The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells

doi:10.4236/jct.2013.46119

Paper Menu >>

Journal Menu >>

Journal of Cancer Therapy, 2013, 4, 1052-1059

http://dx.doi.org/10.4236/jct.2013.46119 Published Online August 2013 (http://www.scirp.org/journal/jct)

The Role of Thymidylate Synthase in

Pemetrexed-Resistant Malignant

Pleural Mesothelioma Cells

Tohru Obata*, Motohiro Tanaka, Yuka Suzuki, Takuma Sasaki

Laboratory of Bioorganic Chemistry, School of Pharmacy, Aichi Gakuin University, Nagoya, Japan.

Email: *[email protected]

Received May 15th, 2013; revised June 18th, 2013; accepted June 25th, 2013

which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

ABSTRACT

We established new pemetrexed-resistant cells originating from malignant pleural mesothelioma MSTO-211H cells to

clarify the mechanism involved in pemetrexed resistance in malignant pleural mesothelioma. In the pemetrexed-resis-

tant cells, only thymidylate synthase (TYMS) mRNA was overexpressed among other well-known molecular targets and

chemosensitivity determinants of pemetrexed, and the role of the TYMS gene was ascertained by artificial regulation

induced by specific siRNA. Silencing the TYMS expression partially restored the cytotoxicity of pemetrexed. The resis-

tant cells did not display other gene alterations related to folate metabolism. We conclude that the primary mechanism

imparting resistance to these cells is specific up-regulation of TYMS function. Further, the TYMS gene may serve as a

useful biomarker for the prediction of pemetrexed chemosensitivity in patients with malignant pleural mesothelioma.

We also investigated the efficacy of 1-(3-C-ethynyl-ß-D-ribo-pentofuranosyl)cytosine (ECyd) in overcoming pemetrex-

ed resistance; this compound is presently undergoing clinical trials in the USA as TAS-106. ECyd had a similar antitu-

mor effect on the resistant cells as that on the parental cells. In the clinical treatment of malignant pleural mesothelioma,

ECyd promises to emerge as a novel drug.

Keywords: Malignant Pleural Mesothelioma; Thymidylate Synthase; Pemetrexed; ECyd

1. Introduction

Malignant pleural mesothelioma is considered to be caused

by previous exposure to asbestos fibers [1-3]. Regardless

of the stage at diagnosis, it is generally viewed as a treat-

ment-resistant tumor having poor prognosis [4] owing to

serious difficulties, including the availability of effective

drugs. Until recently, although no chemotherapeutic agent

was effective against malignant pleural mesothelioma, in

2004, the Food and Drug Administration (FDA) ap-

proved administration of pemetrexed in combination with

cisplatin for the treatment of patients whose condition is

unresectable or who are otherwise not candidates for cu-

rative surgery [5]. Pemetrexed is an antifolate drug that

targets some folate enzymes [5,6]; this drug is initially

transported into the cytoplasm by reduced folate carrier

(RFC) and other transporters and then metabolized to a

polyglutamated form by folypoly-gamma-glutamate syn-

thetase (FPGS). Polyglutamation increases cellular reten-

tion and confers an affinity for some enzymes involved

in folate metabolism. Pemetrexed and its polyglutamated

derivatives inhibit thymidylate synthase (TYMS), dihy-

drofolate reductase (DHFR), and glycinamide ribonu-

cleotide transformylase (GARFT), all of which are in-

volved in the de novo biosynthesis of thymidine and pu-

rine nucleotides. Antimetabolite agents, including peme-

trexed, induce an imbalance in the cellular nucleotide

pool and inhibit nucleic acid biosynthesis that results in

arresting the proliferation of tumor cells and inducing

cell death [5-7].

In pemetrexed-resistant cells, TYMS overexpression is

one of the major factors leading to resistance [8] and the

regulation of DHFR, RFC, and FP GS expression is asso-

ciated with acquired resistance to pemetrexed [8,9]. These

resistance mechanisms have been investigated in the co-

lon [10], breast [11], gastric [12], small cell lung cancer

[13], non-small cell lung cancer [14], and leukemia cell

lines [15]. These tumor types had not been recognized by

FDA. In this study, we have newly established peme-

*Corresponding author.

The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells 1053

trexed-resistant malignant pleural mesothelioma cells

from MSTO-211H cells and studied its resistant mecha-

nisms against pemetrexed. Further, we also examined the

efficacy of 1-(3-C-ethynyl-ß-D-ribo-pentofuranosyl)cyto-

sine (ECyd) against malignant pleural mesothelioma in

overcoming the established resistance.

