American Journal of Plant Sciences, 2010, 1, 119-130
doi:10.4236/ajps.2010.12016 Published Online December 2010 (http://www.SciRP.org/journal/ajps)
Copyright © 2010 SciRes. AJPS
119
Nodulation in Onobrychis Perennial Legume
Plants
Zair S. Shakirov1*, Sardor A. Khakimov1, Khabibullo F. Shomurodov2, Bakhtiyar R. Umarov1
1Institute of Microbiology of Uzbekistan Academy of Sciences, Tashkent, Republic of Uzbekistan; 2Scientific Center of Plant
Production “Botanika”, Uzbekistan Academy of Sciences, Tashkent, Uzbekistan.
Received July 12th, 2010; revised August 27th, 2010; accepted September 9th, 2010.
ABSTRACT
A total of 110 strains of nodule bacteria was isolated from plants Onobrychis transcaucasica and Onobrychis choras-
sanica. Nodulation study of bacteria in both Onobrychis plant species in microvegetation experiment gave a very low
nodulation on plant roots. The intensive nodulation of Onobrychis plants was recorded in vegetation experiment and for
Onobrychis transcaucasica the efficiently-nodulating strains were found OT102, OT103, OT117, OT121, OT130,
OT136, ОT139, ОT140, while for Onobrychis chorassanica plants – ОC106, ОC107, ОC109, ОC112, ОT103, ОT117
and ОT123 strains. Nucleotide sequencing of the 16S rRNA gene and BLAST analysis showed that nodule bacteria of
Onobrychis plants were related to Rhizobium, Burkholderia, Enterobacter and Pantoea genera. It has been shown a
possibility of growing up of Onobrychis plants at minimal additional moisture of sabulous soils in the Kyzyl Kum De-
sert, creating artificial pastures and thereby immobilizing the desert blown sands.
Keywords: Onobrychis Transcaucasica, Onobrychis Chorassanica, Nodulation, Nitrogen Fixation, 16S rRNA,
Rhizobium, Burkholderia, Enterobacter, Pantoea
1. Introduction
Although more than on 32 millions Ha world wide alfalfa
is grown, it is conducted a search for new special purpose
forage legumes supported by smaller plantings of species
of Coronilla, Onobrychis, and Lotus [1].
Actually, there was tried an Onobrychis inoculation
experiment, but due to too low germination rates of seeds
and poorer nodulation, no reliable data were obtained [2].
Rhizobia from Canadian soils were selected for cold ad-
aptation with the aim of improving productivity of leg-
umes that are subjected to cool temperatures during the
growing season [3]. One approach was to use rhizobia
associated with legume species indigenous to arctic and
subarctic regions: Mesorhizobium sp. isolated from As-
tragalus, Oxytropis spp. and Rhizobium leguminosarum
from Lathryrus spp. The majority of these rhizobia are
considered as psychrotolerant because they can grow at 0.
The advantages of cold adaptation of arctic Mesorhizo-
bium to improve legume symbiosis were demonstrated
with the temperate forage legume sainfoin (Onobrychis
viciifolia). In laboratory and field studies, arctic rhizobia
were more efficient than temperate (commercial) rhizo-
bia in improving growth of sainfoin and were more
competitive in forming nodules. Biochemical studies on
cold adaptation showed higher synthesis of cold shock
proteins in cold-adapted than in non-adapted arctic
rhizobia. Since arctic Mesorhizobium cannot nodulate
agronomically important legumes, the nodulation genes
and the bacterial signals (Nod factors) were characterized
as a first step to modifying the host specificity of nodula-
tion [3].
The genetic diversity of 44 rhizobial isolates from As-
tragalus, Oxytropis, and Onobrychis spp. originating
from different geographic locations was evaluated by
mapped restriction site polymorphism (MRSP) analysis
of 16S rRNA genes and by PCR DNA fingerprinting
with repetitive sequences (REP-PCR) [4]. From the REP-
PCR data, authors identified only three examples in
which rhizobia from a single plant species appeared to be
closely related (the two strains from Astragalus sinicus,
two strains from Onobrychis viciifolia, and three strains
from Astragalus cicer). These results agree with previous
classifications of other publications by serology, by nu-
merical taxonomy, and by cross-infection experiments in
which rhizobia from Astragalus, Oxytropis, and Ono-
brychis spp. were grouped independently of their plant
Nodulation in Onobrychis Perennial Legume Plants
Copyright © 2010 SciRes. AJPS
120
origin [4].
Five isolates from sainfoin (Onobrychis viciifolia, tribe
Hedysareae, related to the tribe of Galegeae) were in-
cluded because this legume species was effectively
nodulated by rhizobia isolated from Astragalus and Oxy-
tropis [5]. The nitrogenase activities of five arctic rhizo-
bia isolates were higher at low temperatures than those of
temperate rhizobia when symbiotic with the legume
sainfoin (Onobrychis viciifolia Scop.) [6]. It was also
found that a strain isolated from a cold environment
caused nodulation and formed bacteroids under low tem-
peratures while a strain isolated from a warmer environ-
ment did not [7].
Since Phaseolus vulgaris is a promiscuous host nodu-
lated by at least six species of rhizobia, introduced plants
could also have established symbiosis with rhizobia from
Leucaena, Onobrychis, Dalea, etc. [8], with other words,
nodule bacteria isolated from Onobrychis plants could
display cross-inoculation host specificity towards to the
strange host-plant.
The tasks of the present research included a study of
symbiotic properties of 110 nodule bacteria isolated from
nodules of Onobrychis transcaucasica and Onobrychis
chorasanica, as well as their generic and specific (spe-
cies) belonging, and also the sand immobilization with
help of Onobrychis symbiosis aiming to create artificial
semi-desert pastures and increase their productivity.
