Journal of Cancer Therapy, 2013, 4, 1052-1059
http://dx.doi.org/10.4236/jct.2013.46119 Published Online August 2013 (http://www.scirp.org/journal/jct)
The Role of Thymidylate Synthase in
Pemetrexed-Resistant Malignant
Pleural Mesothelioma Cells
Tohru Obata*, Motohiro Tanaka, Yuka Suzuki, Takuma Sasaki
Laboratory of Bioorganic Chemistry, School of Pharmacy, Aichi Gakuin University, Nagoya, Japan.
Received May 15th, 2013; revised June 18th, 2013; accepted June 25th, 2013
Copyright © 2013 Tohru Obata et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT
We established new pemetrexed-resistant cells originating from malignant pleural mesothelioma MSTO-211H cells to
clarify the mechanism involved in pemetrexed resistance in malignant pleural mesothelioma. In the pemetrexed-resis-
tant cells, only thymidylate synthase (TYMS) mRNA was overexpressed among other well-known molecular targets and
chemosensitivity determinants of pemetrexed, and the role of the TYMS gene was ascertained by artificial regulation
induced by specific siRNA. Silencing the TYMS expression partially restored the cytotoxicity of pemetrexed. The resis-
tant cells did not display other gene alterations related to folate metabolism. We conclude that the primary mechanism
imparting resistance to these cells is specific up-regulation of TYMS function. Further, the TYMS gene may serve as a
useful biomarker for the prediction of pemetrexed chemosensitivity in patients with malignant pleural mesothelioma.
We also investigated the efficacy of 1-(3-C-ethynyl-ß-D-ribo-pentofuranosyl)cytosine (ECyd) in overcoming pemetrex-
ed resistance; this compound is presently undergoing clinical trials in the USA as TAS-106. ECyd had a similar antitu-
mor effect on the resistant cells as that on the parental cells. In the clinical treatment of malignant pleural mesothelioma,
ECyd promises to emerge as a novel drug.
Keywords: Malignant Pleural Mesothelioma; Thymidylate Synthase; Pemetrexed; ECyd
1. Introduction
Malignant pleural mesothelioma is considered to be caused
by previous exposure to asbestos fibers [1-3]. Regardless
of the stage at diagnosis, it is generally viewed as a treat-
ment-resistant tumor having poor prognosis [4] owing to
serious difficulties, including the availability of effective
drugs. Until recently, although no chemotherapeutic agent
was effective against malignant pleural mesothelioma, in
2004, the Food and Drug Administration (FDA) ap-
proved administration of pemetrexed in combination with
cisplatin for the treatment of patients whose condition is
unresectable or who are otherwise not candidates for cu-
rative surgery [5]. Pemetrexed is an antifolate drug that
targets some folate enzymes [5,6]; this drug is initially
transported into the cytoplasm by reduced folate carrier
(RFC) and other transporters and then metabolized to a
polyglutamated form by folypoly-gamma-glutamate syn-
thetase (FPGS). Polyglutamation increases cellular reten-
tion and confers an affinity for some enzymes involved
in folate metabolism. Pemetrexed and its polyglutamated
derivatives inhibit thymidylate synthase (TYMS), dihy-
drofolate reductase (DHFR), and glycinamide ribonu-
cleotide transformylase (GARFT), all of which are in-
volved in the de novo biosynthesis of thymidine and pu-
rine nucleotides. Antimetabolite agents, including peme-
trexed, induce an imbalance in the cellular nucleotide
pool and inhibit nucleic acid biosynthesis that results in
arresting the proliferation of tumor cells and inducing
cell death [5-7].
In pemetrexed-resistant cells, TYMS overexpression is
one of the major factors leading to resistance [8] and the
regulation of DHFR, RFC, and FP GS expression is asso-
ciated with acquired resistance to pemetrexed [8,9]. These
resistance mechanisms have been investigated in the co-
lon [10], breast [11], gastric [12], small cell lung cancer
[13], non-small cell lung cancer [14], and leukemia cell
lines [15]. These tumor types had not been recognized by
FDA. In this study, we have newly established peme-
*Corresponding author.
Copyright © 2013 SciRes. JCT
The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells 1053
trexed-resistant malignant pleural mesothelioma cells
from MSTO-211H cells and studied its resistant mecha-
nisms against pemetrexed. Further, we also examined the
efficacy of 1-(3-C-ethynyl-ß-D-ribo-pentofuranosyl)cyto-
sine (ECyd) against malignant pleural mesothelioma in
overcoming the established resistance.