2. Materials and Methods

2.1. Drugs and Tumor Cells

1-(3-C-Ethynyl-ß-D-ribo-pentofuranosyl)cytosine (ECyd,

TAS-106) was provided by TAIHO Pharmaceutical (To-

kyo, Japan), while pemetrexed was purchased from To-

ronto Research Chemicals (North York, Canada). Human

mesothelioma MSTO-211H cells were purchased from

the American Type Culture Collection (ATCC, Manassas,

VA, USA). The resistant cell line (H/pemetrexed) was

established by a stepwise drug increase method. Both

parental and resistant cell lines were maintained at 37˚C

and 5% CO2 in RPMI-1640 medium supplemented with

10% heat-inactivated fetal bovine serum (FBS) and 1%

penicillin-streptomycin (Life Technologies, Carlsbad,

CA, USA).

2.2. Drug Sensitivity Test

The growth-inhibitory effects of the drugs on human

tumor cells were examined using a colorimetric assay

involving 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetra-

zolium bromide (MTT). Briefly, 190-µl aliquots of an

exponentially growing cell suspension (1000 cells/190

µl/well) were incubated with 10 µl of varying concentra-

tions of drugs. After exposure to the drugs for 48 - 72 h,

20 µl of MTT solution (3 mg/ml) was added to each well

and the cell cultures were incubated at 37˚C for 4 h. Af-

ter removal of the medium, the formed formazan was dis-

solved in 200 µl of dimethyl sulfoxide. The absorbance

of each well was measured at 570 nm with an immuno-

reader (MTP-800AFC, CORONA Electric, Hitachinaka,

Japan), and the inhibition ratio (IR) was calculated using

the following formula: IR (%) = (1 − T/C) × 100, where

C is the mean of optical densities of the control group

and T of the treatment group. The IC50 value was defined

as the concentration of the drug needed to effect a 50%

reduction in growth relative to the control. The IC50 value

was determined by a graphical correlation of the dose-

response curve with at least three drug concentration

points.

2.3. siRNA Transfection

All small-interfering RNAs (siRNAs) were purchased

from Stealth RNAi (Life Technologies). The sequences

of three siRNAs (TYMS-1 to -3) targeting TYMS gene

(NM_001071) were

5’-GCTGTGGTTTATCAAGGGATCCACA-3’

(403 - 427),

5’-GGGAGATGCACATATTTACCTGAAT-3’

(895 - 919), and

5’-CAGAGATATGGAATCAGATTATTCA-3’

(577 - 919), respectively. Stealth RNAi glyceraldehyde-

3-phosphate dehydrogenase (GAPDH) Positive Control

(Life Technologies) and Stealth RNAi Negative Control

(Low GC Duplex #2; Life Technologies) were served as

a control. Upon preincubation at 37˚C for 24 h, cells in

35-mm dishes were transfected with 250 pmol siRNA

using lipofectamine 2000 (Life Technologies) following

the manufacturer’s protocol. Cells were treated with the

transfection agent/siRNA complex for 24 h and subjected

to further analysis.

2.4. Quantization of mRNA Expression

The cells were washed with PBS (−) and then total RNA

was extracted using ISOGEN (Nippon Gene, Osaka, Ja-

pan) according to the manufacturer’s instructions. The

concentration of the total extracted RNA was determined

by measuring the OD at 260 nm, and the RNA was di-

luted to 200 µg/ml. First strand cDNA synthesis was car-

ried out using 2 µg of total RNA, 5 pmol oligo (dT) 12 -

18 (GE Healthcare, Buckinghamshire, UK) and Re-

veTraAce (TOYOBO, Osaka, Japan) at 42˚C for 90 min.

cDNA prepared by the reverse transcription reaction was

subjected to PCR amplification in a Thermal Cycler Dice

Real-Time System (Takara Bio, Shiga) with SYBR Green

PCR Master Mix (Takara Bio, Japan) using specific

primers (Table 1). The expression of the target genes

was standardized using the regular housekeeping genes

[ribosomal protein large P2 (RPLP2), ribosomal protein

S18 (RPS18), phosphoglycerate kinase 1 (PGK1), and

beta-actin (ACTB)], and the relative expression levels

were quantified by using the 2-ΔΔCT method.

2.5. Establishment of TYMS-Overexpressing

Tumor Cell Line

Cells were transfected with the TYMS gene to clarify and

understand the effect of the drugs on TYMS function.

Human TYMS was overexpressed by PCR amplification

of the full coding sequence of human TYMS cDNA using

the sense primer 5’-ATGCCTGTGGCCGGCTCGGA-3’

and the antisense primer

5’-ATATCCTTCGAGCTCCTTTG-3’. The TYMS

cDNA was cloned into the pEF6/V5-His TOPO vector

(Life Technologies) to construct pEF6/TYMS. This plas-

mid was transfected into the MSTO-211H cells by using

the FuGENE 6 transfection reagent (Roche Diagnostics,

Indianapolis, IN, USA) according to the manufacturer’s

instructions. The transfectants were grown in a cultured

medium containing 500 µg/ml blasticidin S. Blasticidin-

The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells

1054

Table 1. Primers used in real-time PCR.