2. Materials and Methods
2.1. Isolation and Purification of Nodule Bacteria
from Onobrychis Plants
Nodules with pink and fallow tissue were taken from the
root system of both Onobrychis species. The nodules
were surface-sterilized with 30% H2O2 for 30 s and
washed several times with sterile distilled water [9].
Sterile nodules were crushed gently up to homogenous
state and the nodule contents were streaked on medium
of the following composition (g/L): glucose—5, sucrose
—5, К2НРО4—0.5, КН2РО4—0.5, MgSO4 · 7H2O—0.5,
CaSO4—0.2, pea—50, agar—20, water distilled - up to 1
L, pH 6.8-7.0 (pea was boiled during 1 hour and the me-
dium was prepared on the basis of pea’s broth) [10]. The
bacteriological-pure nodule bacteria were isolated from
single grown colonies.
2.2. Microvegetation and Vegetation
Experiments
For microvegetation experiments Onobrychis seeds were
treated by concentrated sulphuric acid during 4 minutes,
then after their numerous washing by sterile water the
treated seeds were put on sterile wet discs from filter
paper into Petri dishes and were incubated in thermostat
at 30 temperature for 1-2 days before their germination.
The germinated seeds further were introduced into tubes
with volume 60 ml with sterile mixture sand: vermiculite
(3:1), height of which was 8 cm, containing nutritive
medium for plants, into each tube there was added 8 ml
of this medium: MgSO4 ·4H2O—5 mM, K2SO4—10 mM,
CaCl2 · 2H2O—1 mM, phosphate buffer (NaH2PO4 +
Na2HPO4, pH 6.5)—15 mM, Fe-Sequestrene 138 (Fe-
EDDHA)—5mM, microelements—0.05 ml/L of medium.
Microelements (g/L): H3BO3—17.16, MnSO4—7.2,
ZnSO4—1.32, CuSO4—1.65, Na2MoO4—0.12 [11].
In vegetation experiment the plants were grown within
bags of 2 L volume that were filled by sand impregnated
with nutritive medium. After appearance of seedlings of
germinated seeds, they were inoculated with bacterial
suspensions of 3-daily nodule bacteria cultures that were
prepared in the nutritive medium solution in titre 109
cells/ml (on 2 ml of microelements solution per each tube
together with 10 ml of bacterial suspension in the nutria-
tive medium per each bag). In microvegetation experi-
ment the plant seedlings were inoculated by all isolates
that were isolated from nodules of both Onobrychis plant
species. In vegetation experiment the plant seedlings
were inoculated by Onobrychis transcaucasica isolates
(OT102, OT103, OT111, OT114, OT115, OT117,
OT118, OT121, OT122, OT123, OT124, OT130, OT136,
OT139, OT140, OT148, OT151) and Onobrychis
chorassanica isolates (OC104, OC106, OC107, OC109,
OC111, OC112, OC113, OC138). The inoculated Ono-
brychis seedlings were cultivated in sterile conditions
during 45 days. Each variant of inoculation was done in 3
repeats on 2 plants per each repeat (in vegetation ex-
periment - 5 plants/repeat).
2.3. Determination of Nitrogen-Fixing Activity
Nitrogen-fixing activity was estimated by the acetylene-
reductase activity (ARA) assay described by Hardy [12].
The plant samples (with root nodules) were washed with
sterile water and transferred into 60 ml capacity agro-
nomic tubes fitted with airtight rubber stoppers. Acety-
lene (10 volume %) was injected and the tubes were in-
cubated at 30°C for 24 hours. The data was the mean of
three replicates. The samples without acetylene were
used as control. The quantitative estimation of ethylene
gas produced in the samples was measured on a gas
chromatograph (LHM-80). The acetylene-reductase ac-
tivity of the plants was expressed as nmoles C2H 4 /
tube/hour.
2.4. PCR Amplication of the 16S rRNA Gene
The 16S rRNA gene from nodule bacteria of Onobrychis
transcaucasica and Onobrychis chorassanica was ampli-
ed using universal primers 1070f (59-ACGGGCGGTG
Nodulation in Onobrychis Perennial Legume Plants
Copyright © 2010 SciRes. AJPS
121
TGTAC-39) and 1392r (59-CGCCCGCCGCGCCCCGC
GCCCGGCCCGCCGCCCCCGCCCCACGGGCGGTG
TGTAC-39) [13]. Each PCR mixture contained the fol-
lowing: 10 pmol each primer, 200 M dNTPs, 1U Tag
DNA polymerase, 100-200 ng genomic DNA and Taq
polymerase buffer in a nal reaction volume of 50 l.
The DNA thermal cycler used for PCR amplication was
programmed as follows: an initial extensive denaturation
step at 94 for 5 min; 30 cycles of 94 for 1 min, 53
for 1 min and 72 for 1.5 min; and a nal extension step
at 72 for 10 min.
2.5. Phylogenetic Analysis
The complete 300-354-bp 16S rRNA gene sequences
were compared with the sequences available in the Gen-
Bank database using the standard Basic Local Alignment
Search Tool, BLASTn [14], at the National Center for
Biotechnology Information (NCBI) (http://blast.ncbi.nlm.
nih.gov/Blast.cgi). From the aligned sequences, neighbor-
joining dendrograms [15] were constructed with the
software MEGA version 4.0.2 [16]. The robustness of the
inferred trees was evaluated by 1000 bootstrap resam-
plings.
2.6. Field Experiments on Sand Immobilization
The plot for field experiments on sand immobilization
was chosen in area that was represented by clay (sabu-
lous) sand and all area surrounded experimental plot
served as control plot without sowing. A square plot with
the area of 400 m2 was divided into four square subplots
of 100 m2, which in turn were divided into allotments of
10 m length and 0.7 m width. Seeds (3 seeds/hole) were
sown at 0.25 m intervals along the length the edge of
each allotment. Seeds of Onobrychis transcaucasica and
Onobrychis chorassanica were inoculated with 109 cells/ml
suspensions of 3-daily grown cultures of bacterial strains
as described before [10]. Control plots were sown with
non-inoculated seeds.