2. Materials and Methods
2.1. Drugs and Tumor Cells
1-(3-C-Ethynyl-ß-D-ribo-pentofuranosyl)cytosine (ECyd,
TAS-106) was provided by TAIHO Pharmaceutical (To-
kyo, Japan), while pemetrexed was purchased from To-
ronto Research Chemicals (North York, Canada). Human
mesothelioma MSTO-211H cells were purchased from
the American Type Culture Collection (ATCC, Manassas,
VA, USA). The resistant cell line (H/pemetrexed) was
established by a stepwise drug increase method. Both
parental and resistant cell lines were maintained at 37˚C
and 5% CO2 in RPMI-1640 medium supplemented with
10% heat-inactivated fetal bovine serum (FBS) and 1%
penicillin-streptomycin (Life Technologies, Carlsbad,
CA, USA).
2.2. Drug Sensitivity Test
The growth-inhibitory effects of the drugs on human
tumor cells were examined using a colorimetric assay
involving 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetra-
zolium bromide (MTT). Briefly, 190-µl aliquots of an
exponentially growing cell suspension (1000 cells/190
µl/well) were incubated with 10 µl of varying concentra-
tions of drugs. After exposure to the drugs for 48 - 72 h,
20 µl of MTT solution (3 mg/ml) was added to each well
and the cell cultures were incubated at 37˚C for 4 h. Af-
ter removal of the medium, the formed formazan was dis-
solved in 200 µl of dimethyl sulfoxide. The absorbance
of each well was measured at 570 nm with an immuno-
reader (MTP-800AFC, CORONA Electric, Hitachinaka,
Japan), and the inhibition ratio (IR) was calculated using
the following formula: IR (%) = (1 T/C) × 100, where
C is the mean of optical densities of the control group
and T of the treatment group. The IC50 value was defined
as the concentration of the drug needed to effect a 50%
reduction in growth relative to the control. The IC50 value
was determined by a graphical correlation of the dose-
response curve with at least three drug concentration
points.
2.3. siRNA Transfection
All small-interfering RNAs (siRNAs) were purchased
from Stealth RNAi (Life Technologies). The sequences
of three siRNAs (TYMS-1 to -3) targeting TYMS gene
(NM_001071) were
5’-GCTGTGGTTTATCAAGGGATCCACA-3’
(403 - 427),
5’-GGGAGATGCACATATTTACCTGAAT-3’
(895 - 919), and
5’-CAGAGATATGGAATCAGATTATTCA-3’
(577 - 919), respectively. Stealth RNAi glyceraldehyde-
3-phosphate dehydrogenase (GAPDH) Positive Control
(Life Technologies) and Stealth RNAi Negative Control
(Low GC Duplex #2; Life Technologies) were served as
a control. Upon preincubation at 37˚C for 24 h, cells in
35-mm dishes were transfected with 250 pmol siRNA
using lipofectamine 2000 (Life Technologies) following
the manufacturer’s protocol. Cells were treated with the
transfection agent/siRNA complex for 24 h and subjected
to further analysis.
2.4. Quantization of mRNA Expression
The cells were washed with PBS () and then total RNA
was extracted using ISOGEN (Nippon Gene, Osaka, Ja-
pan) according to the manufacturer’s instructions. The
concentration of the total extracted RNA was determined
by measuring the OD at 260 nm, and the RNA was di-
luted to 200 µg/ml. First strand cDNA synthesis was car-
ried out using 2 µg of total RNA, 5 pmol oligo (dT) 12 -
18 (GE Healthcare, Buckinghamshire, UK) and Re-
veTraAce (TOYOBO, Osaka, Japan) at 42˚C for 90 min.
cDNA prepared by the reverse transcription reaction was
subjected to PCR amplification in a Thermal Cycler Dice
Real-Time System (Takara Bio, Shiga) with SYBR Green
PCR Master Mix (Takara Bio, Japan) using specific
primers (Table 1). The expression of the target genes
was standardized using the regular housekeeping genes
[ribosomal protein large P2 (RPLP2), ribosomal protein
S18 (RPS18), phosphoglycerate kinase 1 (PGK1), and
beta-actin (ACTB)], and the relative expression levels
were quantified by using the 2-ΔΔCT method.
2.5. Establishment of TYMS-Overexpressing
Tumor Cell Line
Cells were transfected with the TYMS gene to clarify and
understand the effect of the drugs on TYMS function.
Human TYMS was overexpressed by PCR amplification
of the full coding sequence of human TYMS cDNA using
the sense primer 5’-ATGCCTGTGGCCGGCTCGGA-3’
and the antisense primer
5’-ATATCCTTCGAGCTCCTTTG-3’. The TYMS
cDNA was cloned into the pEF6/V5-His TOPO vector
(Life Technologies) to construct pEF6/TYMS. This plas-
mid was transfected into the MSTO-211H cells by using
the FuGENE 6 transfection reagent (Roche Diagnostics,
Indianapolis, IN, USA) according to the manufacturer’s
instructions. The transfectants were grown in a cultured
medium containing 500 µg/ml blasticidin S. Blasticidin-
Copyright © 2013 SciRes. JCT
The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells
Copyright © 2013 SciRes. JCT
1054
Table 1. Primers used in real-time PCR.
