American Journal of Plant Sciences, 2010, 1, 95-1 03
doi:10.4236/ajps.2010.12012 Published Online December 2010 (http://www.SciRP.org/journal/ajps)
Copyright © 2010 SciRes. AJPS
95
Genetic Diversity within Wild Potato Species
(Solanum spp.) Revealed by AFLP and SCAR
Markers
Angelina Nunziata1, Valentino Ruggieri1, Nicola Greco2, Luigi Frusciante1, Amalia Barone1*
1Department of Soil, Plant, Environmental and Animal Production Sciences, University of Naples ‘‘Federico II’’, Via Università 100,
Portici, Italy; 2Institute for Plant Protection, Section of Bari, National Research Council, Via G. Amendola, Bari, Italy.
Received July 24th, 2010; revised September 27th, 2010; accepted November 8th, 2010.
ABSTRACT
Exploitation of variab ility displayed by wild Solanum species for b reeding the cu ltivated potato (S. tub erosum) requires
phenotypic and genotypic characterization of germplasm resources. In the present work, a collection of 15 wild So-
lanum species was investigated for resistance to pathotype Ro2 of the nematode Globodera rostochiensis. Most of the
genotypes reduced reproduction of the nematode, compared to the control variety Spunta, a highly resistant genotype
being an accession of S. tuberosum spp. andigena. The genetic variability of the Gro1 gene cluster, which confers re-
sistance to some pathotypes of G. rostochiensis, was then studied in the Solanum species used in this study. For this
purpose, SCAR markers for eight paralogues of Gro1 gene were developed. No species showed the same pattern of the
resistant control genotype. Moreover, wide-genome variability was also assessed by using AFLP markers, which al-
lowed species-specific ma rkers to be identified for each geno type analyzed
Keywords: Potato, Nematode Resistance, Globodera Rostochiensis, Gro1 Gene Cluster-SCAR Markers, AFLP Markers
1. Introduction
The genus Solanum contains more than 2000 species,
distributed in very different habitats. Among these, more
than 200 tuber-bearing species exist that could be par-
ticularly important for improving the cultivated potato,
Solanum tuberosum L. Indeed, wild species are known to
be important sources of plant pathogen resistance genes,
as well as of many other interesting traits [1]. This has
been underlined in subsection Potatoe of the Solanum
genus, which includes several tuber-bearing wild species
already used to improve the cultivated potato [2], par-
ticularly for resistance against the variety of pathogens
that negativ ely affect potato productio n [3]. Moreo ver, in
the last years, potato breeding deeply increased its effi-
ciency by the aid of molecular markers [4,5]. Indeed,
molecular fingerprinting of various potato wild species
[6,7] and assisted-selection (MAS) [8] allow a better ge-
netic resources managment and a more efficient gene
transfer among Solanum species.
Among pathogens that affect potato production, the
cyst nematodes Globodera rostochiensis and G. pallida
cause severe damage to the cultivated potato and are
found worldwide [9]. Resistance to G. rostochiensis has
already been introgressed into S. tuberosum from some
Solanum wild species, such as S. andigena, S. vernei and
S. spegazzinii [10,11], and has been associated with sin-
gle genes and quantitative trait lo ci (QTLs). As an exam-
ple, the locus H1 was introgressed from S. andigena and
mapped on a distal position of chromosome V; it confers
resistance to G. rostochiensis pathotypes Ro1 and Ro4
[12]. Another important source of broad spectrum resis-
tance to potato cyst nematodes has been mapped on
chromosome V (locus Grp1): it is a QTL and confers
high resistance levels to G. rostochiensis pathotype Ro5
and to several populations of Globodera pallida [13].
This resistance was found in an interspecific hybrid re-
sulting from a complex breeding scheme involving S.
tuberosum, S. vernei, S. vernei ssp. ballsii, S. olocense
and S. tuberosum ssp. andigena.
Finally, a source of resistance to G. rostochiensis
pathotypes Ro1 and Ro5 derives from S. spegazzinii: it is
due to the gene Gro1 that was mapped on chromosome
VII [14] and was then sequenced and characterized by
means of positional cloning [15]. In particular, it was
evidenced that the resistance gene, named Gro1-4, is part
Genetic diversity within Wild Potato Species (Solanum spp.) Revealed by AFLP and SCAR Markers
Copyright © 2010 SciRes. AJPS
96
of a complex cluster of paralogue genes, some of which
seem to be true genes, and others pseudogenes. Therefore
some of these paralogues could also confer resistance to
other pathotypes of G. rostochiensis or to different
pathogens, as already reported for the resistance gene
Mi-1 in tomato [16]. This could be particularly interest-
ing for finding sources of resistance to pathotype Ro2 of
G. rostochiensis, which causes severe damage to culti-
vated potato in Italy.
Therefore our aim was to investigate a collection of
Solanum wild species for: a) their response to G. rosto-
chiensis pathotype Ro2, b) their genetic variability at a
genome-wide level by AFLP markers, and c) their vari-
ability at the Gro1 gene cluster through the design of
SCAR markers specific for different paralogues.