3. Results
3.1. Isolation of Nodule Bacteria
Onobrychis is related to Fabaceae family, Hedysarea
tribe, Onobrychis genus. Onobrychis chorassanica is a
drought- (xerophyte) and frost-resistant leguminous plant
with multiply (up to 20) straight sprouts with height
0.9-1.2 m [17]. Onobrychis chorassanica is a steppe
plant, which grows in sandy, rubbly, dried zones, on rocky
slopes of mountains and foothills and speckled ores of
Tien Shan, Pamirs-Alai, Kopetdag, Iranian plateau and in
the Northern Afganistan (Figure 1(a)). Onobrychis tran-
scaucasica is widespread among mountain meadow and
steppe areas of Azerbaijan, Georgia and Armenia [18], it
(a)
(b)
Figure 1. The appearance of Onobrychis chorassanica (a)
and Onobrychis transcaucasica (b) plants.
is mezoxerophyte, which was introduced earlier into Uz-
bekistan (Figure 1(b)). For isolation of natural nodule
bacteria the nodules were gathered from the roots of
Onobrychis transcaucasica and Onobrychis choras-
sanica plants, growing up in their natural habitats. There
have been isolated 65 nodule bacteria from Onobrychis
transcaucasica plant nodules and 45 nodule bacteria
from Onobrychis chorassanica nodules and it has been
created a collection of their nodule bacterial isolates.
Microscopic investigations of some bacterial cells of
Nodulation in Onobrychis Perennial Legume Plants
Copyright © 2010 SciRes. AJPS
122
selected strains showed that studied cells were repre-
sented with typical motile rods, their width varied from
0.5 to 0.8 micron and length – from 1.0 to 1.5 micron. It
was marked a polymorphism of cells in dependence on
the cell’s age – in logarithmic phase of growth the cells
were represented with motile cells, whereas in stationary
phase of growth the cells lost their motility. The speed of
growth of nodule bacteria isolated strains depends on
conditions of cultivation and it is one of the most impor-
tant taxonomic signs. During this well-formed colony of
fast-growing bacteria can be obtained by 3-4 days of
growth, but for slowly-growing—by 7-10 days. In media
containing agar-agar the isolates of nodule bacteria
formed colorless, transparent, slimy colonies. Such type
of isolates colonies was relevant to S-forms of bacteria.
3.2. Nodulation Test
The next stage of investigation there was a research of
plant nodulation aiming to select high-efficient bacteria
in microvegetation experiments. As it was shown in Fig-
ure 2, the inoculated plants in sterile conditions during
microvegetation experiment grew and developed well.
Examination of nodulation for Onobrychis transcau-
casica and Onobrychis chorassanica plants on the 45th
day of plant growing up showed that nodulation under
inoculation with Onobrychis transcaucasica isolates (65
isolates) occurred only in 4% from total number of in-
oculated plants and 13% in Onobrychis chorassanica (45
isolates). Onobrychis transcaucasica OT102, OT103,
OT124, OT148 nodule bacteria formed from 1 to 3 nod-
ules per plant with its original host plant (Onobrychis
transcaucasica, direct inoculation). At the same time up
to 4 nodules were formed on Onobrychis chorassanica
plant roots during inoculation with both their OC106,
OC107, OC109 bacteria (direct inoculation) and Ono-
brychis transcaucasica OT104 bacteria (cross inocula-
tion) (Figure 2). From obtained results it may conclude
that so low nodulation in both Onobrychis species un-
doubtedly depended on growing conditions, although in
sterile micro-vegetation experiments the plants grew well,
1 2 3 4 5 6 7 8
(a) (b)
Figure 2. Nodulation of Onobrychis transcaucasica (a) and Onobrychis chorassanica (b) under inoculation with nodule bac-
teria in conditions of sterile microvegetation experiment (45- daily plants): 1 –O Т102; 2 – OT148; 3 – OT124; 4 – OT103; 5
–OC104; 6 –OC106; 7– OC109; 8– OC107.
Nodulation in Onobrychis Perennial Legume Plants
Copyright © 2010 SciRes. AJPS
123
but it was not enough for nodule formation on plant roots.
According to literature data in nature the nodulation in
Onobrychis chorassanica starts by 20-25th day after ap-
pearance of sprouts, one week later than in wild species
of alfalfa [17]. For getting the high nodulation frequency
of Onobrychis plants it was necessary to create more
optimal growing conditions than it was in microvegeta-
tion experiment. In this connection for finding of the
most optimal conditions for nodulation the plants of
Onobrychis transcaucasica (grown in microvegetation
experiment during 45 days) inoculated with OT139 nod-
ule bacteria and Onobrychis chorassanica plants (grown
in microvegetation experiment during 45 days) inocu-
lated by OC140 nodule bacteria were transferred into 2 L
bags with sterile sand as potting material. The further
growing up of 45-daily plants in vegetation experiment
for one month showed that on roots of Onobrychis plants
formed numerous nodules with size 0.3-0.8 cm and dur-
ing this the plants developed much better than in mi-
crovegetation experiment. In this connection the further
experiments on study of nodulation of Onobrychis plants
were carried out in sterile vegetation experiment. As re-
sults showed, the nodulation in both plant species was
observed with different nodule number (Table 1, 2; Fig-
ure 3). The intense nodulation was detected more in
Onobrychis transcaucasica than in Onobrychis choras-
sanica plants. Among all of tested strains for Onobrychis
transcaucasica plants OT102, OT103, OT117, OT121,
OT130, OT136, ОT139 and ОT140 strains were efficient
(Table 1) and for Onobrychis chorassanica plants –
ОС106, ОС107, ОС109, ОС112, ОТ103, ОТ117, ОТ123
strains (Table 2). It should be noted that the biggest effi-
ciency for Onobrychis chorassanica plants was found
under cross inoculation with ОТ123 strain. The acethyl-
ene-reductase activity for Onobrychis transcaucasica
plants varied within range from 28 to 63 nmoles С2Н4/
hour/tube, while for Onobrychis chorassanica – 29-51
nmoles С2Н4/hour/tube. The correlation between nitrogen
fixation and efficiency was observed in symbiosis of
Onobrychis transcaucasica plants with ОТ117 and
ОТ139 nodule bacteria, but in Onobrychis chorassanica
– with ОС109 and ОТ123 The nodule bacteria isolated
from nodules of Onobrychis plants displayed cross
nodulation specificity (the nodulation specificity towards
to non-maternal host plant under cross inoculation of
nonmaternal plant) towards to both plant species.