Gene name GenBankacc No.

Symbol

Forward primer Reverse primer

thymidylate synthetase NM_001071.2

TYMS ATCATCATGTGCGCTTGGAATC TGTTCACCACATAGAACTGGCAGAG

dihydrofolate reductase NM_000791.3

DHFR AGGGTTGGTTAGGCAATCATTC AGGATTTAGCTCTTACACCATCACA

gamma-glutamyl hydrolase NM_003878.2

GGH AACCTCTGACTGCCAATTTCCATAA TCTCTGGATGCCACTGGACAC

phosphoribosylglycinamideformyltransferase transcript variant 1 NM_000819.3

GART_v1

CATAGCAATGGATTTAGCCTTGTGA GCTGTAGATTCTGGTAGGCGTGAG

phosphoribosylglycinamideformyltransferase transcript variant 2 NM_175085.2

GART_v2

ATGGACTGCTCTGCACATCTCTG AGTGCCTGCATGGAACACCTC

folylpolyglutamate synthase transcript variant 1 NM_004957.4

FPGS_v1

TCTGCCCTAACCTGACAGAGGTG TCGTCCAGGTGGTTCCAGTG

folylpolyglutamate synthase transcript variant 2 NM_001018078.1

FPGS_v2

TCTGCCCTAACCTGACAGAGGTG TCGTCCAGGTGGTTCCAGTG

solute carrier family 19 (folate transporter) member 1 transcript variant 1 NM_194255.1

SLC19A1 ACTTTCATTGTCTCGGACGTG GTAGATGATGGACAGGATCAGGA

solute carrier family 46 member 1 (folate transporter) NM_080669.3

SLC46A1 CCGCAGCTTAAAGCAGTCACAA CAGCACCTGCCTGGCTACAA

ribonucleotide reductase M1 NM_001033.3

RRM1 GAGCAGGGCCCATACGAAAC CCCAGGATCTGAGCAGTGGAA

ribonucleotide reductase M2, transcript variant NM_001034.1

RRM2 TGATGTTCAAACACCTGGTACACAA AACCCAGTTCCAGCATAAGTCTGTC

ribonucleotide reductase M2B (TP53 inducible) transcript variant 1 NM_015713.3

RRM2B AATGATAAAGCTGCAGATGGGCTAA AATTCTGTGCCATTCATCCAGATTC

resistant cells were isolated and designated as MSTO/

TYMS. The empty vector pEF6 was also transfected into

the MSTO-211H cells to generate control cells, which

were designated as MSTO/Mock.

2.6. Western Blot Analysis for Protein

Expression of Human TYMS

Cell lysates were prepared in CelLytic-M reagent

(Sigma-Aldrich, St. Louis, MO, USA) containing 10%

Protease Inhibitor Cocktail (Sigma-Aldrich). Protein

samples were mixed with a loading buffer [50 mMTris-

HCl (pH 6.5), 10% glycerol, 2% sodium dodecyl sulfate

(SDS), 0.1% bromophenol blue, and 40 mM dithiothrei

tol] and electrophoresed on a 10% - 20% gradient SDS-

poly-acrylamide gel (mini-quick gel, Anatech, Tokyo,

Japan) after which the proteins were transferred to a

polyvinylidene difluoride membrane filter (Immobilon;

Millipore, Bedford, MA, USA). The membrane was

blocked in TBS-Tween containing 5% blocking agent

(GE Healthcare) for 1 h and then probed with the mouse

monoclonal antibody to TYMS (ab3145, Abcam, Cam-

bridge, UK) or with rabbit polyclonal antibody to ß-actin

(ab8227, Abcam) for 2 h at room temperature. Horserad-

ish peroxidase-conjugated anti-mouse IgG antibody or

anti-rabbit IgG antibody (GE Healthcare) was used for

the detection with enhanced chemiluminescence detec-

tion reagent (GE Healthcare). Chemiluminescence was

detected by LAS-3000 (Fuji Film, Tokyo, Japan).

3. Results

3.1. Establishment of Pemetrexed-Resistant Cells

Originating from Malignant Pleural

Mesothelioma

The MSTO-211H cells were initially cultured with 1 nM

pemetrexed. Incremental increase in the concentration of

The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells 1055

pemetrexed during logarithmic cell growth allowed the

determination of maximum growth rate, and eventually,

the cells were grown in the culture medium containing

0.1 µM pemetrexed. The dose-response curves for pe-

metrexed exposed to parental MSTO-211H cells and

resistant cells (H/pemetrexed) are presented in Figure 1.