Gene name GenBankacc No.
Symbol
Forward primer Reverse primer
thymidylate synthetase NM_001071.2
TYMS ATCATCATGTGCGCTTGGAATC TGTTCACCACATAGAACTGGCAGAG
dihydrofolate reductase NM_000791.3
DHFR AGGGTTGGTTAGGCAATCATTC AGGATTTAGCTCTTACACCATCACA
gamma-glutamyl hydrolase NM_003878.2
GGH AACCTCTGACTGCCAATTTCCATAA TCTCTGGATGCCACTGGACAC
phosphoribosylglycinamideformyltransferase transcript variant 1 NM_000819.3
GART_v1
CATAGCAATGGATTTAGCCTTGTGA GCTGTAGATTCTGGTAGGCGTGAG
phosphoribosylglycinamideformyltransferase transcript variant 2 NM_175085.2
GART_v2
ATGGACTGCTCTGCACATCTCTG AGTGCCTGCATGGAACACCTC
folylpolyglutamate synthase transcript variant 1 NM_004957.4
FPGS_v1
TCTGCCCTAACCTGACAGAGGTG TCGTCCAGGTGGTTCCAGTG
folylpolyglutamate synthase transcript variant 2 NM_001018078.1
FPGS_v2
TCTGCCCTAACCTGACAGAGGTG TCGTCCAGGTGGTTCCAGTG
solute carrier family 19 (folate transporter) member 1 transcript variant 1 NM_194255.1
SLC19A1 ACTTTCATTGTCTCGGACGTG GTAGATGATGGACAGGATCAGGA
solute carrier family 46 member 1 (folate transporter) NM_080669.3
SLC46A1 CCGCAGCTTAAAGCAGTCACAA CAGCACCTGCCTGGCTACAA
ribonucleotide reductase M1 NM_001033.3
RRM1 GAGCAGGGCCCATACGAAAC CCCAGGATCTGAGCAGTGGAA
ribonucleotide reductase M2, transcript variant NM_001034.1
RRM2 TGATGTTCAAACACCTGGTACACAA AACCCAGTTCCAGCATAAGTCTGTC
ribonucleotide reductase M2B (TP53 inducible) transcript variant 1 NM_015713.3
RRM2B AATGATAAAGCTGCAGATGGGCTAA AATTCTGTGCCATTCATCCAGATTC
resistant cells were isolated and designated as MSTO/
TYMS. The empty vector pEF6 was also transfected into
the MSTO-211H cells to generate control cells, which
were designated as MSTO/Mock.
2.6. Western Blot Analysis for Protein
Expression of Human TYMS
Cell lysates were prepared in CelLytic-M reagent
(Sigma-Aldrich, St. Louis, MO, USA) containing 10%
Protease Inhibitor Cocktail (Sigma-Aldrich). Protein
samples were mixed with a loading buffer [50 mMTris-
HCl (pH 6.5), 10% glycerol, 2% sodium dodecyl sulfate
(SDS), 0.1% bromophenol blue, and 40 mM dithiothrei
tol] and electrophoresed on a 10% - 20% gradient SDS-
poly-acrylamide gel (mini-quick gel, Anatech, Tokyo,
Japan) after which the proteins were transferred to a
polyvinylidene difluoride membrane filter (Immobilon;
Millipore, Bedford, MA, USA). The membrane was
blocked in TBS-Tween containing 5% blocking agent
(GE Healthcare) for 1 h and then probed with the mouse
monoclonal antibody to TYMS (ab3145, Abcam, Cam-
bridge, UK) or with rabbit polyclonal antibody to ß-actin
(ab8227, Abcam) for 2 h at room temperature. Horserad-
ish peroxidase-conjugated anti-mouse IgG antibody or
anti-rabbit IgG antibody (GE Healthcare) was used for
the detection with enhanced chemiluminescence detec-
tion reagent (GE Healthcare). Chemiluminescence was
detected by LAS-3000 (Fuji Film, Tokyo, Japan).
3. Results
3.1. Establishment of Pemetrexed-Resistant Cells
Originating from Malignant Pleural
Mesothelioma
The MSTO-211H cells were initially cultured with 1 nM
pemetrexed. Incremental increase in the concentration of
The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells 1055
pemetrexed during logarithmic cell growth allowed the
determination of maximum growth rate, and eventually,
the cells were grown in the culture medium containing
0.1 µM pemetrexed. The dose-response curves for pe-
metrexed exposed to parental MSTO-211H cells and
resistant cells (H/pemetrexed) are presented in Figure 1.