1 2 3 4 5 6
(a) (b)
Figure 3. Nodulation of 1-monthly Onobrychis transcaucasica (a) and Onobrychis chorassanica (b) plants under inoculation
with nodule bacteria in conditions of sterile vegetation experiments: 1 – OT117; 2 – OT121; 3 – OT123; 4 – OC104; 5 –
OC113; 6 – OC107.
Nodulation in Onobrychis Perennial Legume Plants
Copyright © 2010 SciRes. AJPS
124
Table 1. Nodulation of Onobrychis transcaucasica plants under inoculation with nodule bacteria strains isolated from Ono-
brychis plants.
Inoculation variant Average dry biomass of
1 plant, mg
Average nodule
number per 1 plant
ARA, nmoles
С2Н4 /tube/hour
Efficiency
symbiosis, %
Control 81.5 2.14 - - 100
OТ102(1) 104.0 3.98 2.0 1.0 46.0 11.0 127.6
OТ103 103.0 1.99 2.3 1.5 48.0 4.58 126.3
OТ111 98.8 2.27 1.6 1.15 51.0 10,58 121.2
OT114 89.8 5.57 2.6 0.52 49.0 8.18 110.1
OТ115 74.8 2.41 2.3 0.57 35.0 4.58 91.7
OТ117 111.0 3.97 2.6 1.96 59.0 3.0 136.1
OТ118 88.0 1.52 1.3 0.57 48.0 7.0 107.9
OТ121 101.0 8.08 10.0 2.64 63.0 8.88 123.9
OТ122 87.0 6.38 4.6 1.44 58.0 11.53 106.7
OТ123 93.6 6.86 2.3 0.57 51.0 .56 114.8
OT124 97.5 6.26 2.6 0.69 53.0 6.0 119.6
OТ130 107.0 4.17 2.3 0.51 33.0 14.17 131.2
OТ136 102.2 5.38 3.0 1.0 49.0 4.58 125.3
OT139 103.8 5.62 2.3 1.12 57.0 3.0 127.3
OТ140 99.6 6.69 3.3 0.51 62.0 9.16 122.2
OT148 84.4 4.22 2.0 1.0 45.0 10.8 103.5
OТ151 80.0 3.36 1.6 0.57 28.0 2.48 98.1
OC107(2) 92.6 3.00 2.3 0.57 53.0 5.56 113.6
OC109 79.5 6.47 1.6 1.15 43.0 6.24 97.5
Control 81.5 2.14 - - 100
OТ102(1) 104.0 3.98 2.0 1.0 46.0 11.0 127.6
OТ103 103.0 1.99 2.3 1.5 48.0 4.58 126.3
OТ111 98.8 2.27 1.6 1.15 51.0 10,58 121.2
OT114 89.8 5.57 2.6 0.52 49.0 8.18 110.1
OТ115 74.8 2.41 2.3 0.57 35.0 4.58 91.7
OТ117 111.0 3.97 2.6 1.96 59.0 3.0 136.1
OТ118 88.0 1.52 1.3 0.57 48.0 7.0 107.9
OТ121 101.0 8.08 10.0 2.64 63.0 8.88 123.9
OТ122 87.0 6.38 4.6 1.44 58.0 11.53 106.7
OТ123 93.6 6.86 2.3 0.57 51.0 .56 114.8
OT124 97.5 6.26 2.6 0.69 53.0 6.0 119.6
OТ130 107.0 4.17 2.3 0.51 33.0 14.17 131.2
OТ136 102.2 5.38 3.0 1.0 49.0 4.58 125.3
OT139 103.8 5.62 2.3 1.12 57.0 3.0 127.3
OТ140 99.6 6.69 3.3 0.51 62.0 9.16 122.2
OT148 84.4 4.22 2.0 1.0 45.0 10.8 103.5
OТ151 80.0 3.36 1.6 0.57 28.0 2.48 98.1
OC107(2) 92.6 3.00 2.3 0.57 53.0 5.56 113.6
OC109 79.5 6.47 1.6 1.15 43.0 6.24 97.5
Note: Values are the ±SE, n = 3; ARA – acetylene-reductase activity. OT(1) – nodule bacteria isolated from Onobrychis transcaucasica nodules; OC(2) – nodule
bacteria isolated from Onobrychis chorassanica nodules.
Thus, proceeding from these results one can suppose
that more optimal growing conditions which are close to
natural conditions of their habitats are necessary for
nodulation of Onobrychis transcaucasica and Onobrychis
chorasanica plants, because these plants are wild plants.
3.3. Phylogenetic Analysis of the 16S rRNA Gene
of Nodule Bacteria Strains
Further, the taxonomy of bacterial isolates of nodule
bacteria isolated from nodules of Onobrychis transcau-
casica and Onobrychis chorassanica plants was studied
with help of 16S rRNA gene method. The determination
of nucleotide sequence of 16S rRNA gene of nodule
bacteria of Onobrychis plants enabled to realize an iden-
tification of specific belonging of the bacteria up to ge-
nus, but for some bacteria – up to specie. Results of
comparative BLAST analysis of nucleotide sequence of
conservative region of 16S rRNA gene of ОT102, ОT123,
ОT136, OT140 bacteria from Onobrychis transcaucasica
were identical with genes of Rhizobium sp. EGY2
(AY693662.1) by 99%. It is interesting to note that nu-
cleotide sequences of ОT102, ОТ103, ОT111, ОT115,
ОT117, ОT123, ОT136, ОT139, ОT140 bacteria from
Onobrychis transcaucasica have also 96-98% identity
with genes of Sinorhizobium meliloti CCNWYC140
(EU849576.1), Sinorhizobium meliloti (AB535707.1),
Nodulation in Onobrychis Perennial Legume Plants
Copyright © 2010 SciRes. AJPS
125
Table 2. Nodulation of Onobrychis chorassanica plants under inoculation with nodule bacteria strains isolated from Ono-
brychis plants.