The IC50 value of the H/pemetrexed cells was estimated

to be over 100 times that of the parental cells.

3.2. Comparison of the Expression of Related

Genes during Folate Metabolism

Expression of several typical genes related to pemetrexed

chemosensitivity was measured by real-time PCR, and

the TYMS mRNA expression (32.9 ± 9.7 times) was

found to be significantly increased in H/pemetrexed

cells (Figure 2(a)). The expression of DHFR, gamma-

glutamyl hydrolase (GGH), ribonucleotide reductase M1

(RRM1), and ribonucleotide reductase M2B (RRM2B)

genes also increased slightly in the H/pemetrexed cells

(3.2 to 4.6-fold, statistically insignificant). On the other

hand, the expression of solute carrier family 19 member

(SLC19A) mRNA, which is one of the folate transporters,

was significantly reduced compared to the parental cells

(0.53 ± 0.05 times). Overexpression of the TYMS protein

was also confirmed by western blot analysis (Figure

2(b)).

3.3. Drug Sensitivity to Assess the Effect of

Transfection with siRNA Targeted to the

TYMS Gene

Intracellular mRNA expression can be downregulated by

specific siRNA. All three TYMS siRNAs, which targeted

independent sequences within the TYMS coding region,

effectively induced downregulation of the intracellular

Figure 1. Chemosensitivity in pemetrexed-resistant cells

originating from malignant pleural mesothelioma. Dose-

response curves for pemetrexed in MSTO-211H cells (clos-

ed circles) and in H/pemetrexed cells (open circles). Con-

tinuous exposure to variable concentrations of pemetrexed

applied for 72 h. Each point was plotted as an average of

easily three independent experiments.

TYMS mRNA expression by over 80% in H/pemetrexed

and MSTO-211H cells (Figure 3). Control siRNA, tar-

geted towards the GAPDH gene, also specifically down-

regulated the expression of GAPDH mRNA. Each

siRNA had an effect exclusively on the expression of its

specific target gene in both the cells. The cells treated

with siRNA were exposed to varying concentrations of

pemetrexed for 48 h after which their chemosensitivity

was evaluated. Pemetrexed was applied at two varying

concentrations, as each cell line possessed considerably

TYMS

DHFR

GGH

GART_v1

GART_v2

FPGS_v1

FPGS_v2

SLC19A

SLC46A1

RRM1

RRM2

RRM2B

RPLP2

RPS18

PGK1

ACTB

Relative expression

(vs. in MSTO-211H)

TYMS

-actin

MSTO-211H

H/pemetrexe

(a) (b)

Figure 2. Comparison of anti-folate metabolism genes be-

tween parental and resistant cells. (a) mRNA expression

was evaluated by real-time RT-PCR using the ΔΔCT

method normalized by housekeeping genes. *shows signifi-

cant difference from parental MSTO-211H cells by the

t-test (p < 0.01); (b) The level of TYMS protein in MSTO-

211H cells and H/pemetrexed cells as detected by the west-

ern blot analysis.

Figure 3. Quantization of mRNA expression in siRNA treat-

ed MSTO-211H and H/pemetrexed cells. Three TYMS siRNAs

were targeted for different TYMS gene sequences and tran-

sfected into MSTO-211H and H/pemetrexed cells. GAPDH

and negative siRNA were used as controls. mRNA expres-

sion was evaluated by quantitative real-time PCR. Upper

and lower graphs represent the expression of TYMS and

GAPDH mRNAs, respectively. Each expression fold was

calculated from the ratio of MSTO-211H cells treated with

negative siRNA.

The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells

1056

different chemosensitivity to pemetrexed. Treating the

parental cells with two siRNAs targeting TYMS (TYMS

−2 and −3) enhanced the antitumor activity (27 and 15%)

at 0.007 µM pemetrexed (Figure 4). Moreover, the effect

of TYMS siRNA was confirmed even in H/pemetrexed

cells that had overexpressed TYMS mRNA. In both cell

lines, siRNAs targeted at TYMS increased the cytotoxic-

ity of pemetrexed.

3.4. Reduction of Drug Sensitivity in Transfected

Cells with TYMS Expression Vector

In order to determine whether TYMS gene expression

was affected by pemetrexed sensitivity, the parental cells

were transfected with a TYMS expression vector. The

TYMS expression vector (pEF6/TYMS) was constructed

from pEF6/V5-His TOPO vector according to the given

protocol, and the constructed vector was transfected into

the MSTO-211H cells to establish stable TYMS overex-

pressed cells (MSTO/TYMS). The expression of TYMS

mRNA in these cells was confirmed by real-time PCR

(Figure 5) and the expression levels in the MSTO/

TYMS cells against parental MSTO-211H cells (21.9 ±

3.9 fold) was similar to that of H/pemetrexed cells. Pe-

metrexed chemosensitivity in the established MSTO/

TYMS cells was investigated (Figure 6) and found to be

reduced, having IC50 values higher than those of the pa-

rental or mock cells. Furthermore, a cross-resistance to

methotrexate (MTX) was also observed.