The IC50 value of the H/pemetrexed cells was estimated
to be over 100 times that of the parental cells.
3.2. Comparison of the Expression of Related
Genes during Folate Metabolism
Expression of several typical genes related to pemetrexed
chemosensitivity was measured by real-time PCR, and
the TYMS mRNA expression (32.9 ± 9.7 times) was
found to be significantly increased in H/pemetrexed
cells (Figure 2(a)). The expression of DHFR, gamma-
glutamyl hydrolase (GGH), ribonucleotide reductase M1
(RRM1), and ribonucleotide reductase M2B (RRM2B)
genes also increased slightly in the H/pemetrexed cells
(3.2 to 4.6-fold, statistically insignificant). On the other
hand, the expression of solute carrier family 19 member
(SLC19A) mRNA, which is one of the folate transporters,
was significantly reduced compared to the parental cells
(0.53 ± 0.05 times). Overexpression of the TYMS protein
was also confirmed by western blot analysis (Figure
2(b)).
3.3. Drug Sensitivity to Assess the Effect of
Transfection with siRNA Targeted to the
TYMS Gene
Intracellular mRNA expression can be downregulated by
specific siRNA. All three TYMS siRNAs, which targeted
independent sequences within the TYMS coding region,
effectively induced downregulation of the intracellular
Figure 1. Chemosensitivity in pemetrexed-resistant cells
originating from malignant pleural mesothelioma. Dose-
response curves for pemetrexed in MSTO-211H cells (clos-
ed circles) and in H/pemetrexed cells (open circles). Con-
tinuous exposure to variable concentrations of pemetrexed
applied for 72 h. Each point was plotted as an average of
easily three independent experiments.
TYMS mRNA expression by over 80% in H/pemetrexed
and MSTO-211H cells (Figure 3). Control siRNA, tar-
geted towards the GAPDH gene, also specifically down-
regulated the expression of GAPDH mRNA. Each
siRNA had an effect exclusively on the expression of its
specific target gene in both the cells. The cells treated
with siRNA were exposed to varying concentrations of
pemetrexed for 48 h after which their chemosensitivity
was evaluated. Pemetrexed was applied at two varying
concentrations, as each cell line possessed considerably
0
5
10
15
20
25
30
35
40
45
TYMS
DHFR
GGH
GART_v1
GART_v2
FPGS_v1
FPGS_v2
SLC19A
SLC46A1
RRM1
RRM2
RRM2B
RPLP2
RPS18
PGK1
ACTB
Relative expression
(vs. in MSTO-211H)
*
*
TYMS
-actin
MSTO-211H
H/pemetrexe
d
(a) (b)
Figure 2. Comparison of anti-folate metabolism genes be-
tween parental and resistant cells. (a) mRNA expression
was evaluated by real-time RT-PCR using the ΔΔCT
method normalized by housekeeping genes. *shows signifi-
cant difference from parental MSTO-211H cells by the
t-test (p < 0.01); (b) The level of TYMS protein in MSTO-
211H cells and H/pemetrexed cells as detected by the west-
ern blot analysis.
Figure 3. Quantization of mRNA expression in siRNA treat-
ed MSTO-211H and H/pemetrexed cells. Three TYMS siRNAs
were targeted for different TYMS gene sequences and tran-
sfected into MSTO-211H and H/pemetrexed cells. GAPDH
and negative siRNA were used as controls. mRNA expres-
sion was evaluated by quantitative real-time PCR. Upper
and lower graphs represent the expression of TYMS and
GAPDH mRNAs, respectively. Each expression fold was
calculated from the ratio of MSTO-211H cells treated with
negative siRNA.
Copyright © 2013 SciRes. JCT
The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells
1056
different chemosensitivity to pemetrexed. Treating the
parental cells with two siRNAs targeting TYMS (TYMS
2 and 3) enhanced the antitumor activity (27 and 15%)
at 0.007 µM pemetrexed (Figure 4). Moreover, the effect
of TYMS siRNA was confirmed even in H/pemetrexed
cells that had overexpressed TYMS mRNA. In both cell
lines, siRNAs targeted at TYMS increased the cytotoxic-
ity of pemetrexed.
3.4. Reduction of Drug Sensitivity in Transfected
Cells with TYMS Expression Vector
In order to determine whether TYMS gene expression
was affected by pemetrexed sensitivity, the parental cells
were transfected with a TYMS expression vector. The
TYMS expression vector (pEF6/TYMS) was constructed
from pEF6/V5-His TOPO vector according to the given
protocol, and the constructed vector was transfected into
the MSTO-211H cells to establish stable TYMS overex-
pressed cells (MSTO/TYMS). The expression of TYMS
mRNA in these cells was confirmed by real-time PCR
(Figure 5) and the expression levels in the MSTO/
TYMS cells against parental MSTO-211H cells (21.9 ±
3.9 fold) was similar to that of H/pemetrexed cells. Pe-
metrexed chemosensitivity in the established MSTO/
TYMS cells was investigated (Figure 6) and found to be
reduced, having IC50 values higher than those of the pa-
rental or mock cells. Furthermore, a cross-resistance to
methotrexate (MTX) was also observed.
