Journal of Environmental Protection, 2010, 1, 362-373
doi:10.4236/jep.2010.14042 Published Online December 2010 (http://www.SciRP.org/journal/jep)
Copyright © 2010 SciRes. JEP
Cytochrome P450 Induction and Gene Expression
in Channel Catfish (Ictalurus punctatus) Following
Wastewater Treatment Plant Effluent Exposure in
Field and Laboratory Settings
Alicia Whatley1*, In Ki Cho1, Christi Magrath1, Paul M. Stewart1, Robert W. Li2
1Department of Biological and Environmental Sciences, Troy University, Troy, USA; 2Bovine Functional Genomics Laboratory,
USDA, Beltsville, USA.
Received July 16th, 2010; revised August 26th, 2010; accepted August 30th, 2010.
ABSTRACT
The objectives of this study were as follows: 1) to establish a baseline ethoxyresorufin-O-deethylase (EROD) activity
level in channel catfish (Ictalurus punctatus), 2) to assess changes in induction of cytochrome P450 enzyme in channel
catfish following exposure to creek water at the discharge point from the Troy (Alabama) Wastewater Treatment Plant
(TWWTP) compared to upstream samples from Walnut Creek, 3) to compare EROD activity in populations maintained
in laboratory and field settings, and 4) to quantify cytochrome P450 gene expression. Enzyme activity was measured
fluorometrically and CYP1 gene expression was analyzed by quantitative real-time reverse transcription polymerase
chain reaction. A mean EROD baseline was established at 0.03 nmol/min/µg of protein. The overall mean field effluent
(TF) EROD had a significant 5-fold increase over field upstream (UF) exposed catfish; and overall mean laboratory
effluent (TL) exposed catfish EROD had a significant 1.8-fold increase over laboratory upstream (UL) exposed catfish.
Field exposures generally showed more robust enzyme induction over laboratory exposures on all sampling days. Ex-
pression of the CYP1B gene following TF exposure was 6-fold over UF. Results suggested that in situ exposure to
wastewater pollutants using caged test organisms provided a much more sensitive local monitor of pollutant exposure
and biological impact than ex situ toxicological studies.
Keywords: EROD, CYP1B, Molecular Biomarker, Channel Catfish, Liver Monooxygenases, MFO
1. Introduction
Measurements of molecular biomarkers are useful for
determining the impact of water-borne contaminants on
living organisms in the aquatic environment. The use of
biomarkers also addresses some of the disadvantages of
other water quality assessment techniques, such as the
ineffectiveness of chemical and physical analyses to deal
with dilution and dispersion of chemicals in the ambient
environment that reduce concentrations below analytical
detection limits [1]. Since the ambient environment may
also alter the availability of chemicals for uptake by liv-
ing organisms [2], the complexity of chemical mixtures,
distribution, and interactions with other environmental
factors makes it difficult to estimate the impacts of pol-
lutants on living organisms. Although the problem with
mixtures may be addressed through use of bioassess-
ments, these studies primarily examine a single end point,
such as reproduction, lethality (as LC50), and behavioral
changes; and while these are clearly defined and fre-
quently used, they may be inadequate in terms of sensi-
tivity, duration, and accuracy [3]. Because of their fo-
cus on the toxicity of pollutants [4], bioassessments may
miss subtle metabolic changes that can be picked up by
molecular biomarkers.
One important and useful molecular biomarker is in-
duction of cytochrome P450 (CYP1) enzyme, measured
as ethoxyresorufin-O-deethylase (EROD) activity, which
is involved in metabolism of a variety of drugs and xe-
nobiotics, such as polycyclic chlorinated biphenyls
(PCBs) [5] and polycyclic aromatic hydrocarbons (PAHs)
This article is sponsored by a Troy University Faculty Development
t
Cytochrome P450 Induction and Gene Expression in Channel Catfish (Ictalurus punctatus) Following Wastewater
Treatment Plant Effluent Exposure in Field and Laboratory Settings
Copyright © 2010 SciRes. JEP
363
[6], in higher eukaryotic organisms. Since the CYP1 en-
zyme is involved in Phase I metabolism of xenobiotics in
an organism, it can rapidly respond to the presence of
xenobiotics [2]. Induction of CYP1 and EROD activity in
fish are well-known indicators of exposure to chemical
pollutants.
At present, many issues are still involved in predicting
the impact of contaminants in natural environments, in-
cluding 1) determining biomarker levels in situ doesn’t
necessarily identify the causative agents; 2) sufficient
numbers of exposed organisms might not be available at
the field site; 3) reference sites are not always as “clean”
as desired; and 4) the difficulty of distinguishing back-
ground from exposure effects. Although laboratory mi-
crocosms and mesocosms are attempts to address these
issues, it is impossible to replicate the actual in situ ex-
posure conditions.
Few studies have been concerned with domestic waste
water EROD induction [7]. In addition, only a few stud-
ies have compared results for EROD induction following
exposure to the same wastewater effluent in both field
and laboratory settings. For example, Munkittrick et al.
[8] measured EROD induction in white sucker (Ca-
tostomus commersoni) following in situ and ex situ ex-
posure to treated paper mill effluent, but failed to main-
tain constant testing conditions such as water chemistry
and duration of exposure for both exposures. Munkittrick
et al. [8] did, however, reference unpublished research
where a 300-fold higher EROD activity was found in in
situ caged rainbow trout compared to ex situ exposure to
WWTP effluent. These results suggest that there were
significant differences in the water quality in the field
compared to the laboratory. Therefore, the issue remains
as to whether controlled laboratory studies are adequate
predictors of EROD induction in the field.
The City of Troy (Alabama) Wastewater Treatment
Plant (TWWTP) treats wastewater to the secondary level
before it discharges into Walnut Creek under a National
Pollutant Discharge Elimination System (NPDES) permit
issued by the Alabama Department of Environmental
Management (ADEM) [9]. Walnut Creek is a tributary to
the Choctawhatchee River and is classified for fish and
wildlife use [10]. The “fish and wildlife” classification is
given to a water body that can support aquatic life, but is
not suitable for human consumption as drinking water
[10]. In a 1997 monitoring study by ADEM, Walnut
Creek downstream of the TWWTP showed increased
concentrations of chloride, zinc, nutrients, and diazinon.
Significant levels of some chemicals, such as lead and
diazinon, exceeded acute and chronic toxicity levels [11].
Variables, such as total alkalinity, hardness, total dis-
solved solids, and conductivity, had increased concentra-
tions downstream of the TWWTP when compared to
water upstream of the facility. Based on chemical water
quality, macroinvertebrate indices, and results of short
term and chronic studies using Ceriodaphnia dubia,
Walnut Creek downstream of the TWWTP has been
characterized as moderately impaired [10].