3.5. Antitumor Activity of ECyd against

Pemetrexed-Resistant Cells

The cytotoxicity of other antimetabolic drugs was inves

tigated for overcoming the high pemetrexed-resistance in

H/pemetrexed cells (Table 2). ECyd showed similar an-

titumor effect against both parental and resistant cells.

Figure 4. Effect of TYMS siRNA on cytotoxicity of pe-

metrexed in MSTO-211H and H/pemetrexed cells. MSTO-

211H and H/pemetrexed cells were exposed to 0.007 and

840 µM of pemetrexed for 48 h after transfection with spe-

cific siRNA. *shows significant difference from negative

siRNA treated cells by the t-test (p < 0.01).

Figure 5. mRNA expression in MSTO-211H cells trans-

fected with TYMS expression vector. MSTO-211H cells

transfected with TYMS expression vector were established

by a selection agent over a few weeks. The mRNA expres-

sion was evaluated by quantitative real-time PCR. Each ex-

pression fold was calculated by the ratio against MSTO-

211H cells. *shows significant difference from parental

MSTO-211H cells by the t-test (p < 0.01).

100

0.01 0.11

IR (%)

pemetrexed (µM)

(a)

100

0.01 0.1110

IR (%)

MTX (µM)

(b)

Figure 6. Inhibition of antitumor effect by transfection with

TYMS expression vector. The chemosensitivity of peme-

trexed and MTX is shown in MSTO-211H cells (open cir-

cles), MSTO/TYMS cells (closed circles) and MSTO/Mock

cells (open triangles).

The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells 1057

Table 2. Cytotoxicity profiles of antimetabolic drugs in

H/pemetrexed cells.

IC50 (µM)

Drug

MSTO-211H H/pemetrexed

Resistant

index*

Pemetrexed 0.067 8.70 130

MTX 0.012 0.066 5.67

5FU 7.46 13.7 1.84

ECyd 0.029 0.012 0.43

*Resistance index was calculated as a ratio of IC50 for resistant cells to IC50

for parental cells.

Since MTX had a similar mechanism as pemetrexed,

partial cross-resistance was observed in H/pemetrexed

cells. Additionally, 5FU had an equivalent antitumor ef-

fect, which was revealed even in H/pemetrexed cells.

4. Discussion

Although several pemetrexed-resistant cells originating

from colon, breast, gastric and non-small cell lung can-

cers and especially leukemia cell lines have already been

reported, there is no report of pemetrexed-resistance cells

from malignant pleural mesothelioma cell lines. Recently,

pemetrexed has been clinically approved against malign-

nant pleural mesothelioma, but continuous and repeated

treatment can result in resistance against permetrexed in

the future. We attempted to establish pemetrexed-resis-

tant cells originating from some malignant pleural meso-

thelioma cell lines in order to clarify the mechanism un-

derlying pemetrexed resistance in mesothelioma. Among

the cell lines tested, only the MSTO-211H cells could

acquire resistance against pemetrexed. Treatment of MS-

TO-211H cells with pemetrexed induced higher expres-

sion of TYMS mRNA compared to other mesothelioma

cell lines, such as NCI-H2452 and ACC-MESO-1. This

characteristic nature of MSTO-211H cells may contrib-

ute to the acquisition of high resistance against peme-

trexed.

Detailed pemetrexed-resistant mechanisms in H/pe-

metrexed cells were investigated by analyzing mRNA

expression, which were closely related to folate metabo-

lism. Remarkably, TYMS mRNA was expressed in H/

pemetrexed cells, and the expression of some genes, in-

cluding DH FR, GGH, and RR, increased slightly. The

main reason for pemetrexed-resistance in H/pemetrexed

cells was considered to be an up-regulation of the TYMS

function. However, contribution of the up-regulation of

DHFR, GGH, and RR genes in the elevated pemetrexed-

resistance could not be completely ruled out. The expres-

sion of SLC19A, a folate-transporter gene, decreased sig-

nificantly and there appeared to be a weak relationship

with pemetrexed resistance. Additionally, pemetrexed

may be specifically transported intracellularly via SLC

19A1 and not SLC46A1.

Single nucleotide polymorphism (SNP) in the 5’-UTR

of the TYMS gene is well known, and the tandem repeat

is related to the chemosensitivity of 5FU [16-19]. The

overexpression of TYMS mRNA could not be attributed

to SNP in the 5’-UTR, since the genomic polymorphisms

(3R type) among the parental and resistant cells were not

altered. Moreover, since the E2F of a transcription factor

resided within the promoter region of the TYMS gene, the

mRNA expression of the E2F family was investigated.