Inoculation variant Average dry biomass of
1 plant, mg
Average nodule
number per 1 plant
ARA, nmoles
С2Н4 /tube/hour
Efficiency
symbiosis, %
Control 75.3 3.30 - - 100
OC104 101.4 8.48 2.6 0.57 42.0 4.58 134
OC106 94.8 5.18 1.6 0.57 47.0 6.08 125
OС107 95.6 2.85 1.6 1.15 43.0 7.0 126.9
OC109 97.1 7.01 2.3 1.15 45.0 3.0 128.9
OC111 80.0 9.64 1.3 0.51 39.0 3.46 106.2
OC112 90.8 3.63 2.6 1.09 41.0 6.0 120.5
OC113 81.4 6.50 1.3 0.57 37.0 6.24 108.1
OC138 78.6 2.89 1.7 0.64 40.0 3.6 104.3
OТ102 77.2 4.38 2.3 1.12 43.0 8.88 102.6
OТ103 96.8 2.11 3.3 1.15 48.0 3.6 128.5
OТ111 92.4 5.93 1.6 0.57 41.0 7.0 122.7
OТ115 72.0 6.38 1.3 0.6 29.0 9.84 95.6
OТ117 91.8 4.83 1.6 0.69 38.0 2.64 121.9
OТ121 75.6 6.61 1.3 1.15 39.0 6.92 100.3
OТ123 99.0 5.76 2.3 1.15 46.0 2.64 131.4
OТ136 97.5 5.80 2.6 1.52 31.0 6.0 129.4
Sinorhizobium fredii CCBAU 10078 (GU552900.1),
Mesorhizobium mediterraneum Zw-2-1 (GU201845.1),
Mesorhizobium obiense Zw-1 (GU201844.1), Bradyr-
hizobium japonicum PRY65 (AF239848.2) bacteria. The
conservative region of 16S rRNA gene of ОT114, ОT124,
ОT148 bacteria coincides by 98-99% with genes of Pan-
toea agglomerans GS2 (GQ374474.1), Enterobacter
cloacae IHB B 1374 (GU186117.1) and Pantoea ag-
glomerans MKPTK-4 bacteria (GQ499274.1) accord-
ingly.
Analogous results were obtained for nodule bacteria
from Onobrychis chorassanica. The analysis of 16S
rRNA gene of Onobrychis chorassanica nodule bacteria
showed that nucleotide sequence of ОС104, ОС107,
ОС109 and ОС111 bacteria by 98- 99% coincides with
genes of Rhizobium sp. EGY2 (AY693662.1). More-
over, 16S rRNA genes of ОС104, ОС107, ОС109 bacte-
ria by 97-99% were homologous with genes of several
bacteria species such as Sinorhizbium meliloti CCNWY
C140 (EU849576.1), Sinorhizobium meliloti YcS2
(AB535707.1), Sinorhizobium fredii CCBAU 10078 (GU
552900.1), Mesorhizobium tianshanense (FM203306.1),
Mesorhizobium amorphae CCNWYC131 (EU849577.1)
and Bradyrhizobium japonicum PRY62 bacteria (AF
239847.2). ОС112 bacterium is identical by 99% with
nucleotide sequences of 16S rRNA gene of Burkholderia
caryophylli WAB1944 (AM184283.1), the genes of
ОС106 coincides by 97% with genes of Pantoea ag-
glomerans HXJ (HM016799.1), genes of ОС138 by 98%
coincides with genes of Enterobacter sp. RF-100 (GQ
205104.1) and genes of ОС113 bacteria by 97% are
identical with genes of Enterobacter sp. B-13M3 (AJ
874743.1).
During analysis of phylogenetic tree of created on the
basis of nucleotide sequence of 16S rRNA gene of dif-
ferent bacteria it was established that studied ОT102,
ОТ103, ОT111, ОT115, ОT117, ОT123, ОT136, ОT139,
ОT140 bacteria from Onobrychis transcaucasica were
related to Alphaproteobacteria class (Figure 4(a)), but
ОT114, ОT124, ОT148 bacteria were related to Gam-
maproteobacteria class (Figure 4(b)). On phylogenetic
tree of Onobrychis chorassanica nodule bacteria unlike to
Onobrychis transcaucasica bacteria formed three clusters.
Bacteria, incoming into the 1st cluster, were Alphaproteo-
bacteria (Figure 5(a)), the 2nd cluster—Betaproteobac-
teria (Figure 5(b)), and bacteria of the 3rd cluster were
related to Gammaproteobacteria class, in particular to
Enterobacter and Panoea genera (Figure 5(c)).
3.4. Immobilization of Sand with Onobrychis
Plants
The seeds of both Onobrychis transcaucasica and Ono-
brychis chorassanica plants were sowed into sabulous
sand of experimental desert trial plot; there was an aver-
age 17 % of sand humidity at the plot under 3 additional
irrigation treatments within 5-6 months. The sprouts
emerged already by 2nd-3rd day after seed sowing and
they developed up to stage with real (non-embryonal)
leaves already by 6-8th day. During the further 5-6
months the plants grew and gave a good yield of green
biomass (2 hay cuttings were for the mentioned period)
and within this time they formed compact “green belt” of
Nodulation in Onobrychis Perennial Legume Plants
Copyright © 2010 SciRes. AJPS
126
Figure 4. Phylogenetic tree based on the 16S rRNA gene strains of nodule bacteria Onobrychis transcaucasica: (a) Alphapro-
teobacteria; (b) Gammproteobacteria. The branching pattern was produced by the neighbour-joining method. The GenBank
accession numbers for the sequences used are indicated in parentheses. Symbionts of Onobrychis transcaucasica are shown in
bold type.