3.5. Antitumor Activity of ECyd against
Pemetrexed-Resistant Cells
The cytotoxicity of other antimetabolic drugs was inves
tigated for overcoming the high pemetrexed-resistance in
H/pemetrexed cells (Table 2). ECyd showed similar an-
titumor effect against both parental and resistant cells.
Figure 4. Effect of TYMS siRNA on cytotoxicity of pe-
metrexed in MSTO-211H and H/pemetrexed cells. MSTO-
211H and H/pemetrexed cells were exposed to 0.007 and
840 µM of pemetrexed for 48 h after transfection with spe-
cific siRNA. *shows significant difference from negative
siRNA treated cells by the t-test (p < 0.01).
Figure 5. mRNA expression in MSTO-211H cells trans-
fected with TYMS expression vector. MSTO-211H cells
transfected with TYMS expression vector were established
by a selection agent over a few weeks. The mRNA expres-
sion was evaluated by quantitative real-time PCR. Each ex-
pression fold was calculated by the ratio against MSTO-
211H cells. *shows significant difference from parental
MSTO-211H cells by the t-test (p < 0.01).
0
20
40
60
80
100
0.01 0.11
IR (%)
pemetrexed (µM)
(a)
0
20
40
60
80
100
0.01 0.1110
IR (%)
MTX (µM)
(b)
Figure 6. Inhibition of antitumor effect by transfection with
TYMS expression vector. The chemosensitivity of peme-
trexed and MTX is shown in MSTO-211H cells (open cir-
cles), MSTO/TYMS cells (closed circles) and MSTO/Mock
cells (open triangles).
Copyright © 2013 SciRes. JCT
The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells 1057
Table 2. Cytotoxicity profiles of antimetabolic drugs in
H/pemetrexed cells.
IC50 (µM)
Drug
MSTO-211H H/pemetrexed
Resistant
index*
Pemetrexed 0.067 8.70 130
MTX 0.012 0.066 5.67
5FU 7.46 13.7 1.84
ECyd 0.029 0.012 0.43
*Resistance index was calculated as a ratio of IC50 for resistant cells to IC50
for parental cells.
Since MTX had a similar mechanism as pemetrexed,
partial cross-resistance was observed in H/pemetrexed
cells. Additionally, 5FU had an equivalent antitumor ef-
fect, which was revealed even in H/pemetrexed cells.
4. Discussion
Although several pemetrexed-resistant cells originating
from colon, breast, gastric and non-small cell lung can-
cers and especially leukemia cell lines have already been
reported, there is no report of pemetrexed-resistance cells
from malignant pleural mesothelioma cell lines. Recently,
pemetrexed has been clinically approved against malign-
nant pleural mesothelioma, but continuous and repeated
treatment can result in resistance against permetrexed in
the future. We attempted to establish pemetrexed-resis-
tant cells originating from some malignant pleural meso-
thelioma cell lines in order to clarify the mechanism un-
derlying pemetrexed resistance in mesothelioma. Among
the cell lines tested, only the MSTO-211H cells could
acquire resistance against pemetrexed. Treatment of MS-
TO-211H cells with pemetrexed induced higher expres-
sion of TYMS mRNA compared to other mesothelioma
cell lines, such as NCI-H2452 and ACC-MESO-1. This
characteristic nature of MSTO-211H cells may contrib-
ute to the acquisition of high resistance against peme-
trexed.
Detailed pemetrexed-resistant mechanisms in H/pe-
metrexed cells were investigated by analyzing mRNA
expression, which were closely related to folate metabo-
lism. Remarkably, TYMS mRNA was expressed in H/
pemetrexed cells, and the expression of some genes, in-
cluding DH FR, GGH, and RR, increased slightly. The
main reason for pemetrexed-resistance in H/pemetrexed
cells was considered to be an up-regulation of the TYMS
function. However, contribution of the up-regulation of
DHFR, GGH, and RR genes in the elevated pemetrexed-
resistance could not be completely ruled out. The expres-
sion of SLC19A, a folate-transporter gene, decreased sig-
nificantly and there appeared to be a weak relationship
with pemetrexed resistance. Additionally, pemetrexed
may be specifically transported intracellularly via SLC
19A1 and not SLC46A1.