We observed that the expression of E2F family mRNA

was not upregulated in the H/pemetrexed cells. Therefore,

even though the activation mechanism of the TYMS gene

in H/pemetrexed cells has not yet been identified, the

TYMS gene is considered to be an important factor in the

acquisition of pemetrexed-resistance.

The TYMS gene was artificially regulated to clarify its

involvement in pemetrexed resistance. TYMS down-regu-

lation by specific siRNA partially restored the chemo-

sensitivity for pemetrexed in the parental and H/peme-

trexed cells. However, the effect of TYMS-1 siRNA on

pemetrexed chemosensitivity did not appear unexpect-

edly. Although TYMS-1 siRNA knocked down TYMS

mRNA, the chemosensitivity for pemetrexed in only the

parental MSTO-211H cells were similar to that treated

with control siRNA. Since TYMS mRNA expression in

MSTO-211H cells were steady at a lower level than that

in H/pemetrexed cells, the enhanced cytotoxic effect on

being treated with specific siRNA in MSTO- 211H cells

are plausible. On the other hand, MSTO/ TYMS cells,

which stably over-expressed TYMS mRNA, tended to be

resistant against pemetrexed and MTX. Even though the

expression level of TYMS mRNA in MSTO/TYMS cells

were over 20 times higher than that in MSTO-211H cells,

its resistance were weak relative to H/pemetrexed cells,

which similarly over-expressed TYMS mRNA. In H/pe-

metrexed cells, the expression of other genes, including

DHFR and GGH, increased slightly but not in MSTO/

TYMS cells. It was considered that the functions of DHFR

and GGH were partially related to acquisition of pe-

metrexed resistance in the MSTO-211H cells.

High resistance to an antitumor drug is a serious prob-

lem in chemotherapy. We have examined the cytotoxic-

ity of some antimetabolic drugs in H/pemetrexed cells

(Table 2) and found that these cells showed cross-resis-

tance to MTX, which had cellular metabolism and targets

similar to pemetrexed. Although 5FU targets the same

cellular factors as MTX, the chemosensitivity for 5FU in

H/pemetrexed cells were retained, suggesting that the

main target of 5FU in this cell line is not TYMS. It ap-

peared that the pyrimidine salvage pathway was more

prominent than in other cell lines. ECyd, having an anti-

tumor mechanism different from pemetrexed, was an

The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells

1058

effective drug even in pemetrexed-resistant cells. How-

ever, the mechanism of ECyd involves inhibition of RNA

biosynthesis, and ECyd has been considered a superior

antitumor nucleoside whose clinical trials are in progress

as TAS-106 in USA [20,21]. ECyd and pemetrexed be-

long to the same category as anti-metabolic drugs. How-

ever, their metabolic and activated pathways differ through

the pyrimidine and folate metabolic pathways, respec-

tively, bestowing ECyd with excellent antitumor activity

against many solid tumors [22-28]. Even in H/peme-

trexed cells, ECyd showed the same antitumor effect as

in MSTO-211H cells. Therefore, in the clinical treatment

of malignant pleural mesothelioma patients, ECyd may

be extremely useful as a promising second line drug. The

TYMS gene may be considered as a useful biomarker for

predicting pemetrexed chemosensitivity in malignant pleu-

ral mesothelioma patients.

REFERENCES

[1] M. Pistolesi and J. Rusthoven, “Malignant Pleural Meso-

thelioma: Update, Current Management, and Newer The-

rapeutic Strategies,” Chest, Vol. 126, No. 4, 2004, pp.

1318-1329. doi:10.1378/chest.126.4.1318

[2] M. E. Ramos-Nino, J. R. Testa, D. A. Altomare, H. I.

Pass, M. Carbone, M. Bocchetta and B. T. Mossman, “Cel-

lular and Molecular Parameters of Mesothelioma,” Jour-

nal of Cellular Biochemistry, Vol. 98, No. 4, 2006, pp.

723-734. doi:10.1002/jcb.20828

[3] B. W. Robinson and R. A. Lake, “Advances in Malignant

Mesothelioma,” New England Journal of Medicine, Vol.

353, No. 15, 2005, pp. 1591-1603.

doi:10.1056/NEJMra050152

[4] J. P. Steele and A. Klabatsa, “Chemotherapy Options and

New Advances in Malignant Pleural Mesothelioma,” An-

nals of Oncology, Vol. 16, No. 3, 2005, pp. 345-351.

doi:10.1093/annonc/mdi094

[5] M. Hazarika, R. M. White, J. R. Johnson and R. Pazdur,

“FDA Drug Approval Summaries: Pemetrexed (Alimta),”

Oncologist, Vol. 9, No. 5, 2004, pp. 482-488.