Previous laboratory research done at Troy University
with channel catfish examined the levels of EROD activ-
ity following exposures to different water samples. These
samples included water from upstream of the TWWTP at
Walnut Creek, from the mixing zone of the TWWTP at
Walnut Creek, as well as water from a supposed refer-
ence site [12,13]. Exposure to mixing zone water sig-
nificantly induced (more than three-fold) EROD activity
in channel catfish over upstream water exposure; how-
ever, greater mortality was observed in fish exposed to
upstream water. Although the cause of death was not
established, standard water quality parameters (bio-
chemical oxygen demand, pH, turbidity, phosphorus,
nitrates, total solids, electrical conductivity, hardness,
total alkalinity, and metals) in upstream water were less,
and in most cases significantly less, than in water from
the TWWTP mixing zone. With the exception of higher
suspended solids in water from the reference site over
water from Walnut Creek upstream, water quality at both
sites was the same. However, exposure to water from the
reference site induced more than two-fold EROD activity
in channel catfish over exposure to water from Walnut
Creek upstream. This study suggested that establishing a
baseline EROD level in catfish, as well as doing a con-
trolled comparison of laboratory versus field exposures
were necessary for adequate interpretation of future stu-
dies involving impact of TWWTP effluent on channel
catfish [12].
Catfish are an economic species with production rep-
resenting the largest segment of North American aqua-
culture [14]. Given the importance of catfish as a protein
source for humans, pollutant intake by catfish has both a
direct and indirect effect on human socio-economics and
health. The purpose of the current study was to evaluate
hepatic CYP1 induction and EROD activity in channel
catfish as a means to assess the environmental impact of
TWWTP effluent on Walnut Creek. The objectives of
this study were 1) to establish a baseline EROD level in
channel catfish, 2) to determine the level of EROD activ-
ity following exposures to TWWTP effluent, 3) to com-
pare EROD activity for in situ (field) and ex situ (labora-
tory) exposure conditions, and 4) to compare CYP1 gene
expression in relationship to EROD activity.
2. Materials and Methods
2.1. Exposure Conditions
The five exposure conditions for this study consisted of 1)
Cytochrome P450 Induction and Gene Expression in Channel Catfish (Ictalurus punctatus) Following Wastewater
Treatment Plant Effluent Exposure in Field and Laboratory Settings
Copyright © 2010 SciRes. JEP
364
Walnut Creek, 1.6 km upstream of the TWWTP in the
field (upstream field, UF); 2) Walnut Creek at the
TWWTP effluent mixing zone (treatment field, TF); 3)
water from Walnut Creek upstream in the laboratory (up-
stream lab, UL); 4) water from Walnut Creek at the
TWWTP effluent mixing zone in the laboratory (treat-
ment lab, TL); and 5) City of Troy dechlorinated tap wa-
ter in the laboratory (tap water, TP).
For in situ exposures, rectangular cages (0.9 m × 0.6 m
× 0.3 m) were constructed using 33.4 mm diameter poly-
vinyl chloride (PVC) piping covered with 9.5 mm plastic
mesh. Three cages were placed in the Walnut Creek
upstream site, and three cages were placed in Walnut
Creek at the TWWTP effluent mixing zone.
Forty-liter polypropylene tanks were used for ex situ
exposures (Troy University Laboratory), with three rep-
licates used for each exposure condition – Walnut Creek
upstream (UL), TWWTP effluent mixing zone (TL), and
dechlorinated tap water (TP) – for a total of nine tanks.
Sufficient quantities of Walnut Creek upstream water and
TWWTP effluent mixing zone water were transported to
the laboratory at the beginning of the study, and fresh
water from the field sites was replenished every three
days during the course of the study. Three days prior to
placing fish in exposure tanks, and at 3-day intervals, the
City of Troy tap water was dechlorinated by treating with
TetraAquaTM AquaSafe® water conditioner. Nine addi-
tional forty-liter polypropylene tanks were alternated
with the original tanks and filled with fresh water for the
three exposure conditions at 3-day intervals. Polypro-
pylene tanks were thoroughly washed and dried before
filling with water. Fish were netted and transferred to
respective tanks. Water in all tanks, including precon-
ditioned tap water, was aerated and recirculated continu-
ously without filtration.
2.2. Treatment of Animals and Sample
Preparation
Channel catfish fingerlings, of mean length 8.58 cm (1.4
SD) and mean weight 11.05 g (3.64 SD), were purchased
from Lake Geneva Fish Hatchery (Geneva, AL). Fifty
randomly selected channel catfish fingerlings were
placed in each tank or cage in laboratory and field loca-
tions respectively, with acclimation occurring during the
first three days of the study. In the laboratory, catfish
were maintained on a 12-hour daylight and 12-hour night
photoperiod and were fed ad libitum every three days
with floating catfish food pellets purchased from the
hatchery. In the field, three cages were placed at equal
intervals across Walnut Creek at the upstream and mix-
ing zone locations. Every three days catfish food pellets
were scattered in the cages and over the creek surface
where cages were placed.
Five fish were randomly netted from each tank and
cage on days 1, 3, 6, 9, and 13, and placed in separate
labeled containers. All collected fish were investigated
for any abnormalities and sacrificed with a blow to the
back of head. Fish were measured for total length and
total weight. Livers were excised, rinsed of blood in cold
buffer (0.15 M KCl), blotted dry with paper towels [15],
and weighed. The five livers collected from each indi-
vidual replicate cage or tank were pooled to form a single
sample, therefore each treatment/location had triplicates
made of five pooled catfish livers. A total of 75 fish or 15
pooled samples were collected on each sampling day.
Liver samples were divided into two parts (one half for
microsome preparation and one half for quantitative
real-time reverse transcription polymerase chain reac-
tion), put into centrifuge tubes, and immediately stored at
80 until needed for analysis. Fish were handled and
treated humanely as required by the Animal Research
Review Board, Troy University (Troy, AL).
2.3. Microsome Preparation
Microsomes were prepared as described by Burke and
Mayer [15], wherein each pooled liver sample was
placed in 4 ml cold homogenization buffer (0.05 M Tris -
0.15 M KCl; pH 7.8) per gram weight of liver tissue.
Samples were homogenized with two 5-second bursts of
the Sonic Dismembrator (Fisher model 100). The ho-
mogenates were centrifuged in a Sorvall® RC 26 Plus
centrifuge at 12,000 g at 4 for 15 minutes. The result-
ing supernatants were centrifuged at 100,000 g at 4 for
60 minutes to sediment microsomes (Beckman L8-80M
Ultracentrifuge, Beckman Coulter, Inc., Fullerton, CA).
Pellets were re-suspended in 1 ml re-suspension buffer
(0.1 M potassium phosphate, 0.5 mM DTT, 1 mM EDTA,
and 20% glycerol; pH 7.4). Ethylenediamine tetraacetic
acid (EDTA) was purchased from Fisher Scientific In-
ternational, Inc. (Fairlane, NJ) and dithiothreitol (DTT)
was purchased from Pierce Biotechnology (Rockford, IL).