Single nucleotide polymorphism (SNP) in the 5’-UTR
of the TYMS gene is well known, and the tandem repeat
is related to the chemosensitivity of 5FU [16-19]. The
overexpression of TYMS mRNA could not be attributed
to SNP in the 5’-UTR, since the genomic polymorphisms
(3R type) among the parental and resistant cells were not
altered. Moreover, since the E2F of a transcription factor
resided within the promoter region of the TYMS gene, the
mRNA expression of the E2F family was investigated.
We observed that the expression of E2F family mRNA
was not upregulated in the H/pemetrexed cells. Therefore,
even though the activation mechanism of the TYMS gene
in H/pemetrexed cells has not yet been identified, the
TYMS gene is considered to be an important factor in the
acquisition of pemetrexed-resistance.
The TYMS gene was artificially regulated to clarify its
involvement in pemetrexed resistance. TYMS down-regu-
lation by specific siRNA partially restored the chemo-
sensitivity for pemetrexed in the parental and H/peme-
trexed cells. However, the effect of TYMS-1 siRNA on
pemetrexed chemosensitivity did not appear unexpect-
edly. Although TYMS-1 siRNA knocked down TYMS
mRNA, the chemosensitivity for pemetrexed in only the
parental MSTO-211H cells were similar to that treated
with control siRNA. Since TYMS mRNA expression in
MSTO-211H cells were steady at a lower level than that
in H/pemetrexed cells, the enhanced cytotoxic effect on
being treated with specific siRNA in MSTO- 211H cells
are plausible. On the other hand, MSTO/ TYMS cells,
which stably over-expressed TYMS mRNA, tended to be
resistant against pemetrexed and MTX. Even though the
expression level of TYMS mRNA in MSTO/TYMS cells
were over 20 times higher than that in MSTO-211H cells,
its resistance were weak relative to H/pemetrexed cells,
which similarly over-expressed TYMS mRNA. In H/pe-
metrexed cells, the expression of other genes, including
DHFR and GGH, increased slightly but not in MSTO/
TYMS cells. It was considered that the functions of DHFR
and GGH were partially related to acquisition of pe-
metrexed resistance in the MSTO-211H cells.
High resistance to an antitumor drug is a serious prob-
lem in chemotherapy. We have examined the cytotoxic-
ity of some antimetabolic drugs in H/pemetrexed cells
(Table 2) and found that these cells showed cross-resis-
tance to MTX, which had cellular metabolism and targets
similar to pemetrexed. Although 5FU targets the same
cellular factors as MTX, the chemosensitivity for 5FU in
H/pemetrexed cells were retained, suggesting that the
main target of 5FU in this cell line is not TYMS. It ap-
peared that the pyrimidine salvage pathway was more
prominent than in other cell lines. ECyd, having an anti-
tumor mechanism different from pemetrexed, was an
Copyright © 2013 SciRes. JCT
The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells
1058
effective drug even in pemetrexed-resistant cells. How-
ever, the mechanism of ECyd involves inhibition of RNA
biosynthesis, and ECyd has been considered a superior
antitumor nucleoside whose clinical trials are in progress
as TAS-106 in USA [20,21]. ECyd and pemetrexed be-
long to the same category as anti-metabolic drugs. How-
ever, their metabolic and activated pathways differ through
the pyrimidine and folate metabolic pathways, respec-
tively, bestowing ECyd with excellent antitumor activity
against many solid tumors [22-28]. Even in H/peme-
trexed cells, ECyd showed the same antitumor effect as
in MSTO-211H cells. Therefore, in the clinical treatment
of malignant pleural mesothelioma patients, ECyd may
be extremely useful as a promising second line drug. The
TYMS gene may be considered as a useful biomarker for
predicting pemetrexed chemosensitivity in malignant pleu-
ral mesothelioma patients.
REFERENCES
[1] M. Pistolesi and J. Rusthoven, “Malignant Pleural Meso-
thelioma: Update, Current Management, and Newer The-
rapeutic Strategies,” Chest, Vol. 126, No. 4, 2004, pp.
1318-1329. doi:10.1378/chest.126.4.1318
[2] M. E. Ramos-Nino, J. R. Testa, D. A. Altomare, H. I.
Pass, M. Carbone, M. Bocchetta and B. T. Mossman, “Cel-
lular and Molecular Parameters of Mesothelioma,” Jour-
nal of Cellular Biochemistry, Vol. 98, No. 4, 2006, pp.
723-734. doi:10.1002/jcb.20828
[3] B. W. Robinson and R. A. Lake, “Advances in Malignant
Mesothelioma,” New England Journal of Medicine, Vol.
353, No. 15, 2005, pp. 1591-1603.
doi:10.1056/NEJMra050152
[4] J. P. Steele and A. Klabatsa, “Chemotherapy Options and
New Advances in Malignant Pleural Mesothelioma,” An-
nals of Oncology, Vol. 16, No. 3, 2005, pp. 345-351.
doi:10.1093/annonc/mdi094
[5] M. Hazarika, R. M. White, J. R. Johnson and R. Pazdur,
“FDA Drug Approval Summaries: Pemetrexed (Alimta),”
Oncologist, Vol. 9, No. 5, 2004, pp. 482-488.