[6] S. Chattopadhyay, R. G. Moran and I. D. Goldman, “Pe-

metrexed: Biochemical and Cellular Pharmacology, Me-

chanisms, and Clinical Applications,” Molecular Cancer

Therapeutics, Vol. 6, No. 2, 2007, pp. 404-417.

doi:10.1158/1535-7163.MCT-06-0343

[7] M. Hazarika, R. M. White Jr., B. P. Booth, Y. C. Wang,

D. Y. Ham, C. Y. Liang, A. Rahman, J. V. Gobburu, N.

Li, R. Sridhara, D. E. Morse, R. Lostritto, P. Garvey, J. R.

Johnson and R. Pazdur, “Pemetrexed in Malignant Pleural

Mesothelioma,” Clinical Cancer Research, Vol. 11, No. 3,

2005, pp. 982-992.

[8] R. Zhao and I. D. Goldman, “Resistance to Antifolates,”

Oncogene, Vol. 22, No. 47, 2003, pp. 7431-7457.

[9] N. Hagner and M. Joerger, “Cancer Chemotherapy: Tar-

geting Folic Acid Synthesis,” Cancer Management and

Research, Vol. 2, 2010, pp. 293-301.

[10] J. Sigmond, H. H. Backus, D. Wouters, O. H. Temmink,

G. Jansen and G. J. Peters, “Induction of Resistance to the

Multitargeted Antifolate Pemetrexed (ALIMTA) in WiDr

Human Colon Cancer Cells Is Associated with Thymidy-

late Synthase Overexpression,” Biochemical Pharmacol-

ogy, Vol. 66, No. 3, 2003, pp. 431-438.

doi:10.1016/S0006-2952(03)00287-9

[11] D. B. Longley, P. R. Ferguson, J. Boyer, T. Latif, M.

Lynch, P. Maxwell, D. P. Harkin and P. G. Johnston, “Cha-

racterization of a Thymidylate Synthase (TS)-Inducible

Cell Line: A Model System for Studying Sensitivity to

TS- and Non-TS-Targeted Chemotherapies,” Clinical

Cancer Research, Vol. 7, No. 11, 2001, pp. 3533-3539.

[12] J. H. Kim, K. W. Lee, Y. Jung, T. Y. Kim, H. S. Ham, H.

S. Jong, K. H. Jung, S. A. Im, T. Y. Kim, N. K. Kim and

Y. J. Bang, “Cytotoxic Effects of Pemetrexed in Gastric

Cancer Cells,” Cancer Science, Vol. 96, No. 6, 2005, pp.

365-371. doi:10.1111/j.1349-7006.2005.00058.x

[13] H. Ozasa, T. Oguri, T. Uemura, M. Miyazaki, K. Maeno,

S. Sato and R. Ueda, “Significance of Thymidylate Syn-

thase for Resistance to Pemetrexed in Lung Cancer,”

Cancer Science, Vol. 101, No. 1, 2010, pp. 161-166.

doi:10.1111/j.1349-7006.2009.01358.x

[14] D. Zhang, N. Ochi, N. Takigawa, Y. Tanimoto, Y. Chen,

E. Ichihara, K. Hotta, M. Tabata, M. Tanimoto and K.

Kiura, “Establishment of Pemetrexed-Resistant Non-Small

Cell Lung Cancer Cell Lines,” Cancer Letters, Vol. 309,

No. 2, 2011, pp. 228-235.

doi:10.1016/j.canlet.2011.06.006

[15] Y. Wang, R. Zhao and I. D. Goldman, “Decreased Ex-

pression of the Reduced Folate Carrier and Folypolyglu-

tamate Synthetase Is the Basis for Acquired Resistance to

the Pemetrexed Antifolate (LY231514) in an L1210 Mur-

ine Leukemia Cell Line,” Biochemical Pharmacology,

Vol. 65, No. 7, 2003, pp. 1163-1170.

doi:10.1016/S0006-2952(03)00007-8

[16] Q. Zhang, Y. P. Zhao, Q. Liao, Y. Hu, Q. Xu, L. Zhou

and H. Shu, “Associations between Gene Polymorphisms

of Thymidylate Synthase with Its Protein Expression and

Chemosensitivity to 5-Fluorouracil in Pancreatic Carci-

noma Cells,” Chinese Medical Journal (English Edition),

Vol. 124, No. 2, 2011, pp. 262-267.

[17] K. Kawakami and G. Watanabe, “Identification and Func-

tional Analysis of Single Nucleotide Polymorphism in the

Tandem Repeat Sequence of Thymidylate Synthase Gene,”

Cancer Research, Vol. 63, No. 18, 2003, pp. 6004-6007.

