., Wadgaonkar, R., Cao, G. and Jiang, X.C. (2009)
Sphingomyelin synthase 2 is one of the determinants for
plasma and liver sphingomyelin levels in mice. Arterio-
sclerosis, Thrombosis, and Vascular Biology, 29, 850-
856. doi:10.1161/ATVBAHA.109.185223
[30] Sekulic, N., Dietrich, K., Paarmann, I., Ort, S., Konrad,
M. and Lavie, A. (2007) Elucidation of the active con-
formation of the APS-kinase domain of human PAPS
synthetase 1. Journal of Molecular Biology, 367, 488-
500. doi:10.1016/j.jmb.2007.01.025
[31] Choudhary, D., Jansson, I., Stoilov, I., Sarfarazi, M. and
Schenkman, J.B. (2005) Expression patterns of mouse
and human CYP orthologs (families 1-4) during devel-
opment and in different adult tissues. Archives of Bio-
chemistry and Biophysics, 436, 50-61.
doi:10.1016/j.abb.2005.02.001