2. Materials and Methods
2.1. Plant Material
One accession from 15 Solanum wild species (listed in
Table 1) was screened. Plant material was provided as
true seed by the IR-1 Potato Introduction Project, Stur-
geon Bay, WI. In addition to this material, a cultivar of S.
tuberosum (cv. ‘Spunta’ ) and a diplo id S. spegazzinii × S.
tuberosum hybrid (P 40) were studied. The latter was
kindly provided by Dr. Gebhardt (Max-Planck-Institut
Koln, Germany) and is the resistant genotype used for
RFLP mapping of locus Gro1 and for Gro1-4 cloning
and sequencing [14,15].
Table 1. Accessions of Solanum wild species analyzed with
their geographical origin: Plant Introduction number is
indicated as well as the code used in the present work.
Species Plant introduction
number (P.I.) Code Geographical
Origin
S. acaule 210029 ACL 1 Bolivia
S. boliviense 310974 BLV 1 Bolivia
S. bulbocastanum 243510 BLB 3 Mexico
S. canasense 265863 CAN 1 Peru
S. cardiophyllum 347759 CPH 2 Mexico
S. chacoense 133124 CHC 1 Uruguay
S. demissum 205625 DMS 1 Mexico
S. fendleri 458417 FEN 2 USA
S. hougasii 161726 HOU 1 Mexico
S. jamesii 275263 JAM 1 USA
S. multidissectum 8MLT-MI MLT 1 Peru
S. phureja IVP 35 IVP 35 Colombia
S. stoloniferum 275248 STO 1 Mexico
S. tarijense 265577 TAR 1 Bolivia
S. tuberosum ssp.
andigena 205624 TBR1 Bolivia
Seeds for each accession were sterilized in 20% bleach
for 10 min and were germinated in vitro on MS medium
[17] in a growth chamber (24 and 16 h of light/day).
All studied genotypes were maintained as micropropa-
gated plants on MS medium with 1% sucrose and 0.8%
agar, and incubated at 4000 lux, 16 h light, and 24. To
produce plant material for this study, four week-old
plants were transferred to styrofoam trays filled with
sterile soil and acclimated in a growth chamber at 20.
After two weeks, they were transferred to 5-cm-diameter
plastic pots and grown in a temperature-controlled
greenhouse (20–24).
2.2. Response to Globodera Rostochiensis
The 15 Solanum genotypes were tested for their response
to pathotype Ro2 of Globodera rostochiensis. The symp-
toms revealed were compared with those of the suscepti-
ble cv. ‘Spunta’, used as control. The nematode popula-
tion was reared on potato cv. Spunta in pots containing
2.8 dm3 of sandy soil (89% sand) in a greenhouse at 20 ±
2. To estimate the nematode populatio n densities, three
200-g soil samples were processed with a Fenwick can.
The cysts were separated from soil debris by means of
flotation in alcohol [18], and then counted, crushed ac-
cording to Bijloo’s modified method [19] and their egg
content determined. Five plants per genotype were trans-
planted into 5-cm diameter plastic pots containing organic
potting soil and adapted to standard greenhouse condi-
tions. Thirty days later, these plantlets were transplanted
into 14-cm diameter clay pots containing 1000 cm3 of
steam-sterilized sandy soil (89% sand) infested with the
nematode. At planting, the nematode population density
was 20 eggs/g soil of pathotype Ro2. Pots were main-
tained in a greenhouse at 20 ± 2. Two months later, the
plants were cut at ground level and the soil left to dry.
Then the soil of each pot was mixed and a 200-g sub-
sample processed as mentioned above to estimate the
nematode population density. Reproduction rate was
computed by measuring the eggs/g soil found at the end
of the test against the eggs/g soil at the inoculum. All
data were subjected to ANOVA in order to verify that
response to the nematode was genotype dependent and
after they were analyzed by Duncan’s multiple range test
[20].
2.3. AFLP Analysis
AFLP analysis was performed on plant material using the
method described by Vos et al. [21] and the commer-
cially available AFLP ki t and protocol (Gi bco-BRL AFLP
analysis System I, Life Technologies, Gaithersburg, MD),
which employs EcoRI and MseI as restriction enzymes.
For selective amplification, five co mbinations of primers
were used (EcoRI-ACT + MseI-CTC; EcoRI-ACC +
Genetic diversity within Wild Potato Species (Solanum spp.) Revealed by AFLP and SCAR Markers
Copyright © 2010 SciRes. AJPS
97
MseI-CAA; EcoRI-ACC + MseI-CAT; EcoRI-ACC +
MseI-CTA; EcoRI-AAC + MseI-CAG) with the EcoRI
primer in each pair being labelled with FAM fluoro-
chrome. AFLP fragments were separated by capillary
electrophoresis on ABI Prism 3100 Avant Sequence
Analyser (Applied Biosystems). AFLPs electrophero-
grams were read and compared using Gene Mapper V3.7
software (Applied Biosystems). A panel was created for
each primer combination and polymorphisms were scored
as 1 (presence of fragment) or 0 (absence of fragment).