Microsomal preparations were separated into two parts
(one half to be used for EROD analysis and one half for
protein analysis) and stored at 80 until the assays
were completed [16].
2.4. Protein and Enzyme Assays
The protein concentrations of microsomal preparations
were determined using the BCA™ Protein Assay Kit
(Pierce Inc., Rockford, IL) against bovine serum albumin
as the standard [17]. Microsomal preparations were di-
luted 10-fold in deionized-distilled water in order to re-
duce interference from the glycerol buffer [18]. Stan-
dards and samples were prepared and analyzed as de-
Cytochrome P450 Induction and Gene Expression in Channel Catfish (Ictalurus punctatus) Following Wastewater
Treatment Plant Effluent Exposure in Field and Laboratory Settings
Copyright © 2010 SciRes. JEP
365
scribed in the BCA™ Protein Assay Kit test tube proce-
dure using a BioPhotometer (Eppendorf Inc.) at a wave-
length of 562 nm (pre-set for BCA). Based on the stan-
dards curve, protein concentrations for each sample were
measured and read directly on the BioPhotometer.
Assessment of EROD activities induced under the five
exposure conditions were evaluated fluorometrically.
Samples and reagents were prepared according to the
procedure described by Chan [16]. Assay chemicals, 7-
ethoxyresorufin, resorufin sodium salt and nicotinamide
adenine dinucleotide phosphate hydrogenated (NADPH),
were purchased from Sigma Chemical Company (St.
Louis, MO), and Tris was purchased from Angus Buffers
and Biochemicals (Niagara Falls, NY). Reaction mix-
tures were prepared by mixing 20 µl of each microsomal
preparation with 150 µl of 2.67 µM 7-ethoxyresorufin
solution in TN buffer (50 mM Tris and 0.1 M NaCl; pH
of 7.8). The reaction was initiated in each mixture by
adding 40 µl of 5 mM NADPH in TN buffer. Triplicate
wells were prepared for each reaction mixture on 96-well
microplates (FalconTM), along with triplicate resorufin
standards in concentrations ranging from 2 to 200 nmol.
Fluorescence levels on microplates were measured on the
Cytofluor™ 2350 plate reader at an excitation wave-
length of 530 nm and emission wavelength of 590 nm at
two sensitivities (3 and 4) as described by Rice and Ros-
zell [18]. Microplates were scanned four times at 15
minute intervals.
The concentrations of resorufin in samples were de-
termined by 1) using the fluorescence measurements for
resorufin standards to construct a resorufin- fluorescence
curve and equation for the curve, 2) subtracting sample
blank fluorescence from sample fluorescence, and 3)
substituting these differences in the standards curve equ-
ation to calculate the amount of resorufin per minute in
each sample.
2.5. Quantitative Real-Time Reverse
Transcription Polymerase Chain Reaction
Since fluorometric analyses of liver samples showed sig-
nificant EROD induction for both field and laboratory
exposures to TWWTP effluent on day 9, samples for all
exposures on this day were selected for further analyses
of CYP1B gene expression using quantitative real-time
reverse transcription polymerase chain reaction at the U.
S. Department of Agriculture Bovine Functional Geno-
mics Laboratory (Beltsville, Maryland). Triplicate sam-
ples for each exposure were analyzed. Four additional
metabolism associated genes (metallothionein II, ferritin,
P450 aromatase, and superoxide dismutase 2) were ana-
lyzed, along with 18S ribosomal RNA as a control.
Liver samples were homogenized in TRIZOL® Re-
agent (Invitrogen Corporation, Carlsbad, CA) and treated
with 10 units of DNase I (Ambion Inc., Austin, TX) per
100 µg total RNA at 37. Total RNA was purified fol-
lowing the manufacturer’s instructions (Qiagen Inc., Va-
lencia, CA). The concentration of each total RNA sample
was determined using a NanoDrop ND-1000 spectro-
photometer (NanoDrop Technologies, Rockland, DE)
and adjusted at 110 ng/µl. Complementary DNA (cDNA)
was synthesized using an iScript™ cDNA Synthesis Kit
at 2 µg scale following the manufacturer’s instructions
(Bio-Rad Laboratories Incorporation, Hercules, CA).
Primer sequences (Table 1) for 18S (used as reference
gene), metallothionein II, ferritin, P450 aromatase, and
superoxide dismutase 2 were designed using Bio-Rad
primer design software. Primers (Table 1) specific for
the Ictalurus punctatus CYP1 gene were designed by
Oligonet (Gaithersburg, MD). Real-time RT-PCR analy-
sis was performed using an iQ™ SYBR® Green Super-
mix Kit (Bio-Rad) using 200 nM of each primer and first
strand cDNA (total input of RNA was equivalent to 100
ng) in a 25 µl reactionmixture. The iCycler iQ™ Real
Time PCR Detection System (Bio-Rad) was used: 95
60 sec; 40 cycles of 94–15 sec, 60–30 sec, and
72–30 sec. Relative gene expression data was cal- cu-
lated using the 2-ΔΔCT method [19]. Expression levels of
six genes were initially normalized to 18 s ribosomal
RNA expression within each sample, and 18 s ribosomal
RNA levels were within 0.5 Ct between samples.
2.6. Water Quality Analyses
Water temperature, percent dissolved oxygen, turbidity,
salinity, specific conductivity, dissolved oxygen, and pH
were measured for all exposures at field and laboratory
sites every three days throughout the study using the Hy-
drolab Quanta® (Hach Environmental Corp., Loveland,
CO).
Water samples were collected in acid-cleaned glass
jars from Walnut Creek upstream, Walnut Creek at the
TWWTP mixing zone, and dechlorinated tap water eve-
rythree days. Samples were stored in a refrigerator at 4
until they were transported, in a cooler on ice, to the
Auburn University Soil Testing Laboratory (Auburn, AL)
for analysis of metals, suspended solids, and electrical
conductivity.
2.7. Statistical Analyses
Daily and overall EROD activity results by treatment
were analyzed statistically by one-way analysis of vari-
ance (ANOVA) with Bonferroni correction for pairwise
comparisons. Results were considered to be significantly
different if α < 0.05. Gene expression for CYP1B was
Cytochrome P450 Induction and Gene Expression in Channel Catfish (Ictalurus punctatus) Following Wastewater
Treatment Plant Effluent Exposure in Field and Laboratory Settings
Copyright © 2010 SciRes. JEP
366
Table 1. Primer sequences for metabolism-associated genes.