Figure 5. Phylogenetic tree based on the 16S rRNA gene strains of nodule bacteria Onobrychis chorassanica: (a) Alphapro-
teobacteria; (b) Betaproteobacteria; c- Gammproteobacteria. The branching pattern was produced by the neighbour-joining
method. The GenBank accession numbers for the sequences used are indicated in parentheses. Symbionts of Onobrychis
chorassanica are shown in bold type.
Nodulation in Onobrychis Perennial Legume Plants
Copyright © 2010 SciRes. AJPS
127
75-100 cm (Figure 1), the plants blossomed and pro-
duced seeds thereby providing a renewal of the “green
belt”. The dry biomass of Onobrychis transcaucasica
plants reached 323-428 g/m2, while biomass of Ono-
brychis chorassanica plants was 390-714 g/m2 in de-
pendence on inoculation with different nodule bacteria
strains (Table 3). Considerable increase of Onobrychis
transcaucasica biomass was observed at inoculation of
plants with OT121, OT123, OT136 strains. Under cross-
and direct inoculation of Onobrychis chorassanica plants
with OC107, OT118, OT121 strains the highest biomass
of plants in comparison with control plants biomass was
recorded. It should be noted that under inoculation of
plants the numerous nodules on plant roots of both Ono-
brychis transcaucasica (nodule number on each plant
exceeded 500 units per 1 plant) and Onobrychis
сhorassanica (more 200 nodules / plant) were detected
(Table 3, Figure 6). During development of root system
the plants immobilized significant amount of sand, where
Onobrychis transcaucasica plants had a fibrous (ra-
cemose) root system (Figure 6). The measurements of
sand accumulation near the foot of the plants showed that
if on the edges of the experimental plot there was a layer
of sand with 5 cm height, then within internal zone of the
plot (in furrows, between rows) the sand layer of 2-3 cm
height was detected. By the 2nd year of plants vegetation
the sustainable growth of Onobrychis plants was re-
corded (Figure 7), where together with adult (mature)
plants it was possible to observe an appearance of plenty
young sprouts of fallen seeds (seedfall).
Table 3. Sand immobilization with Onobrychis plants (field experiments during 5 months at the Kyzil-Kum Desert Biostas-
tion).
Onobrychis transcaucasica Onobrychis chorassanica
Inoculation
variant Average dry shoot
plant biomass, g/m2
Average height of sand
layer at foot of plants, cm
Average dry shoot
plant biomass, g/m2
Average height of sand
layer at foot of plants, cm
Control 329 22.0 350 39.0
OT102 347 34.0 552 30.99
OT103 361 22.0 409 8.0
OT115 323 19.0 504 51.0
OT117 342 24.0 457 20.41
OT118 400 20.99 695 22.99
OT121 423 40.0 698 33.0
OT123 428 27.0 390 25.0
OT136 428 28.9 433 11.99
OC104 419 2.0 480 13.0
OC107 380 34.99 714 14.99
OC109 390 25.99 438 36.0
OC111 340 25.0
2-3
498 20.99
2-3
Note: Values are the means ± SE, n=2; nodule number on each plant exceeded 500 units per 1 plant Onobrychis transcaucasica
(Onobrychis chorassanica – more 200 nodules / plant), their size varied within range for Onobrychis transcaucasica 0.3 – 1.7 cm
in diameter (0.3 – 2.2 cm for Onobrychis chorassanica plants). Height of Onobrychis plants varied within range 75-100 cm and
length of roots – 45–65 cm.
(a) (b)
Figure 6. The root system of Onobrychis transcaucasica (a) and Onobrychis chorasanica (b).
Nodulation in Onobrychis Perennial Legume Plants
Copyright © 2010 SciRes. AJPS
128
Figure 7. The 2nd year, early spring, of vegetation of Onobrychis transcaucasica plants at experimental trial plot (model
pasture) at Kyzyl-Kum Desert Biostation (Scientific Center of Plant Production “Botanika”, Uzbekistan Academy of Sci-
ences).
Thus, with help of Onobrychis plants it is possible to
conduct an efficient sand immobilization in a way of
their growing on blown sand on condition of necessary
irrigation and create artificial pastures in semi-desert
conditions in order to increase a productivity of natural
pastures. But for this it is necessary to support moisture
of sabulous soil (sandy clay) no less than 17% for active
vegetation (maximal average moisture of desert sand
observed in spring season), blossoming and obtaining of
real crop yield of Onobrychis plants in conditions of de-
serted soils.
4. Discussion
Some works devoted to nodulation of leguminous plants
with bacteria related to Bettaproteobacteia and Gam-
maproteobacteria classes are published lately [19-22].
First L. Moulin with other authors established that bacte-
ria of Burkholderia genus [20] formed normal nodules on
plant roots. Then other researchers found that isolates of
root nodule bacteria from two Mimosa species at three
sites in Costa Rica belonged to the genera Burkholderia,
Cupriavidus, and Rhizobium. Inoculation tests further
indicated that both Cupriavidus and Burkholderia spp.
resulted in signicantly higher plant growth and nodule
nitrogenase activity relative to plant performance with
strains of Rhizobium [21]. Under identification of bacte-
ria isolated from nodules of Prosopis juliflora it was
shown that in addition to traditional nodule bacteria the
bacteria which had 100% of homology with Achromo-
bakter xylosoxidans were found [22]. The repeated in-
oculation of Prosopis juliflora plants with these bacteria
led to formation of nitrogen-fixing nodules on plant roots.