2.4. SCAR Analysis
For SCAR analysis, specific primers for each paralogue
of the Gro1 cluster (Gro1-2, Gro1-3, Gro1-4, Gro1-5,
Gro1-6, Gro1-8, Gro1-11, Gro1-14) from P40 resistance
allele [15] were designed using sequences available in
GenBank (accession numbers AY196151-AY196158).
For this purpose, sequences specific to each paralogue
were identified by means of multiple-sequence alignment
tools (CLUSTAL-W) [22] and pairwise alignment (Local
BLAST-N) [23]. On these paralogue-specific sequences,
primer pairs were constructed using E-Primer3 Software
(http://emboss.sourceforge.net/) or manually. Primer speci-
ficity was verified by Local BLAST-N. Gro1-4 specific
primers from Gebhardt et al. [5] were also used and are
named 4RNA2.
PCR was performed in a total volume of 25 µl con-
taining 0.2 mM dNTPs, 2 mM MgCl2, 0.4 M of each
primer and 1.25 U Taq DNA polymerase in the reaction
buffer provided by the manufacturer (Invitrogen, Carls-
bad, CA, USA). PCR conditions were as follows: 3 min
at 94 followed by 35 cycles of 45 s at 92, 45 s at the
primer pair specific annealing temperature, 1 min at 72
and finally 10 min at 72. Amplification patterns were
compared and polymorphisms were scored as 1 (presence
of fragment of expected size) or 0 (absence of expected
fragment).
2.5. Cluster Analysis
Similarity between clones was calculated both on AFLP
analysis and SCAR analysis data using the Jaccard coef-
ficient: J = a /(a + b + c), where a = number of bands
present in x and y, b = number of bands present in x and
absent in y, c = number of bands present in y and absent
in x. The genetic similarities were graphically repre-
sented by an un rooted dendrogram constructed using the
UPGMA clustering algorithm (Unweighted Pair Group
Method). Genetic similarity calculatio ns and dendrogram
construction were performed using an NTSYS-pc pack-
age [24]. Bootstrap analysis were then performed using
WinBoot Software with a bootsrapping value of 1000
[25].
3. Results
3.1. Response to Globodera Rostochiensis
ANOVA carried on the results of the resistance test gave
significant F values for all considered parameters in tests
with 15 and 84 degrees of freedom (p < 0.01). In par-
ticular F was 10.4 for eggs/g soil, 4.09 for eggs per cyst
and 10.43 for the reproduction rate.
As shown by Duncan test results, in general, the
nematode pathotype Ro2 reproduced significantly less on
the accessions of the wild Solanum species than on the
susceptible control cv. Spunta (Table 2). The number of
eggs/g soil of pathotype Ro2 on the wild clones varied
from 1/6 (group A, abc) to about 1/2 (group B, d) of that
on cv. Spunta (63.9; group C, e). The only exception was
clone MLT1 for which this value (67.9; group C, e) was
similar to that of the susceptible control. Differences
were also observed in the number of eggs per cyst and in
the reproduction rate of the nematode. There were sig-
nificantly fewer eggs per cysts than in the control for
clones BLB3, CAN1, JAM1 and TBR1. For clones
ACL1, BLB3, JAM1, STO1 and TBR1, the reproduction
rates of patho type Ro2 were < 1.
Table 2. Accessions of Solanum wild species analyzed with
their geographical origin: Plant Introduction number is
indicated as well as the code used in the present work.
Pathotype Ro2
Clone Eggs/g soil
(no.) Eggs/cyst
(no.) Reproduction
rate
ACL118.9 abc A B 129 bcde BC 0.9 abc A B
BLV1 21.1 abcd AB 145 cdef BCD 1.1 abcd AB
BLB3 1 8.5 abc AB 114 b AB 0.9 abc AB
CAN122.2 abcd AB 120 bc ABC 1.1 abcd A B
CPH2 25 .2 abcd AB 152 def BCD 1.3 abcd AB
CHC132.3 cd B 131 bcde BC 1.6 cd B
DMS121. 0 abc d AB 126 bcd BC 1.0 abcd AB
FEN2 2 6.0 bcd AB 152 bcde BCD 1.3 bcd AB
HOU133.0 d B 160 ef CD 1.6 d B
JAM118.3 abc AB 120 bc ABC 0.9 ab AB
MLT167.9 e C 174 f D 3.4 e C
IVP3524.2 abcd AB 134 bcde BCD 1.2 abcd A B
STO1 17.6 ab AB 131 bcde BC 0.9 abc A B
TAR1 19.3 abcd AB 126 bcd BC 1.0 abcd AB
TBR1 11.5 a AB 80 a A 0.6 a A
Spunta63.9 e C 154 def BCD 3.1 e C
Genetic diversity within Wild Potato Species (Solanum spp.) Revealed by AFLP and SCAR Markers
Copyright © 2010 SciRes. AJPS
98
3.2. AFLP Analysis
Using five primer pairs an average of 317 fragments per
genotype were scored for a total of 1084 bins. The num-
ber of fragments scored for each genotype ranged from
148 for S. cardiophyllum to 470 for Spunta. The average
number of selected bins per primer combination was 216,
and ranged from 144 (EcoRI-ACC/MseI-CAT) to 350
(EcoRI-ACT/MseI-CTC) (data not shown). Most of the
bins selected from each primer pair were polymorphic
across the tested species (98.15%); only 20 were present
in all the tested species. Among the polymorphic frag-
ments, 88 were species-specific: the number of the spe-
cies-specific fragments varied from 1 (for S. tuberosum
subsp andigena and S. fendleerii) to 24 for S. tarijense.