Accession# Gene Forward Primer Reverse Primer
DQ088663 CYP1B CATCAACCAGTGGTCCCTGAA AGCGCAATGGGTTGAAGATC
AF087935 Metallothionein II TGCGAATGCTCCAAGACTG TCTTCACTGGCAGCACTTG
AF417239 P450 aromatase AGTCGTTTCTTCCAGCCATTC TACAGCCTTCATCATCACCATAG
DQ086198 Superoxide dismutase 2 CACATCAACCACACCATCTTC GACATCTTCTCCTTCATCTTCTG
CK404798 Ferritin CAGAGCGTGACGAGTGGGGCAG CAGAGCGTGACGAGTGGGGCAG
GQ465835 18s ribosomal RNA TGGTTAATTCCGATAACGAACGA CGCCACTTGTCCCTCTAAGAA
analyzed by one-way analysis of variance (ANOVA).
Groups were considered to be significantly different if α
< 0.05. Spearman’s correlation was used to compare
EROD activity, CYP1B expression, and LSI values. All
statistical tests and graphs were performed and generated
on the Statistical Package for the Social Sciences
(SPSSTM version 16.0, SPSS Inc., Chicago, IL.). Data are
represented as the mean ± standard error (SE).
3. Results
3.1. Hepatic EROD Activity
Resorufin and protein levels for pooled liver sample rep-
licates were used to determine hepatic EROD activity by
calculating the ratio of the concentration of resorufin per
minute to the amount of protein in liver samples (Figure
1). An elevated EROD activity was found for samples
collected on day zero (day experimental exposures set
up). These samples consisted of 15 catfish that were tak-
en after fish were obtained from the hatchery and im-
mediately prior to placement of fish in exposure condi-
tions. The EROD activities for catfish exposed to dechlo-
rinated tap water provided data to establish the baseline
channel catfish EROD of 0.030 nmol/min/µg of protein.
It should be noted that by day 3, catfish under all expo-
sure conditions had acclimated to their surroundings,
with EROD activity levels returning to that of the dech-
lorinated tap water baseline level of 0.030 nmol/min/µg
of protein. Some significant changes were found in daily
EROD activity (Figure 1). The maximum EROD activity
was found in the TF exposure group on day 13 (0.31
nmol/min/µg of protein). Noticeable EROD activeity
induction attributable to TF exposure started to appear on
day 6 with a 2.7-fold increase from day 3 to day 6, a
3.5-fold increase from day 6 to day 9, and 1.2-fold in-
crease from day 9 to day 13. Compared to the baseline
achieved on day 3, TF showed a 10.3-fold induction in
EROD activity by day 13. The level of EROD activity
peaked in the TL exposure group on day 9, showing a
2-fold increase over day 6. However, the activity level
for TL declined to the baseline level on day 13. Upon
comparing EROD activity between two exposure groups
(Table 2), TF showed significantly higher EROD active-
ity compared to UF on days 6, 9, and 13. The EROD acti-
vity for TL was significantly higher than UL on day 9.
The overall mean EROD activity (Figure 2) of fish
exposed to the TWWTP mixing zone (TF) was signifi-
cantly higher (p < 0.001) with a 5-fold increase over UF,
and the mean EROD activity of TL showed a signifi-
cantly higher EROD activity (p < 0.001) with 1.8-fold
increase compared to UL exposed catfish.
3.2. Quantitative Real-Time RT-PCR Results
The relative gene expression for channel catfish CYP1B
for five exposure groups taken on day 9 of the study are
shown (Table 3). The result of real-time RT-PCR, based
on day 9 EROD activities, found CYP1B expression in
TF was significantly higher than UF (p < 0.001) and TL
was significantly higher than UL (p < 0.001). The rela-
tive CYP1B gene expression for TF was 6-fold that of
UF. Expressions of four other metabolism related genes
(metallothionein II, ferritin, P450 aromatase, and super-
oxide dismutase 2) are also shown. While the products of
these genes may be involved in energy metabolism and
chemical detoxication, apart from CYP1B, the biological
significances of the levels found were not examined in
the current study.
3.3. Liver Appearance and LSI
Over time, livers from TF exposed fish were noticeably
larger and lighter in color than the livers from other ex-
posure conditions. Daily and overall mean liver somatic
indexes (LSI) were calculated by wet liver weight di-
vided by total wet body weight times 100 (Table 4).
Daily mean liver sizes within UF, UL, TL, and TP expo-
sure groups did not increase significantly through the
course of the study (p < 0.05). However, the LSI for TF
increased significantly from day 0 to day 13 (p = 0.004).
Cytochrome P450 Induction and Gene Expression in Channel Catfish (Ictalurus punctatus) Following Wastewater
Treatment Plant Effluent Exposure in Field and Laboratory Settings
Copyright © 2010 SciRes. JEP
367
Figure 1. Daily mean hepatic ethoxyresorufin-O-deethylase activity (EROD) for samples from channel
catfish exposed to Walnut Creek Upstream (UF) and Walnut Creek at the Troy Wastewater Treatment
Plant effluent mixing zone (TF) in the field setting, and Walnut Creek Upstream (UL), Walnut Creek at
Troy Wastewater Treatment Plant effluxent mixing zone (TL), and dechlorinated tap water (TP) in the
laboratory setting. Unexposed samples were taken after catfish were obtained from the hatchery and
prior to any study exposure conditions. Data represent the mean for three replicates (consisting of five
pooled livers) ± SE.
Figure 2. Overall mean hepatic EROD activity for channel catfish following exposure to five different
exposure conditions (UF, TF, UL, TL, and TP). Data represent the mean ± SE and are expressed as
nmol/min/µg of protein. Exposures sharing a common letter indicates a statistical significant difference
between means (ANOVA, p < 0.05).
Cytochrome P450 Induction and Gene Expression in Channel Catfish (Ictalurus punctatus) Following Wastewater
Treatment Plant Effluent Exposure in Field and Laboratory Settings
Copyright © 2010 SciRes. JEP
368
Table 2. Statistical comparisons using ANOVA of daily he-
patic ethoxyresorufin O-deethylase activity (EROD) (nmol/
min/µg protein) in channel catfish following exposure:
Walnut Creek upstream in field (UF) vs. Walnut Creek at
the TWWTP effluent mixing zone in field (TF), Walnut
Creek upstream in field (UF) vs. Walnut Creek upstream in
laboratory (UL), Walnut Creek at the TWWTP effluent
mixing zone in laboratory (TL) vs. Walnut Creek upstream
in laboratory (UL), and Walnut Creek at the TWWTP ef-
fluent mixing zone in laboratory (TL) vs. Walnut Creek at
the TWWTP effluent mixing zone in field (TF). Data are
shown as the mean differences (ANOVA significance in
parentheses).
TF vs. UF UF vs. UL TL vs. UL TF vs. TL
Day 1 0.127
(0.001)
0.035
(0.001)
0.000
(1.000)
0.162
(0.001)
Day 3 0.000
(1.000)
0.000
(1.000)
0.000
(1.000)
0.000
(1.000)
Day 6 0.050
(0.013)
0.000
(1.000)
0.000
(1.000)
0.050
(0.013)
Day 9 0.230
(0.001)
0.010
(1.000)
0.034
(0.001)
0.197
(0.001)
Day 13 0.287
(0.001)
0.000
(1.000)
0.000
(1.000)
0.280
(0.001)
When overall mean LSI between exposures were com-
pared, TF had a significantly higher LSI compared to all
other exposures (p = 0.025). A comparison of EROD
activity, CYP1B expression, and LSI for day 9 exposures
(Figure 3), showed that there was a significant positive
relationship between EROD activity and LSI (p = 0.012),
while other combinations were not correlated (p > 0.05).