In the bacteria it was determined an availability of nodC
gene that is responsible for nodule formation in legume
plants. In other works from the root nodules of the three
Mediterranean wild legume species Hedysarum carno-
sum, Hedysarum spinosissimum subsp. capitatum and
Hedysarum pallidum there were isolated bacteria which
belonged to the class Gammaproteobacteria and included
Pantoea agglomerans, Enterobacter kobei, Enterobacter
cloacae, Leclercia adecarboxylata, Escherichia vulneris,
and Pseudomonas sp [23].
In our research devoted to Onobrychis plant nodula-
tion we also had heterogeneity of bacteria isolated from
nodules. Determination of generic and specific composi-
tion of bacterial isolates from nodules of Onobrychis
transcaucasica and Onobrychis chorassanica plants
showed that 16S rRNA genes of bacteria were highly
identical as to Alphaproteobacteria, well as to Betta- and
Gammaproteobacteria. The studied OT102, OT103,
Nodulation in Onobrychis Perennial Legume Plants
Copyright © 2010 SciRes. AJPS
129
OT111, OT115, OT117, OT121, OT123, OT136, OT139,
OT140 bacteria from Onobrychis transcaucasica were
related to Rhizobium genus (Alphaproteobacteria /
Rhizobiales / Rhizobiaceae / Rhizobium), while OT114,
OT148 bacteria were related to Patnoea genus and
OT124 strain—to Enterobacter genus (Gammaproteo-
bacteria / Enterobacteriales / Enterobacteriaceae / En-
terobacter, Pantoea). Bacteria from Onobrychis choras-
sanica unlike to bacteria from Onobrychis transcau-
casica on their 16S rRNA genes were related to three
classes of bacteria—Alphaproteobacteria, Betaproteo-
bacteria, Gammaproteobacteria. OC104, OC107, OC109,
OC111 bacteria were related to Rhizobium genus, OC112
bacterium—to Burkholderia genus (Betaproteobacteria,
Burkholderiales, Burkholderiaceae, Burkholderia) and
OC106, OC118 and OC138 bacteria were related to En-
terobacter genus. If to consider the origin of nodule bac-
teria from both Onobrychis plant species, then it is possi-
ble to notice that the most of studied bacteria are very
close neighbours incoming into the same genus of bacte-
ria. But as a whole the nodule bacteria from Onobrychis
plants comprise a wide scope on phylogenetic tree.
Under studying of nodulation of Onobrychis plants it
has been established that in microvegetation experiment
the shoot part of plants was by 2 times longer than root
part and very low nodulation was observed. In vegetation
experiment the plant roots developed well and the root
length was by 3 times longer than the length of shoot part
of plants and practically in all variants the nodules were
formed. Proceeding from these results one can suppose
that intense growth and root development are one of the
main criteria that determines the nodulation in both
Onobrychis transcaucasica and Onobrychis chorassa-
nica plants. The nodule bacteria independently on their
belonging to one or another bacterial genus formed full
nitrogen-fixing nodules on Onobrychis plants. It should
be noted that OT103, OT111 and OT117 strains dis-
played a high efficiency in both Onobrychis transcau-
casica host plant and Onobrychis chorasanica plant too.
As our field experiments showed, growing up of inocu-
lated Onobrychis transcaucasica and Onobrychis chor-
sasanica plants in sabulous sandy soils in the Kyzil-Kum
Desert showed a possibility of sand immobilization with
its further stabilization. In addition to stabilization of
blown sand it is possible to increase a productivity of
semi-deserted by means of creation of artificial renew-
able pastures—if in natural conditions the productivity of
desert pasture comprises usually 100-300 kg/ha (24),
then on condition of minimal additional irrigation of
Onobrychis transcaucasica and Onobrychis choras-
sanica symbiosis in sabulous soils it is possible to in-
crease this productivity up to 30-70 c/ha.
Thus, Onobrychis nitrogen-fixing symbiosis can be
used for both increase of biological fertility (restoration)
of poorer deserted soils which would promote the desert
flora diversity and immobilization of sandy soils with
aim to increase of productivity of deserted and semi-
deserted pastures under minimal irrigation measures.
5. Acknowledgements
Authors express a deep gratitude to Dr. M. Ines M.
Soares and Prof. Herman Lips (Institute for Desert Re-
search Ben-Gurion University of the Negev Sede Boqer,
Israel), Dr. Jhonathan E. Ephrath (Wyler Dept. for Dry-
land Agriculture, Jacob Blaustein Institute for Desert
Research, Ben-Gurion University of the Negev, Sede
Boqer, Israel) for help and consultations in carrying out
of microbiological, molecular-genetic and field experi-
ments. These investigations were carried out owing to
grant support of USAID/CDR/CAR Program.
REFERENCES
[1] M. D. Rumbaugh, “Special Purpose Forage Legumes,” In:
J. Janick and J. E. Simon, Ed., Advances in New Crops.
Timber Press, Portland, OR, 1990, pp. 183-190.
[2] H. Blasum, “Wild legumes, vetch inoculation, and rhizo-
bial taxonomy in Xiaman farm, eastern edge of the Qing-
hai-Tibet plateau”, MS Thesis. http://www.blasum.net/
holger/wri/alpleg/index.html
[3] D. Prévost, P. Drouin, S. Laberge, A. Bertrand, J. Cloutier
and G. Lévesque, “Cold-Adapted Rhizobia for Nitrogen
Fixation in Temperate Regions,” Canadian Journal of
Botany, Vol. 81, 2003, pp. 1153-1161.
[4] G. Laguerre, P. Van Berkum, N. Amarger and D. Prevost,
“Genetic Diversity of Rhizobial Sym-bionts Isolated from
Legume Species within the Genera Astragalus, Oxytropis
and Onobrychis,” Applied Environmental Microbiology,
Vol. 63, December 1997, pp. 4748-4758.