The most informative primer combinations identified
from 26 to 33 species-specific fragments and allowed
from 9 to 14 species to be discriminated (Table 3).
Dendrogram analysis grouped the tested genotypes
into one main group (bootstrap values of 58%), with the
species S. tarijense, S. acaule S. bulbocastanum, S. jame-
sii, S. canasense and S . cardiophyllum standing outside
this cluster (Figure 1). The main group can be divided
into two secondar y branch es, with a similarity coefficient
between 28% and 39%. The similarity coefficient among
species is never higher than 62% except for the two spe-
cies S. fendleerii and S. tuberosum subs. andigena which
group together with a similarity of about 79%.
3.3. SCAR Analysis
Each region of the Gro1-4 gene was compared to other
Gro1 paralogue sequences available in GenBank by
means of Local Blast. This analysis allowed the length of
specific regions for each paralogue to be identified, as
reported in Table 4 . The regions which differed in length
from the others were examined as paralogue-specific
candidates, such as the region I intron for paralogue
Gro1-5.
Where no evident difference in length was detectable,
polymorphic sites (SNP or INDEL) were identified by
CLUSTAL-W, as was the case of region III intron of
paralogue Gro1-3 where various SNPs were found. This
analysis allowed at least one paralogue specific region to
be identified for each of the eight genes deriving from
the S. spegazzinii Gro1 resistant allele. Where possible,
coding regions were chosen for subsequent analysis. On
each of these paralogue-specific regions a primer pair
was designed with no annealing on different regions of
Gro1 seque nces.
The primers used for SCAR analysis are listed in Ta-
ble 5 and showed in Figure 2, including the primers for
paralogue Gro1-4 from Gebhardt et al. [5].
Table 3. AFLP analysis: for each primer combination the
number of species-specific fragments and of discriminated
species are reported.
Primer combination Species-specific
fragment
(no.)
Discriminated
species
(no.)
EcoRI-ACT/MseI-CTC26 9
EcoRI-ACC/MseI-CAA28 14
EcoRI-ACC/MseI-CAT0 -
EcoRI-ACC/MseI-CTA1 1
EcoRI-AAC/MseI-CAG33 12
Figure 1. Unrooted dendogram built on the basis of UP-
GMA clustering of AFLP markers. The similarity on the
x-axis is based on Jaccard’s coefficient. Bootstrap values
are reported at each cluster node.
Genetic diversity within Wild Potato Species (Solanum spp.) Revealed by AFLP and SCAR Markers
Copyright © 2010 SciRes. AJPS
99
Table 4. Estimated length for each region of Gro1 paralogue sequences available in GenBank.
Region length (bp) Spliced RNA
length Unspliced RNA
length
Accession N°
(Gene) 5' UTR TIR I intron NBSII intronLRRIII intronIV exon3' UTR
AY 196151 (Gro 1-4) 93 496 5465 109576 1337115 479 104 3604 9260
AY 196152 (Gro 1-5) 96 496 875 109576 1340142 431 272 3730 4823
AY 196153 (Gro 1-2) 107 496 12092 109576 1337142 479 272 3786 16096
AY 196154 (Gro 1-3) 78 512 946 109476 1337144 514 n.d. n.d. n.d.
AY 196155 (Gro 1-6) 93 496 403 109476 1330158 491 n.d. n.d. n.d.
AY 196156 (Gro 1-8) n.d. n.d. n.d. 109576 1337142 479 278 n.d. n.d.
AY 196157 (Gro 1-11) 102 496 5199 109376 1284142 479 272 3726 9143
AY 196158 (Gro 1-14) n.d. n.d. n.d. 797 76 226682 509 n.d. n.d. n.d.
n.d.: the length of the region could not be es timated as no alignment was found with the corresponding region ends of Gro1-4.
Table 5. Primers used for each paralogue-specific SCAR marker. Melting temperature (Tm) used in PCR experiments is
reported in column 4 as well as expected fragment size in column 5.