3.4. Water Quality
Water quality data are shown (Table 5). While the cur-
rent study did not focus on identification of causal agents,
comparisons of water quality (inorganics and physical
properties) at the Walnut Creek upstream (UF), TWWTP
effluent mixing zone (TF), and tap water (TP) revealed
that Walnut Creek upstream contained the highest con-
centrations of magnesium, aluminum, iron, and manga-
nese. Water from the TWWTP effluent mixing zone
contained the highest concentrations of sodium, calcium,
potassium, nitrate, boron, phosphate, and suspended sol-
ids, along with the highest dissolved oxygen, specific
conductance, and temperature.
Although tap water generally contained the lowest
concentrations of every variable tested, tap water pH was
the highest for samples taken. The freshwater Criterion
Continuous Concentrations (CCC) [11] for aluminum
and trivalent chromium were exceeded by all samples.
The freshwater Criteria Maximum Concentration [11] for
lead was also exceeded by all samples.
Figure 3. Comparison of day 9 hepatic samples for LSI, CYP1B gene expression, and EROD activity fol-
lowing Walnut Creek Upstream (UF) and Walnut Creek at the Troy Wastewater Treatment Plant ef-
Sfluent mixing zone (TF) in the field setting, and Walnut Creek Upstream (UL), Walnut Creek at Troy
Wastewater Treatment Plant effluent mixing zone (TL), and dechlorinated tap water (TP) in the labo-
ratory setting exposures.
Cytochrome P450 Induction and Gene Expression in Channel Catfish (Ictalurus punctatus) Following Wastewater
Treatment Plant Effluent Exposure in Field and Laboratory Settings
Copyright © 2010 SciRes. JEP
369
Table 3. Relative expressionsa of metabolism-associated genes determined by real-time RT-PCR for hepatic samples from
channel catfish exposed to Walnut Creek Upstream (UF) and Walnut Creek at the Troy Wastewater Treatment Plant efflux-
ent mixing zone (TF) in the field setting, and Walnut Creek Upstream (UL), Walnut Creek at Troy Wastewater Treatment
Plant effluent mixing zone (TL), and dechlorinated tap water (TP) in the laboratory setting. Data represent the mean fold
change ± SE.
Exposure Group CYP1B Metallothionein II Ferritin P450 aromatase Superoxide dismutase 2
UF 0.59 (0.10)b 0.34 (0.050) 1.26 (0.203) 1.67 (0.081) 0.45 (0.086)
TF 3.60 (0.87)b 0.71 (0.106) 0.52 (0.023) 1.39 (0.142) 1.77 (0.413)
UL 1.21 (0.11)c 0.81 (0.050) 0.84 (0.057) 2.77 (0.222) 3.81 (0.859)
TL 1.38 (0.16)c 2.24 (0.144) 1.72 (0.218) 1.69 (0.139) 1.26 (0.170)
TP 1.10 (0.11) 1.16 (0.146) 1.03 (0.067) 1.08 (0.102) 1.28 (0.253)
aGene expression data were normalized with the 18S reference gene; bSignificantly different (ANOVA, p < 0.001); cSignificantly different (ANOVA, p <
0.001).
Table 4. Liver Somatic Indexes for channel catfish following UF, TF, UL, TL and TP exposures. Data represent the mean for
three replicates (consisting of 5 livers pooled) ± SE.
UF TF UL TL TP
DAY 1 Exposure 0.916 (0.040) 0.823 (0.026) 0.657 (0.018) 0.849 (0.019) 0.664 (0.043)
DAY 3 Exposure 0.725 (0.018) 0.658 (0.006) 0.698 (0.080) 0.829 (0.014) 0.911 (0.054)
DAY 6 Exposure 0.672 (0.008) 0.823 (0.041) 0.698 (0.080) 0.999 (0.055) 0.826 (0.065)
DAY 9 Exposure 0.642 (0.027) 1.324 (0.063)a 0.815 (0.036) 0.879 (0.020) 0.907 (0.068)
DAY 13 Exposure 0.724 (0.001) 1.460 (0.047) a 0.974 (0.023) 0.920 (0.028) 1.001 (0.011)
Mean Overall LSI 0.736 (0.035) 1.018 (0.094) 0.768 (0.063) 0.895 (0.035) 0.862 (0.060)
Mean Difference: Day 0b to Day 130.046 0.781c 0.295 0.241 0.323
aSignificantly higher than UF on same day of exposure (ANOVA, p < 0.05; bDay 0 mean LSI was 0.679 ± SE; cSignificantly higher than Day 0 mean LSI
(ANOVA, p < 0.001)
4. Discussion
Some of the earliest changes to occur in an organism
following exposure to an environmental pollutant occur
at the cellular level as a result of xenobiotic and molecu-
lar interactions. Many of these effects can be indicated
by changes in physiological parameters that may serve as
sentinels of environmental pollution by organic chemi-
cals, metals, and various other stressors. These bio-
markers of chemical contamination can include altera-
tions in the structural integrity of the cellular membrane,
interference with the involvement of macromolecules in
metabolic processes, alterations in genetic material and
gene expression, inhibition or induction of certain en-
zyme activity, activation of the immune system, and in-
terference with the regulation of cell growth [21-25].
Wastewater treatment plant effluent has been exten-
sively studied due to its complex chemistry and direct
impact on the ecology of surrounding water resources
[20]. However, determining the nature of this impact on
native species for a specific area in a timely manner re-
mains an important issue for risk management. This is
certainly a concern for Walnut Creek which receives
discharges from TWWTP and is potential habitat for
channel catfish.
Although several studies have investigated induction
of EROD in channel catfish in response to known toxic
chemicals or environmental pollutants [26-29], little or
no attention has been given to establishing the baseline
EROD activity level in channel catfish in the field. Stud-
ies have mainly focused on increased “fold-induction” of
EROD in experimental groups compared to a controlled
group [28,29], or simply the level or presence of EROD
activity [26,27].
In a previous study [13] using EROD as a biomarker
of exposure and impact of TWWTP effluent, the use of
upstream exposures suggested that components of up-
stream water and effluent produced synergistic effects
that were beyond control, making it difficult to assess the
impact of the effluent itself. The use of what was previ-
Cytochrome P450 Induction and Gene Expression in Channel Catfish (Ictalurus punctatus) Following Wastewater
Treatment Plant Effluent Exposure in Field and Laboratory Settings
Copyright © 2010 SciRes. JEP
370
Table 5. Water chemistry for samples collected from Walnut Creek (UF), TWWTP effluent mixing zone (TF), and tap
water (TP). (Values represent the mean for five sampling days - 1, 3, 6, 9, and 13 - with standard error in parentheses).