[5] D. Prevost, L. M. Bordeleau and H. Antoun, “Symbiotic
Effectiveness of Indigenous Arctic Rhizobia on a Tem-
perate Forage Legume: Sainfoin (Onobrychis viciifolia),”
Plant and Soil, Vol. 104, No. 1, March 1987, pp. 63-69.
[6] D. Prévost, H. Antoun and L. M. Bordeleau, “Effects of
Low Temperature on Nitrogenase Activity in Sainfoin
(Onobrychis viciifolia) Nodulated by Arctic Rhizobia,”
FEMS Microbiology Ecology, Vol. 45, 1987, pp. 205-
210.
[7] R. J. Roughley, “The Influence of Root Temperature,
Rhizobium Strain and Host Selection on the Structure and
Nitrogen-Fixing Efficiency of the Root Nodules of Tri-
folium subterraneum,” Annals of Botany, Vol. 34, 1970,
pp. 631-664.
[8] P. H. Graham, “Co-evolution of Phaseolus Vulgaris and
Its Rhizobia,” University of Minnesota, Department of
Soil, Water, and Climate, College of Agricultural, Food,
and Environmental Sciences, Rhizobia Research Labora-
tory.
[9] Z. Zhao, S. E. Williams and G. E. Schuman, “Renodula-
Nodulation in Onobrychis Perennial Legume Plants
Copyright © 2010 SciRes. AJPS
130
tion and Characterization of Rhizobium Isolates from Ci-
cer Milkvetch (Astragalus cicer L.),” Biology and Fertil-
ity of Soils, Vol. 25, No. 2, August 1997, pp. 169-174.
[10] A. U. Khotyanovich, “Methods for Cultivation of Nitro-
gen-Fixing Bacteria, Ways of Both Their Obtaining And
Preparing of Preparations on Their Base (Methodical
Guides),” All-Union Institute of Agricultural Microbiol-
ogy, Leningrad, 1991, pp. 33-60.
[11] D. R. Hoagland, D. J. Arnon, “The Water Culture Method
for Growing Plants without Soil,” California Agricultural
Experimental Station, Vol. 347, 1938, pp. 1-32.
[12] D. W. Hardy, R. Halstein, E. Jakson and R. S. Buens,
“C2H2–C2H4 Assay to N2 Fixation Laboratory and Field
Evaluation,” Plant Physiology, Vol. 43, 1968, pp. 9-13.
[13] M. J. Ferris, G. Muyzer and D. M. Ward, “Denaturing
Gradient Gel Electrophoresis Profiles of 16S
rRNA-Defined Populations Inhabiting a Hot Spring Mi-
crobial Mat Community,” Applied Environmental Micro-
biology, Vol. 62, February 1996, pp. 340-346.
[14] S. F. Altschul, T. L. Madden, A. A. Schaffer, J. Zhang, Z.
Zhang, W. Miller and D. J. Lipman “Gapped: BLAST
and PSI-BLAST: A New Generation of Protein Database
Search Programs,” Nucleic Acids Research, Vol. 25, Sep-
tember 1997, pp. 3389-3402.
[15] N. Saitou and M. Nei, “The Neighbour-Joining Method: a
New Method for Reconstructing Phylogenetic Trees,”
Molecular Biology Evolution, Vol. 4, July 1987, pp.
406-425.
[16] K. Tamura, J. Dudley, M. Nei, S. Kumar, “MEGA4: Mo-
lecular Evolutionary Genetics Analysis (MEGA) software
version 4.0”, Molecular Biology and Evolution, Vol. 24,
2007, pp. 1596-1599.
[17] O. Kh. Khasanov, S. F. Tadjiev, L. Shamsuvalieva, V. I.
Konycheva and T. Rakhimova, “Onobrychis Chorasanica
Bge.—esparcette chorasanskii,” In: D. K. Saidov, Ed.,
Adaptation of Forage Plants to Conditions of Arid Zone
of Uzbekistan, “Fan” of Uzbek SSR, Tashkent, 1983, pp.
236-245.
[18] A. G. Borisova, “New Species of Onobrychis for Cultiva-
tion,” USSR Academy of Sciences Press, 1952.
[19] H. Zahran, “Rhizobia from Wild Legumes: Diversity,
Taxonomy, Ecology, Nitrogen Fixation and Biotechnol-
ogy,” Journal of Biotechnology, Vol. 91, No. 2-3, Octo-
ber 2001, pp. 143-153.
[20] L. Moulin, A. Munive, B. Dreyfus and C. Boivin-Masson,
“Nodulation of legumes by members of the beta-subclass
of Proteobacteria”, Nature, Vol. 411, June 2001 pp.
948-950.
[21] C.F. Barrett, M. A. Parker, “Coexistence of Burkholderia,
Cupriavidus, and Rhizobium sp. Nodule Bacteria on Two
Mimosa spp. in Costa Rica,” Applied and Environmental
Microbiology, Vol. 72, No. 2, February 2006, p.
1198-1206.
[22] B. Hanane, M. Ourarhi, N. Boukhatem, A. Berrichi, A.
Hanaa, M. Rosella, S. Andrea and M. M. El Idrissi,
“Diver- sity of Bacteria that Nodulate Prosopis juliflora
in the Eastern Area of Morocco,” Systematic and applied
micro- biology, 2008, Vol. 31, No. 5, pp. 378-386.
[23] Y. Benhizia, H. Benhizia, A. Benguedouar, R. Muresu, A.
Giacomini and A. Squartini, “Gamma Proteobacteria
Can Nodulate Legumes of the Genus Hedysarum”, Sys-
tematic and Applied Microbiology, Vol. 27, No. 4, 2004,
pp. 462-468.
[24] D. K. Saidov, “Ecological-Biological Fundamentals for
Creation of Artificial Pastures and Haymakings on Adyrs
of the Ferghana Valley,” Tashkent, “Fan”, 1977.