Paralogue Primer Code Primer Sequence 5’-3’ Tm () Product length (bp)
g1-2promF atatagtgttagtgtgcttgg
Gro 1-2 g1-2promR cttatctcgcggtctaagtc
56,0 299
g1-3IIIiF cccgcatgaaaatataaatg
Gro 1-3 g1-3IIIiR ttgagattgtaaccgatatc
51,2 544
4RNA2f* tctttggagatactgattctca
Gro 1-4 4RNA2r* cgacctaaaatgaaaagcatct
54,7 602
G1-5IiF ctctatttttatttctgcgatgaac
Gro 1-5 G1-5IiR ggtatactccttttttcatctttac
56,4 127
g1-6IVF aatgtcgaatgatcccttca
Gro 1-6 g1-6IVR gagcaggcaataacttccaa
54,2 202
g1-8TIRF catgattacgaaatggactc
Gro 1-8 g1-8TIRR tttgatccagatgattgtcg
53,2 315
g1-11p40promF atgtaattccacaagtgagg
Gro 1-11 g1-11p40promR tttgcattagagcttcgtag
53,2 264
g1-14nbsF aataggcgtcagctcagtgc
Gro 1-14 g1-14nbsR tatgctcggccttaattgga
57,4 190
Analysis was run on 15 Solanum wild species, on the
cultivar ‘Spunta’ and the clone P40. All primer pairs were
built to amplify only a fragment for the target paralogue
and had no other amplification products in the positive
control genotype P40. In some cases, faint amplified frag-
ments of different size were attained, albeit not scored, be-
cause following sequencing, they did not exhibit sequence
homolog y to any Gro1 paralogue. In other cases, clear am-
plified fragments of different size were attained and se-
quenced. They corresponded to Gro1 genes but exhibited
INDEL mutations when compared to the target paralogue;
consequently, a similarity value closer to other paralogues
rather than to target one was obtained by BLAST analysis.
Indeed, these mutations did not allow the specific paralogue
of the cluster to be clearly identified (data not shown).
Hence, these fragments were not scored either.
Genetic diversity within Wild Potato Species (Solanum spp.) Revealed by AFLP and SCAR Markers
Copyright © 2010 SciRes. AJPS
100
The PCR results are shown in Figure 3, where for
each species the presence (value 1) or absence (value 0)
of the expected amplified fragment is reported in tabular
form. Some fragments were present in all or most of the
wild species analysed and some proved to be only pre-
sent in one or few species. In particular, Gro1-8 SCAR
was the most common one, being present in all the 17
analysed genotypes, followed by Gro1-14 SCAR (pre-
sent in 16 genotypes). By contrast, Gro1-4 SCAR was
present only in clone P40, followed by Gro1-6 SCAR
(present in 4 genotypes). The data were subjected to
cluster analysis and the dendrogram shown in Figure 3
was built as described in the methods. Cluster analysis
highlighted two groups of identities. The first includes S.
canasense, S. hougasii and S. tuberosum subsp. andigena,
which all lacked the Gro1-4 and Gro1-6 SCARs. The
second group comprised S. boliviense and S. st ol o nif e rum ,
which both lack Gro1-3, Gro1-4, Gro1-6 and Gro1-11
SCARs. This clustering is not consistent with that pro-
duced by AFLP analysis.
Figure 2. Exon/Intron organization of Gro 1 genes with the position of designed SCAR primers.
Figure 3. Unrooted dendogram built on the basis of UPGMA clustering of eight Gro 1 paraloguespecific SCAR markers. The
similarity on the x-axis is based on Jaccard’s coefficient. On theright-hand side of the figure the presence (1) or absence (0) of
each SCAR marker is reported foreach genotype. Bootstrap values are reported at each cluster node.
Genetic diversity within Wild Potato Species (Solanum spp.) Revealed by AFLP and SCAR Markers
Copyright © 2010 SciRes. AJPS
101
4. Discussion
Characterization of variability among plant germplasm is
a fundamental preliminary activity for plant breeding.
While phenotypic variability has been characterized for
centuries, the present-day challenge is to ascertain the
relationship between genotypic and phenotypic variabil-
ity in order to improve plant breeding programmes. With
regard to phenotypic aspects, in the current study we
observed resistance variability to Globodera rostochien-
sis pathotype Ro2 among 15 wild Solanum species. In-
terestingly, some Solanum species suppressed nematode
reproduction, partially confirming the data of Hanneman
and Bamberg [26]. In five of the 15 species tested,
pathotype Ro2 had a reproduction rate < 1. The species S.
tuberosum subsp. andigena is the most interesting be-
cause it suppressed nematode reproduction rates of
pathotype Ro2 (0.6) and there were only 80 eggs per cyst
of pathotype Ro2 compared to 153 in the control cv.
Spunta. This wild species also exhibited a very low re-
productio rate (0.3) in comparison with Spunta (10.3),
when tested against pathotype Ro1 (data not shown).
Therefore, this clone is promising for breeding pro-
grammes for resistance to pathotype Ro2 of G. rosto-
chiensis. However, assessments of its response to other
pathotypes of this cyst nematode and of G. pallida
should also be made. Also, the species S. bulbocastanum,
S. jamesii and S. stoloniferum should be further investi-
gated, since they showed both a low reproduction rate
and a reduced number of eggs per cyst with respect to the
control cv. Spunta. Plant material in this work is also
particularly suitable for an allelic characterization study
and consequent phylogenetic elaborations since it con-
sists of a pool of wild species of various geographical
origins. All the material belongs to the Solanum genus,
but different subgenera are represented and different
polymorphism levels are detectable according to the
various subgroup of material considered.
AFLP cluster analysis confirmed that the species con-
sidered are uniformly distributed on the genus tree as
they showed almost uniform similarity coefficients, most
of them lying between 30% and 50%. Eight of the 15
wild species had been previously characterized in more
than one accession by AFLP analysis [27]. Although
neither the clones analyzed in our work (different acces-
sion numbers) nor the restriction enzymes used were the
same, the main structure of the cladogram found by
Spooner et al. [ 2 7 ] wa s o v e r a ll confirmed.