Parameters UF TF TP
Calcium (ppm) 10.52 (0.500) 76.24 (9.730) 1.00 (0.300)
Potassium (ppm) 0.62 (0.049) 12.52 (2.020) 0.55 (0.080)
Magnesium (ppm) 0.18 (0.058) < 0.10 < 0.10
Phosphate (ppm) < 0.10 1.20 (0.095) 0.06 (0.024)
Aluminum (ppm) 0.50 (0.16) 0.48 (0.240) 0.10 (0.077)
Arsenic (ppm) < 0.10 < 0.10 < 0.10
Boron (ppm) < 0.10 0.52 (0.049) 0.15 (0.022)
Cadmium (ppm) < 0.10 < 0.10 < 0.10
Chromium (ppm) 0.22 (0.091) 0.28 (0.097) 0.25 (0.050)
Copper (ppm) 0.02 (0.020) < 0.10 0.02 (0.020)
Iron (ppm) 1.12 (0.150) 0.08 (0.037) 0.05 (0.039)
Manganese (ppm) 0.18 (0.058) < 0.10 < 0.10
Sodium (ppm) 1.58 (0.037) 204.10 (31.080) 67.00 (1.270)
Nickel (ppm) < 0.10 0.04 (0.040) 0.03 (0.019)
Lead (ppm) 0.6 (0.260) 0.94 (0.210) 0.63 (0.280)
Zinc (ppm) < 0.10 < 0.10 < 0.10
Nitrate (ppm) 0.26 (0.040) 3.12 (0.900) 0.13 (0.019)
ECa (mmhos/cm) 0.07 (0.004) 0.98 (0.096) 0.28 (0.0067)
SSb (ppm) 52.36 (2.240) 683.20 (67.050) 192.50 (4.700)
pH 7.64 (0.052) 8.08 (0.028) 8.42 (0.083)
ously considered a reference site with relatively low pol-
lutants, actually induced higher EROD than the effluent.
Not only did this study point to the need to establish a
baseline EROD level in catfish, but it also pointed out the
challenges of using a reference site for cohort studies.
In the present study, initial overall EROD activity on
day 0 was high (Figure 1) for unexposed fish sampled
prior to initiation of exposures for the study. These data
may be attributed to the stresses caused by confinement,
handling, anoxia, and transportation from the hatchery to
the testing sites [2,30,31]. The current study focused on
eliminating or reducing the influence of unknown identi-
ties and quantities of chemicals on EROD induction by
using dechlorinated tap water to establish a baseline
EROD level in channel catfish. Juvenile fingerlings were
used to avoid age and sex-linked variations, as they have
shown higher EROD activities with less discrepancy
between both sexes than adult fish [32]. After catfish
acclimated to their surroundings by day 3, EROD for TP
exposed fish was 0.03 nmol/min/µg of protein and re-
mained constant throughout the study.
As with the 5-fold EROD increase in fish exposed to
water at the TWWTP effluent mixing zone compared to
Walnut Creek upstream of the facility, a field study con-
ducted by Gagne and Blaise [33] on rainbow trout ex-
posed to pulp and paper mill secondary wastewater
treatment plant effluent water found a similarly elevated
9.4-fold EROD induction. Our data demonstrated that
TWWTP effluent significantly impacted EROD induc-
tion in both field and laboratory scenarios. However, the
greater EROD levels and fold differences found in in situ
exposures suggest that EROD-inducing volatiles may be
present in field exposures that are lost as water samples
are transported to the laboratory.
Although it is not known which specific chemicals in
TWWTP effluent mixing zone water caused induction of
EROD activity, it can be deduced from the data that
WWTP effluent contributed to the effect. The water
Cytochrome P450 Induction and Gene Expression in Channel Catfish (Ictalurus punctatus) Following Wastewater
Treatment Plant Effluent Exposure in Field and Laboratory Settings
Copyright © 2010 SciRes. JEP
371
sample collected at TWWTP effluent mixing zone ex-
ceeded standards for certain metals (aluminum, chro-
mium, and lead) [11]. The levels of some metals (such as
calcium, potassium, boron, sodium, and lead), phosphate,
and nitrate were found to be higher in TF than UF, but
other studies have shown that these chemicals can be
antagonistic to EROD induction [8]. Moreover, of the
other metabolic enzymes measured in the study, metal-
lothionein II, ferritin, and P450 aromatase levels were
less in TF than other exposures (Table 3). Therefore, the
higher EROD levels in TF exposed fish, despite higher
levels of these potentially antagonistic materials, sug-
gested that there must be greater and effective levels of
other inorganic and organic EROD inducing pollutants
present. In further support of this reasoning, noticeable
anatomical changes in the livers (enlarged and pale color)
as well as higher LSI in catfish exposed to Walnut Creek
were found at the effluent mixing zone.
The liver somatic index is known to be sensitive to
pollutants, and LSI increases due to organisms’ efforts to
detoxify the intake of such toxins as polychlorinated bi-
phenyls (PCBs) and polyaromatic hydrocarbons (PAHs)
[34]. Although identification of the cause for LSI changes
was not within the scope of this study, the higher LSIs in
TF compared to all other exposures, suggests that it was
due to the higher concentration of pollutants in TWWTP
effluent. Moreover, since Vosylienė [35] showed that LSI
of fish exposed to a mixture of heavy metals (composite
of copper, zinc, nickel, chromium, lead, cadmium, and
magnesium) either decreased or showed no effect on LSI,
our conclusion that there must be high levels of other
inorganic and organic EROD inducing pollutants in
TWWTP effluent is further supported.
When all aspects of ex situ and in situ setting expo-
sures in our study were compared, it was found that in
situ exposures provided several advantages over the ex
situ setting. Using caged catfish of standard size and
known exposure history in situ made it easier to normal-
ize data; it was not necessary to transport large quantities
of water to a different location; and the issue of having to
recreate or maintain the water quality and conditions of
the field location was eliminated.
In our comparison of field and laboratory data for dai-
ly and overall EROD activity, LSI and CYP1B gene ex-
pression, TF was found to be significantly higher for all
parameters compared to TL and UF was higher than UL.
These results emphasize the robustness of field expo-
sures compared to using laboratory microcosms and me-
socosms.
5. Conclusions
The use of biomarkers has been validated as a diagnostic
tool for monitoring ecosystem health [2]. Biomarkers
directly assess the impact of contaminants on biological
systems. Monod [36] has suggested that CYP1 induction
could be used as an early warning sign for more serious
environmental effects, ranging from aquatic contamina-
tion to biological alterations in exposed organisms. Al-
though CYP1 was classically recognized as specifically
induced by polycyclic aromatic hydrocarbons (PAHs)
and pesticide exposure, it is now known that it is not
specific for one unique class of pollutants; it can be used
as a biomarker to monitor the ecological risk of various
chemicals in the environment [2,36].