[6] S. Chattopadhyay, R. G. Moran and I. D. Goldman, “Pe-
metrexed: Biochemical and Cellular Pharmacology, Me-
chanisms, and Clinical Applications,” Molecular Cancer
Therapeutics, Vol. 6, No. 2, 2007, pp. 404-417.
doi:10.1158/1535-7163.MCT-06-0343
[7] M. Hazarika, R. M. White Jr., B. P. Booth, Y. C. Wang,
D. Y. Ham, C. Y. Liang, A. Rahman, J. V. Gobburu, N.
Li, R. Sridhara, D. E. Morse, R. Lostritto, P. Garvey, J. R.
Johnson and R. Pazdur, “Pemetrexed in Malignant Pleural
Mesothelioma,” Clinical Cancer Research, Vol. 11, No. 3,
2005, pp. 982-992.
[8] R. Zhao and I. D. Goldman, “Resistance to Antifolates,”
Oncogene, Vol. 22, No. 47, 2003, pp. 7431-7457.
[9] N. Hagner and M. Joerger, “Cancer Chemotherapy: Tar-
geting Folic Acid Synthesis,” Cancer Management and
Research, Vol. 2, 2010, pp. 293-301.
[10] J. Sigmond, H. H. Backus, D. Wouters, O. H. Temmink,
G. Jansen and G. J. Peters, “Induction of Resistance to the
Multitargeted Antifolate Pemetrexed (ALIMTA) in WiDr
Human Colon Cancer Cells Is Associated with Thymidy-
late Synthase Overexpression,” Biochemical Pharmacol-
ogy, Vol. 66, No. 3, 2003, pp. 431-438.
doi:10.1016/S0006-2952(03)00287-9
[11] D. B. Longley, P. R. Ferguson, J. Boyer, T. Latif, M.
Lynch, P. Maxwell, D. P. Harkin and P. G. Johnston, “Cha-
racterization of a Thymidylate Synthase (TS)-Inducible
Cell Line: A Model System for Studying Sensitivity to
TS- and Non-TS-Targeted Chemotherapies,” Clinical
Cancer Research, Vol. 7, No. 11, 2001, pp. 3533-3539.
[12] J. H. Kim, K. W. Lee, Y. Jung, T. Y. Kim, H. S. Ham, H.
S. Jong, K. H. Jung, S. A. Im, T. Y. Kim, N. K. Kim and
Y. J. Bang, “Cytotoxic Effects of Pemetrexed in Gastric
Cancer Cells,” Cancer Science, Vol. 96, No. 6, 2005, pp.
365-371. doi:10.1111/j.1349-7006.2005.00058.x
[13] H. Ozasa, T. Oguri, T. Uemura, M. Miyazaki, K. Maeno,
S. Sato and R. Ueda, “Significance of Thymidylate Syn-
thase for Resistance to Pemetrexed in Lung Cancer,”
Cancer Science, Vol. 101, No. 1, 2010, pp. 161-166.
doi:10.1111/j.1349-7006.2009.01358.x
[14] D. Zhang, N. Ochi, N. Takigawa, Y. Tanimoto, Y. Chen,
E. Ichihara, K. Hotta, M. Tabata, M. Tanimoto and K.
Kiura, “Establishment of Pemetrexed-Resistant Non-Small
Cell Lung Cancer Cell Lines,” Cancer Letters, Vol. 309,
No. 2, 2011, pp. 228-235.
doi:10.1016/j.canlet.2011.06.006
[15] Y. Wang, R. Zhao and I. D. Goldman, “Decreased Ex-
pression of the Reduced Folate Carrier and Folypolyglu-
tamate Synthetase Is the Basis for Acquired Resistance to
the Pemetrexed Antifolate (LY231514) in an L1210 Mur-
ine Leukemia Cell Line,” Biochemical Pharmacology,
Vol. 65, No. 7, 2003, pp. 1163-1170.
doi:10.1016/S0006-2952(03)00007-8
[16] Q. Zhang, Y. P. Zhao, Q. Liao, Y. Hu, Q. Xu, L. Zhou
and H. Shu, “Associations between Gene Polymorphisms
of Thymidylate Synthase with Its Protein Expression and
Chemosensitivity to 5-Fluorouracil in Pancreatic Carci-
noma Cells,” Chinese Medical Journal (English Edition),
Vol. 124, No. 2, 2011, pp. 262-267.
[17] K. Kawakami and G. Watanabe, “Identification and Func-
tional Analysis of Single Nucleotide Polymorphism in the
Tandem Repeat Sequence of Thymidylate Synthase Gene,”
Cancer Research, Vol. 63, No. 18, 2003, pp. 6004-6007.