Besides genome-wide characterization of these species,
locus-specific analysis of one resistance gene was also
undertaken. In fact, the first step to improve the genetic
background of potato cultivars through interspecific hy-
bridization is to identify and characterize sources of re-
sistance. In most cases, resistance depends on pathogen
recognition by plant resistance factors and the specificity
of the recognition is given from the interaction between
R genes and Avr genes. These are usually involved in
hypersensitivity response (HR) [28]. Due to their func-
tion, resistance genes typically undergo swift changes
and continuously evolve, usually much faster than other
gene classes. Their rapid evolution is mainly due to en-
vironmental factors: pathogens rapidly overcome ac-
quired plant resistance, such that the plant evolutionary
process accelerates to combat pathogen infection strate-
gies [29]. The way in which resistance genes evolve and
change has long been studied: it is widely stated that re-
sistance genes are grouped into gene clusters containing
several paralogue genes [30], as is the case of I2 [31],
Mi-1 [32], I3 [33], Gro1 [15]. One of the most frequent
gene cluster configuratio ns is that of the gene Xa21 [34],
where a functional gene is organized as a cluster with
non-functional paralogues and truncated sequences. The
Gro1 cluster could be similar, with the Gro1-4 functional
gene linked to non-functional paralogues and gene frag-
ments. This is consistent with the hypothesis that clusters
could represent resistance gene storage and that frequent
gene exchanges in the cluster lead to a new resistance
strategy [35].
In order to characterize the 15 Solanum species at the
Gro-1 locus, in the present study specific primers for
each of the paralogues were constructed exploring the
variability of different functional domains (TIR, NSB,
LLR) and introns of the resistant allele Gro1-4, whose
sequences are available in GenBank. Bioinformatic
analysis of the P40 Gro1 gene cluster by means of
CLUSTAL-W alignment showed a very conserved re-
gion spanning NBS and LRR domains of the paralogues,
but other regions of similarity could not be identified due
to large insertions and repeated regions. In any case, the
primers designed on the basis of these bioinformatic re-
sults allowed the presence/absence of each paralogue to
be verified in each species analysed. As for the resistance
gene Gro1-4, no genotype produced fragments like P40
specifically designed to amplify Gro1-4, not even those
that exhibited resistance. This resistance, in fact, is
probably due to genes other than Gro 1-4, as already re-
ported in the literature [12,10]. Sequencing of the whole
cluster Gro1 has been started in our laboratory in order to
highlight the role of this clu ster in n ematode resistance of
Solanum tuberosum subs p. andigena species.
The cluster analysis of SCAR results underlined the
high similarity between S. canasense, S. hougasii and S.
tuberosum subsp. andigena and between S. boliviense
and S. stoloniferum. As for the first group, the species S.
canasense showed a good level of resistance to pathotyp e
Ro2, as well as S. tuberosum subsp. andigena. These two
Genetic diversity within Wild Potato Species (Solanum spp.) Revealed by AFLP and SCAR Markers
Copyright © 2010 SciRes. AJPS
102
species also shared the SCAR pattern of Gro 1 paralogues.
Therefore, a sequence analysis of Gro 1 locus also for S.
canasense is also desirable, since it could lead to the
definition of which paralogue could be the putative re-
sistance gene to pathotype Ro2. Inconsistency between
the two unrooted dendrograms was expected since evolu-
tion of R genes is strongly driven by environment so that
very different genomes can have very similar resistance
traits and vice-versa [30].
In conclusion, molecular differences within 15 wild
potato species were explored by generating AFLP fin-
gerprints and SCAR profiles. Our study reveals a new set
of markers that distinguish eight paralogues of the Gro 1
locus, potentially suitab le for mapping, MAS and clon ing
purposes. These could represent a useful tool for genetic
and breeding studies, if an association of these markers
with the resistance trait can be confirmed [4]. For this
purpose, the sequencing of the whole Gro 1 locus in the
resistant species is necessary, as well as confirming of
this resistance also in different environments.
5. Acknowledgements
The authors wish to thank Mark Walters for editing the
manuscript. This research was carried out in the frame-
work of the project “Risorse Genetiche di Organismi
Utili per il Miglioramento di Specie di Interesse Agrario
e per un’Agricoltura Sostenibile” funded by the Italian
Ministry of Agricultural and Forestry Policy.
REFERENCES
[1] J. G. Hawkes and J. P. Hierting, “The Potatoes of Bo-
livia—Their Breeding Value and Evolutionary Relation-
ships,” Clarendon Press, Oxford, 1989.
[2] D. Carputo and A. Barone, “Ploidy Level Manipulations
in Potato through Sexual Hybridization,” Annual of Ap-
plied Biol ogy, Vol. 146, No. 1, February 2005, pp. 71-79.
[3] R. Aversano, M. R. Ercolano, L. Frusciante, L. Monti, J.