The determination of baseline EROD activity level in
channel catfish can have immediate application in water
quality assessment where the goal is to determine if
EROD levels are due to exposure to the contaminants
and not inherent levels that exist within the species. Ra-
ther than selecting channel catfish from a reference site,
which may have questionable levels of pollution or con-
tamination, the established EROD baseline can serve as
the reference. Also, an established baseline EROD in-
duction can be useful for monitoring for slight distur-
bances in the environment [37].
An induced level of EROD activity does not predict
whether a single environmental contaminant will have a
negative impact on the organism, since organisms are
capable of further processing chemicals to be inactivated
and/or eliminated from the body. Therefore, future stud-
ies are needed to determine relationships between the
ranges of EROD activities – from those levels that reflect
normal activity and are no threat to the survival of the
organisms, to those that do indicate adverse effects – and
toxic effects beyond the molecular level.
Troy Wastewater Treatment Plant effluent water in-
duced significant EROD activity in channel catfish and
combined with the liver somatic index, water chemistry,
and physical changes, these data suggest that the pollut-
ants in the TWWTP effluent may pose a possible threat
to the survival of organisms and to the integrity of the
Walnut Creek ecosystem. Our study also draws attention
to the inadequacy of relying on exposing aquatic organ-
isms (such as Daphnia and fathead minnows) in labora-
tory settings to assess the toxicity of wastewater rather
than using in situ exposures that are much more indica-
tive of the actual impact of contaminants at the site.
Consequently we suggest that EROD or other molecular
biomarkers be included in requirements for water quality
assessment, even when the contributors to these water
bodies are considered to have relatively low toxicity;
particularly as these biomarkers could serve as early
warnings for more serious biological impact.
Cytochrome P450 Induction and Gene Expression in Channel Catfish (Ictalurus punctatus) Following Wastewater
Treatment Plant Effluent Exposure in Field and Laboratory Settings
Copyright © 2010 SciRes. JEP
372
6. Acknowledgements
This study was funded by a faculty development grant
from Troy University (Troy, Alabama).
REFERENCES
[1] M. L. Haasch, R. Prince, P. J. Wejksnora, K. R. Cooper
and J. J. Lech, “Caged and Wild Fish: Induction of He-
patic Cytochrome P-450 (CYP1A1) as an Environmental
Bio- monitor,” Environmental Toxicology and Chemistry,
Vol. 12, No. 5, pp. 885-895, 1993.
[2] J. C. Amiard, T. Caquet, and L. Lagadic, “Use of Bio-
Markers for Environmental Quality Assessment,” CRC
Press, London, 2000.
[3] M. Parveen, Y. Momose, E. Kitagawa, S. Kurita, O. Ko-
dama and H. Iwahashi, “Bioassay of Pesticide Lindane
Using Yeast-DNA Microarray Technology,” Chem-Bio
In- formatics Journal, Vol. 3, No. 1, 2003, pp. 12-29.
[4] Murata, S. Murata-Mizukami, E. Kitagawa, H. Iwahashi
and K. Takamizawa, “The Evaluation of Environmental
Waters Using Yeast DNA Microarray,” Chem-Bio Infor-
matics Journal, Vol. 6, No. 2, 2003, pp. 29-46.
[5] C. M. Brumley, V. S. Haritos, J. T. Ahokas and D. A.
Holdway, “Validation of Biomarkers of Marine Pollution
Exposure in Sand Flathead Using Aroclor 1254,” Aquatic
Toxicology, Vol. 31, No. 3, 1995, pp. 249-262.
[6] P. A. van Veld, D. J. Westbrook, B. R. Woodin, R. C.
Hale, C. L. Smith, R. J. Huggett and J. J. Stegeman, “In-
duced Cytochrome P-450 in Intestine and Liver of Spot
(Leiostomus xanthurus ) from a Polycyclic Aromatic Hy-
drocarbon Contaminated Environment,” Aquatic Toxicol-
ogy, Vol. 17, No. 2, 1990, pp. 119-132.
[7] B. Hoeger, M. R. van der Heuvel, B. C. Hitzfeld and D. R.
Dietrich, “Effects of Treated Sewage Effluent on Immune
Function in Rainbow Trout (Oncorhynchus mykiss),”
Aquatic Toxicology, Vol. 70, No. 4, 2004, pp. 345-355.
[8] K. R. Munkittrick, G. J. van Der Kraak, M. E. McMaster,
C. B. Portt, M. R. van der Heuvel and M. R. Servos,
“Survey of Receiving-Water Environmental Impacts As-
sociated with Discharges from Pulp Mills,” Environ-
mental Toxicology and Chemistry, Vol. 13, No. 7, 1994,
pp. 1089-1101.
[9] ADEM (Alabama Department of Environmental Man-
agement), “Water Quality Program, Admin. Code R.
335-6-6 et seq., ” Montgomery, Alabama, 2007.
[10] ADEM (Alabama Department of Environmental Man-
agement), Environmental Indicators Section, Field Opera-
tions Division, “Water quality assessment, Walnut Creek,
Troy, Alabama, Pike County,” Montgomery, Alabama,
1997.
[11] U.S EPA (Environmental Protection Agency), National
Recommended Water Quality Criteria, 2009. http://www.
epa.gov/waterscience/criteria/wqctable/#cmc
[12] S. S. Bhattarai, “Induction of Cytochrome P450 in Chan-
nel Catfish (Ictalurus punctatus) Following Exposure to
Troy (Alabama) Waste Water Treatment Plant Effluent,”
M.S. thesis. Troy University, Troy, 2005.
[13] A. Whatley, P. M. Stewart, S. S. Bhattarai and C. Ma-
grath, “Cytochrome P450 in Channel Catfish (Ictalurus
punctatus) Following Exposure to Troy (Alabama) Waste
Water Treatment Plant Effluent,” Aquatic Ecosystem
Health and Management, Vol. 12, No. 2, 2009, pp. 206-
214.
[14] R. W. Li and G. C. Waldbieser, “Genomic Organization
and Expression of the Natural Killer Cell Enhancing Fac-
tor (NKEF) Gene in Channel Catfish, Ictalurus punctatus
(Rafinesque),” Fish & Shellfish Immunology, Vol. 20, No.
1, 2006, pp. 72-82.
[15] M. D. Burk and R. T. Mayer, “Ethoxyresorufin: Direct
Fluorimetric Assay of a Microsomal O-Dealkylation
Which is Preferentially Inducible by
3-Methylcholanthrene,” Drug Metabolism and Disposi-
tion, Vol. 2, No. 6, 1974, pp. 583-588.