[18] N. Nief, V. Le Morvan and J. Robert, “Involvement of
Gene Polymorphisms of Thymidylate Synthase in Gene
Expression, Protein Activity and Anticancer Drug Cyto-
toxicity Using the NCI-60 Panel,” European Journal of
Cancer, Vol. 43, No. 5, 2007, pp. 955-962.
doi:10.1016/j.ejca.2006.12.012
[19] M. Gusella and R. Padrini, “G>C SNP of Thymidylate
Synthase with Respect to Colorectal Cancer,” Pharma-
cogenomics, Vol. 8, No. 8, 2007, pp. 985-996.
doi:10.2217/14622416.8.8.985
[20] L. A. Hammond-Thelin, M. B. Thomas, M. Iwasaki, J. L.
Abbruzzese, Y. Lassere, C. A. Meyers, P. Hoff, J. de Bo-
no, J. Norris, H. Matsushita, A. Mita and E. K. Rowinsky,
“Phase I and Pharmacokinetic Study of 3’-C-ethynyl-
Copyright © 2013 SciRes. JCT
The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells
Copyright © 2013 SciRes. JCT
1059
cytidine (TAS-106), an Inhibitor of RNA Polymerase I, II
and III, in Patients with Advanced Solid Malignancies,”
Investigational New Drugs, Vol. 30, No. 1, 2012, pp.
316-326. doi:10.1007/s10637-010-9535-y
[21] B. Friday, Y. Lassere, C. A. Meyers, A. Mita, J. L. Ab-
bruzzese and M. B. Thomas, “A Phase I Study to Deter-
mine the Safety and Pharmacokinetics of Intravenous Ad-
ministration of TAS-106 Once per Week for Three Con-
secutive Weeks Every 28 Days in Patients with Solid Tu-
mors,” Anticancer Research, Vol. 32, No. 5, 2012, pp.
1689-1696.
[22] S. Tabata, M. Tanaka, A. Matsuda, M. Fukushima and T.
Sasaki, “Antitumor Effect of a Novel Multifunctional An-
titumor Nucleoside, 3’-Ethynylcytidine, on Human Can-
cers,” Oncology Reports, Vol. 3, No. 6, 1996, pp. 1029-
1034.
[23] M. Tanaka, S. Tabata, A. Matsuda, M. Fukushima, K.
Eshima and T. Sasaki, “Antitumor Effect and Mechanism
of a Novel Multifunctional Nucleoside, 3’-Ethynylnu-
cleoside, on Human Cancers,” Gan to Kagaku Ryoho, Vol.
24, No. 4, 1997, pp. 476-482.
[24] S. Tabata, M. Tanaka, Y. Endo, T. Obata, A. Matsuda and
T. Sasaki, “Anti-Tumor Mechanisms of 3’-Ethynyluridine
and 3’-Ethynylcytidine as RNA Synthesis Inhibitors: De-
velopment and Characterization of 3’-Ethynyluridine-Re-
sistant Cells,” Cancer Letters, Vol. 116, No. 2, 1997, pp.
225-231. doi:10.1016/S0304-3835(97)00188-2
[25] A. Matsuda, M. Fukushima, Y. Wataya and T. Sasaki, “A
New Antitumor Nucleoside, 1-(3-C-ethynyl-ß-D-ribo-pento-
furanosyl)cytosine (ECyd), Is a Potent Inhibitor of RNA
Synthesis,” Nucleosides Nucleotides, Vol. 18, No. 4-5,
1999, pp. 811-814. doi:10.1080/15257779908041568
[26] A. Azuma, A. Matsuda, T. Sasaki and M. Fukushima, “1-
(3-C-ethynyl-ß-D-ribo-pentofuranosyl)cytosine (ECyd, T-
AS-106)1: Antitumor Effect and Mechanism of Action,”
Nucleosides Nucleotides Nucleic Acids, Vol. 20, No. 4-7,
2001, pp. 609-619. doi:10.1081/NCN-100002337
[27] A. Matsuda and T. Sasaki, “Antitumor Activity of Sugar-
Modified Cytosine Nucleosides,” Cancer Science, Vol.
95, No. 2, 2004, pp. 105-111.
doi:10.1111/j.1349-7006.2004.tb03189.x
[28] D. Murata, Y. Endo, T. Obata, K. Sakamoto, Y. Syouji,
M. Kadohira, A. Matsuda and T. Sasaki, “A Crucial Role
of Uridine/Cytidine Kinase 2 in Antitumor Activity of 3’-
Ethynyl Nucleosides,” Drug Metabolism and Disposition,
Vol. 32, No. 10, 2004, pp. 1178-1182.
doi:10.1124/dmd.104.000737