M. Bradeen, G. Cristinzio, A. Zoina, N. Greco, S. Vitale
and D. Carputo, “Resistance Traits and AFLP Charac-
terization of Diploid Primitive Tuber-Bearing Potatoes,”
Genetic Resources and Crop Evolution, Vol. 54, No. 8,
December 2007, pp. 1797-1806.
[4] A. Barone, “Molecular Marker-Assisted Selection for
Potato Breeding,” American Journal of Potato Research,
Vol. 81, No. 2, March 2004, pp.111-117.
[5] C. Gebhardt, D. Bellin, H. Henselewski, W. Lehmann, J.
Schwarzfischer and J. P. T. Valkonen, “Marker-Assisted
Combination of Major Genes for Pathogen Resistance in
Potato,” Theoretical and Applied Genetics, Vol. 112, No.
8, February 2006, pp. 458-1464.
[6] S. I. Lara-Cabrera, D.M. Spooner, “Taxonomy of North
and Central American Diploid Wild Potato (Solanum Sect.
Petota) Species: AFLP Data,” Plant Systematics and
Evolution, Vol. 248, No. 1-4, September 2004, pp. 129-
142.
[7] R. G. van den Berg and N. Groendijk-Wilders, “AFLP
Data Support the Recognition of a New Tuber-Bearing
Solanum Species but are Uninformative about Its Taxo-
nomic Relationships,” Plant Systematics and Evolution,
Vol. 269, No. 3-4, December 2007, pp. 133-143.
[8] A. Carrasco, J.E. Chauvin, B. Trognitz, A. PAwlak, O.
Rubio-Covarruvias and E. Zimnoch-Guzowska, “Marker-
Assisted Breeding for Disease Resistance in Potato,” Po-
tato Research, Vol. 52, No. 3, August 2009, pp. 245-248.
[9] R. J. Marks and B. B Brodie, “Introduction: Potato Cyst
Nematodes—An International Pest Complex,” In: R. J.
Marks and B. B. Brodie, Eds., Potato Cyst Nematodes—
Biology, Distribution and Control, CAB International,
Wallingford, UK, 1998, pp. 1-4.
[10] M. F. B. Dale and M. M. de Scurrah, “Breeding for Re-
sistance to the Potato Cyst Nematodes Globodera Rosto-
chiensis and Globodera Pallida,” In: R. J. Marks and B. B.
Brodie, Eds., Potato Cyst Nematodes— Biology, Distri-
bution and Control, CAB International, Wallingford, UK,
1998, pp. 167-195.
[11] H. Ross, “Potato Breeding: Problems and Perspectives,”
In: W. Horn and G. Robbelen, Eds., Journal Plant
Breeding Supplement, Vol. 13, 1986, pp.82-86.
[12] C. Gebhardt, D. Mugniery, E. Ritter, F. Salamini and E.
Bonnel, “Identification of RFLP Markers Closely Linked
to the H1 Gene Conferring Resistance to Globodera ros-
tochiensis in Potato,” Theoretical and Applied Genetics,
Vol. 85, No. 5, January 1993, pp. 541-544.
[13] J. Rouppe van der Voort, W. Lindeman, R. Folkertsma, R.
Hutten, H. Overmars, E. van der Vossen, E. Jacobsen and
J. Bakker, “A QTL for Broad-Spectrum Resistance to
Cyst Nematode Species (Globodera spp.) Maps to a Re-
sistance Gene Cluster in Potato,” Theoretical and Applied
Genetics, Vol. 96, No. 5, April 1998, pp. 654-661.
[14] A. Barone, E. Ritter, U. Schachtschabel, T. Debener, F.
Salamini, C. Gebhardt, “Localization by restriction frag-
ment length polymorphism mapping in potato of a major
dominant gene conferring resistance to the potato cyst
nematode Globodera rostochiensis,” Molecular General
Genetics, vol. 224, November 1990, pp.177-182.
[15] J. Paal, H. Henselewski, J. Muth, K. Mekesem, C.M.
Menendez, F. Salamini, A. Ballvora and C. Gebhardt,
“Molecular Cloning of the Potato Gro1-4 Gene Confer-
ring Resistance to Pathotype Ro1 of the Root Cyst
Nematode Globodera rostochiensis, Based on a Candi-
date Gene Approach,” Plant Journal, Vol. 38, No. 2,
April 2004, pp. 285-297.
[16] P. Vos, G. Simons, T. Jesse, J. Wijbrandi, L. Heinen, R.
Hogers, A. Frijters, J. Groenendijkk, P. Diergaarde, M.
Reijans, J. Fierens-Onstenk, M. De Both, J. Peleman, T.
Liharska, J. Hontelez and M. Zabeau, “The Tomato Mi-1
Gene Confers Resistance to both Root-Knot Nematodes
and Potato Aphids,” Nature Biotechnology, Vol. 16, No.
13, December 1998, pp. 1365-1369.
[17] T. Murashige and F. Skoog, “A Revised Medium for
Rapid Growth and Bioassays with Tobacco Tissue Cul-
Genetic diversity within Wild Potato Species (Solanum spp.) Revealed by AFLP and SCAR Markers
Copyright © 2010 SciRes. AJPS
103
tures,” Physiologia Plantarum, Vol. 15, No. 3, April 1962,
pp. 251-258.