[16] K. M. Chan, “Kinetic Cytofluor EROD Assay for Micro-
Somes in 48-Well Plates,” 2005. http://www.bch.cuhk.
edu.hk/webct/ens4310/kmc/erod_assay.html
[17] E. Stephensen, M. Adolfsson-Erici, M. Celander, M. Hu-
lander, J. Parkkonen, T. Hegelund, J. Sturve, L. Hassel-
berg, M. Bengtsson and L. Förlin, “Biomarker Responses
and Chemical Analyses in Fish Indicate Leakage of Poly-
Cyclic Aromatic Hydrocarbons and Other Compounds
from Car Tire Rubber,” Environmental Toxicology and
Chemis- try, Vol. 22, No. 12, 2003, pp. 2926-2931.
[18] C. D. Rice and L. E. Roszell, “Tributyltin Modulates
3,3’,4,4’,5-Pentachlorobiphenyl (PCB-12 6)-Induced He-
patic CYP1A Activity in Channel Catfish, Ictalurus punc-
tatus,” Journal of Toxicology and Environmental Health
A, Vol. 55, No. 3, 1998, pp. 197-212.
[19] K. J. Livak and T. D. Schmittgen, “Analysis of Relative
Gene Expression Data Using Real-Time Quantitative
PCR and the 2-ΔΔCT Method,” Methods, Vol. 25, 2001,
pp. 402-408.
[20] W. J. Birge, J. A. Blac, T. M. Short and A. G. Wester-
man, “A Comparative Ecological and Toxicological In-
ves- tigation of a Secondary Wastewater Treatment Plant
Efflux- ent and Its Receiving Stream,” Environmental
Toxicology and Chemistry, Vol. 8, No. 5, 1989, pp. 437-
450.
[21] R. M. Maier, I. L. Pepper and C P. Gerba, “Environ-
mental Microbiology,” Academic Press, Burlington,
2009.
[22] A. M. El-Shehawi, F. K. Ali and M. A. Seehy, “Estima-
tion of Water Pollution by Genetic Biomarkers in Tilapia
and Catfish Species Shows Species-Site Interaction,” Af-
rican Journal of Biotechnology, Vol. 6, No. 7, 2007, pp.
840-846.
[23] D. Nadeau, S. Corneau, I. Plante, G. Morrow and R. M.
Tanguay, “Evaluation for HSP 70 as a Biomarker of Ef-
fect of Pollutants on the Earthworm Lumbricus terrestri,”
Cell Stress and Chaperones, Vol. 6, No. 2, 2001, pp.
153-163.
Cytochrome P450 Induction and Gene Expression in Channel Catfish (Ictalurus punctatus) Following Wastewater
Treatment Plant Effluent Exposure in Field and Laboratory Settings
Copyright © 2010 SciRes. JEP
373
[24] D. Schlenk, M. Chelius, S. K. Wolford and K. M. Chan,
“Characterization of Hepatic Metallothionein Expression
in Channel Catfish (Ictalurus punctatus) by Reverse-
Transcriptase Polymerase Chain Reaction,” Biomarkers,
Vol. 2, No. 3, 1997, pp. 161-167.
[25] P. J. Kloepper-Sams and E. Benton, “Exposure of Fish to
Biologically Treated Bleached-Kraft Effluent. 2. Induc-
tion of Hepatic Cytochrome P450 in Mountain Whitefish
(Prosopium williamsoni) and Other Species,” Environ-
mental Toxicology and Chemistry, Vol. 13, No. 9, 1994,
pp. 1483-1497.
[26] J. M. Grizzle, S. A. Horowitz and D. R. Strength, “Caged
Fish as Monitors of Pollution: Effects of Chlorinated Ef-
fluxent from a Wastewater Treatment Plant,” Journal of
the American Water Resources Association, Vol. 24, No.
5, 1988, pp. 951-959.
[27] M. O. James, A. H. Altman, K. Morris, K. M. Kleinow
and Z. Tong, “Dietary Modulation of Phase 1 and Phase 2
Activities with Benzo(A)Pyrene and Related Compounds
in the intestine But Not the Liver of the Channel Catfish,
Ictalurus punctatus,” Drug Metabolism and Disposition,
Vol. 25, No. 3, 1997, pp. 346-354.
[28] D. E. Watson, W. Reichert and R. T. Di Giulio, “Induc-
tion of Hepatic CYP1A in Channel Catfish Increases
Binding of 2-Aminoanthracene to DNA in Vitro and in
Vivo,” Carcinogenesis, Vol. 19, No. 8, 1998, pp. 1495-
1501.
[29] K. L. Willett, P. R. Gardinali, L. A. Lienesch and R. T. Di
Giulio, “Comparative Metabolism and Excretion of
Benzo(A)Pyrene in 2 Species of Ictalurid Catfish,” Toxi-
cological Sciences, Vol. 58, No. 1, 2000, pp. 68-76.
[30] R. Soimasuo, L. Jokinen and J. Kukkonen, “Biomarker
Responses along a Pollution Gradient: Effects of Pulp
Mill Effluents on Caged Whitefish,” Aquatic Toxicology,
Vol. 31, No. 3, 1995, pp. 329-346.
[31] M. Celander, “Impact of Stress on Animal Toxicology,”
In: P. H. M. Balm, Ed., Stress Physiology in Animals,
Sheffield Academic Press, Sheffield, 1999, pp. 246-279.
[32] T. K. Collier, B. F. Anulacion and J. E. Stein, “A Field
Evolution of Cytochrome p4501A as a Biomarker of
Contaminant Exposure in Three Species of Flatfish,” En-
vironmental Toxicology and Chemistry, Vol. 14, 1995, pp.
143-152.
[33] F. Gagne and C. Blaise, “Hepatic Metallothionein Level
and Mixed Function Oxidase Activity in Fingerling
Rainbow Trout (Oncorhynchus mykiss) after Acute Ex-
posure to Pulp Mill Effluents,” Water Resesearch, Vol.
27, No. 11, 1993, pp. 1669-1682.
[34] J. F. Crivello, “Liver-Somatic Index,” 2009. http://estuary.
uconn.edu/EWP6.html
[35] M. Z. Vosylienė, “Distinctive Features of Changes in
Biological Parameters of Rainbow Trout Exposed to
Heavy Metal Model Mixture,” Ekologija, Vol. 48, No. 2,
2002, pp. 22-25.
[36] G. Monod, “L’induction du Cytochrome P4501A1 chez
les Poissons,” In: L. Lagadic, T. Caquet, J. C. Amiard and
F. Ramade, Eds., Biomarqueurs en Ecotoxicologie:
Aspects Foundamentaux, Paris, 1997, pp. 33-54.
[37] U. Kammann, T. Lang, M. Vobach, and W. Wosniok,
“Ethoxyresorufin-O-deethylase (EROD) Activity in Dab
(Limanda limanda) as Biomarker for Marine Monitor-
ing,” Environmental Science and Pollution Research, Vol.
12, No. 3, 2005, pp. 140-145.