[18] N. Nief, V. Le Morvan and J. Robert, “Involvement of

Gene Polymorphisms of Thymidylate Synthase in Gene

Expression, Protein Activity and Anticancer Drug Cyto-

toxicity Using the NCI-60 Panel,” European Journal of

Cancer, Vol. 43, No. 5, 2007, pp. 955-962.

doi:10.1016/j.ejca.2006.12.012

[19] M. Gusella and R. Padrini, “G>C SNP of Thymidylate

Synthase with Respect to Colorectal Cancer,” Pharma-

cogenomics, Vol. 8, No. 8, 2007, pp. 985-996.

doi:10.2217/14622416.8.8.985

[20] L. A. Hammond-Thelin, M. B. Thomas, M. Iwasaki, J. L.

Abbruzzese, Y. Lassere, C. A. Meyers, P. Hoff, J. de Bo-

no, J. Norris, H. Matsushita, A. Mita and E. K. Rowinsky,

“Phase I and Pharmacokinetic Study of 3’-C-ethynyl-

The Role of Thymidylate Synthase in Pemetrexed-Resistant Malignant Pleural Mesothelioma Cells

1059

cytidine (TAS-106), an Inhibitor of RNA Polymerase I, II

and III, in Patients with Advanced Solid Malignancies,”

Investigational New Drugs, Vol. 30, No. 1, 2012, pp.

316-326. doi:10.1007/s10637-010-9535-y

[21] B. Friday, Y. Lassere, C. A. Meyers, A. Mita, J. L. Ab-

bruzzese and M. B. Thomas, “A Phase I Study to Deter-

mine the Safety and Pharmacokinetics of Intravenous Ad-

ministration of TAS-106 Once per Week for Three Con-

secutive Weeks Every 28 Days in Patients with Solid Tu-

mors,” Anticancer Research, Vol. 32, No. 5, 2012, pp.

1689-1696.

[22] S. Tabata, M. Tanaka, A. Matsuda, M. Fukushima and T.

Sasaki, “Antitumor Effect of a Novel Multifunctional An-

titumor Nucleoside, 3’-Ethynylcytidine, on Human Can-

cers,” Oncology Reports, Vol. 3, No. 6, 1996, pp. 1029-

1034.

[23] M. Tanaka, S. Tabata, A. Matsuda, M. Fukushima, K.

Eshima and T. Sasaki, “Antitumor Effect and Mechanism

of a Novel Multifunctional Nucleoside, 3’-Ethynylnu-

cleoside, on Human Cancers,” Gan to Kagaku Ryoho, Vol.

24, No. 4, 1997, pp. 476-482.

[24] S. Tabata, M. Tanaka, Y. Endo, T. Obata, A. Matsuda and

T. Sasaki, “Anti-Tumor Mechanisms of 3’-Ethynyluridine

and 3’-Ethynylcytidine as RNA Synthesis Inhibitors: De-

velopment and Characterization of 3’-Ethynyluridine-Re-

sistant Cells,” Cancer Letters, Vol. 116, No. 2, 1997, pp.

225-231. doi:10.1016/S0304-3835(97)00188-2

[25] A. Matsuda, M. Fukushima, Y. Wataya and T. Sasaki, “A

New Antitumor Nucleoside, 1-(3-C-ethynyl-ß-D-ribo-pento-

furanosyl)cytosine (ECyd), Is a Potent Inhibitor of RNA

Synthesis,” Nucleosides Nucleotides, Vol. 18, No. 4-5,

1999, pp. 811-814. doi:10.1080/15257779908041568

[26] A. Azuma, A. Matsuda, T. Sasaki and M. Fukushima, “1-

(3-C-ethynyl-ß-D-ribo-pentofuranosyl)cytosine (ECyd, T-

AS-106)1: Antitumor Effect and Mechanism of Action,”

Nucleosides Nucleotides Nucleic Acids, Vol. 20, No. 4-7,

2001, pp. 609-619. doi:10.1081/NCN-100002337

[27] A. Matsuda and T. Sasaki, “Antitumor Activity of Sugar-

Modified Cytosine Nucleosides,” Cancer Science, Vol.

95, No. 2, 2004, pp. 105-111.

doi:10.1111/j.1349-7006.2004.tb03189.x

[28] D. Murata, Y. Endo, T. Obata, K. Sakamoto, Y. Syouji,

M. Kadohira, A. Matsuda and T. Sasaki, “A Crucial Role

of Uridine/Cytidine Kinase 2 in Antitumor Activity of 3’-

Ethynyl Nucleosides,” Drug Metabolism and Disposition,

Vol. 32, No. 10, 2004, pp. 1178-1182.

doi:10.1124/dmd.104.000737