[18] J. W. Seinhorst, “Separation of Heterodera Cysts from
Organic Debris Using Ethanol,” Nematologica, Vol. 20,
April 1974, 367-369.
[19] J. W. Seinhorst and H. den Ouden, “An Improvement of
Bijloo’s Method for Determining the Egg Content of Het-
erodera Cysts,” Nematologica, Vol. 12, January 1966, pp.
170-171.
[20] D. B. Duncan, “Multiple Range and Multiple F Tests,”
Biometrics, Vol. 11, No. 1, 1955, pp. 1-42.
[21] P. Vos, R. Hogers, M. Bleeker, M. Reijans, T. van der
Lee, M. Hornes, A. Frijters, J. Pot, J. Peleman, M. Kuiper
and M. Zabeau, “AFLP: A New Technique for DNA Fin-
gerprinting,” Nucleic Acids Research, Vol. 23, No. 21,
November 1995, pp. 4407-4414.
[22] J. D. Thompson, D. G. Higgins and T. J. Gibson,
“CLUSTAL W: Improving the Sensitivity of Progressive
Multiple Sequence Alignment through Sequence Weight-
ing, Position Specific Gap Penalties and Weight Matrix
Choice,” Nucleic Acids Research, Vol. 22, No. 22, No-
vember 1994, pp. 4673-4680.
[23] S. F. Altschul, T. L. Madden, A. A. Schaffer, J. Zhang, Z.
Zhang, W. Miller and D. J. Lipman, “Gapped BLAST
and PSI-BLAST: A New Generation of Protein Database
Search Programs,” Nucleic Acids Research, Vol. 25, No.
17, September 1997, pp. 3389-3402.
[24] F. J. Rolf, “NTSY Spc. Numerical Taxonomy and Multi-
variate Analysis System” Vol 2.0, Exeter Software, Se-
tauket, New York, USA, 1989.
[25] I. V. Yap and R. J. Nelson, “WINBOOT, a Program for
Performing Bootstrap Analysis of Binary Data to Deter-
mine the Confidence Limits of UPGMA Based Dendro-
grams,” IRRI Discussion Paper Ser. No. 14, International
Rice Research Institute, Los Baños, 1996.
[26] R. E. Jr. Hanneman and J. B. Bamberg, “Inventory of
Tuber-Bearing Solanum Species,” Bulletin 533 of Re-
search Division of the College of Agriculture and Life
Sciences, University of Wisconsin, Madison USA, 1986.
[27] D. M. Spooner, K. McLean, G. Ramsay, R. Waugh and G.
J. Bryan, “A Single Domestication for Potato Based on
Multilocus Amplified Fragment Length Polymorphism
Genotyping,” Proceeding of the National Academy of
Sciences of United States of America, Vol. 102, No. 41,
October 2005, pp. 14694-14699.
[28] A. F. Bent and D. Mackey, “Elicitors, Effectors, and R
Genes: The New Paradigm and a Lifetime Supply of
Questions,” Annual Review of Phytopathololy, Vol. 45,
September 2007, pp. 399-436.
[29] G. B. Martin, A.J. Bogdanove and G. Sessa, “Under-
standing the Functions of Plant Disease Resistance Pro-
teins,” Annual Review of Plant Biology, Vol. 54, June
2003, pp. 23-61.
[30] R. Fluhr, “Sentinels of Disease—Plant Resistance Genes,”
Plant Physiology, Vol. 127, No. 4, December 2001, pp.
1367-1374.
[31] G. Simons, “Dissection of the Fusarium I2 Gene Cluster
in Tomato Reveals Six Homologs and One Active Gene
Copy,” Plant Cell, Vol. 10, No. 6, June 1998, pp. 1055-
1068.
[32] S. Seah, J. Yaghoobi, M. Rossi, C. A. Gleason and V. M.
Williamson, “The Nematode-Resistance Gene, Mi-1, is
Associated with an Inverted Chromosomal Segment in
Susceptible Compared to Resistant Tomato,” Theoretical
and Applied Genetics, Vol. 108, No. 8, May 2004, pp.
1635- 1642.
[33] M. N. Hemming, S. Basuki, D. J. McGrath, B. J. Carroll
and D.A. Jones, “Fine Mapping of the Tomato I-3 gene
for Fusarium wilt Resistance and Elimination of a
Co-segregating Resistance Gene Analogue as a Candidate
for I-3,” Theoretical and Applied Genetics, Vol. 109, No.
2, July 2004, pp. 409-418.
[34] W. A. Song, L. A. Pi, G. L. Wang, J. Gardner, T. Hoisten
and P. C. Ronald, “Evolution of the Rice Xa21 Disease
Resistance Gene Family,” Plant Cell, Vol. 9, No. 8, Au-
gust 1997, pp. 1279-1287.
[35] R. W. Michelmore and B.C. Meyers, “Clusters of REsis-
tance Genes in Plants Evolve by Divergent Selection and
Birth-and-Death Process,” Genome Research, Vol. 8, No.
11, November 1998, pp. 1113-1130.