Vol.2, No.11, 1264-1273 (2010) Natural Science
http://dx.doi.org/10.4236/ns.2010.211153
Copyright © 2010 SciRes. OPEN ACCESS
Long-term culture of primary porcine mature
hepatocytes in the medium supplemented with ascorbic
acid 2-phosphate
Yohichi Kumaki1*, Iku Kumaki2, Xiaomei Guo3, Weilin Shang4, Toshie Koyama1, Ai Okamura1,
Yoshiaki Shiba1, Toshiyuki Mukaiyama1, Noriko Sasaki1, Makoto Kodama1
1Tissue Engineering Research Center, National Institute of Advanced Industrial Science and Technology, Higashi, Tsukuba, Ibaraki,
Japan; *Corresponding author: [email protected]
2Department of Laboratory Science, Gunma University School of Health Science, Showa-machi, Maebashi, Gunma, Japan
3Laser Vision Center, Suzhou Eye Hospital, 18 Shuyuan Lane, Suzhou City, Jiangsu Province, China
4304th Clinical Department of Chinese PLA General Hospital, Fucheng Road, Haidian District, Beijing, China
Received 27 July 2010; revised 28 August 2010; accepted 2 September 2010.
ABSTRACT
In this study, the effect of ascorbic acid
2-phosphate (Asc2P) was tested on porcine and
rat mature hepatocytes in vitro. a). Asc2P in-
creased the porcine, but not rat, albumin secre-
tion and mRNA expression. The enhancing ef-
fect of Asc2P on porcine C/EBP alpha mRNA
was observed in porcine mature hepatocytes.
These data suggested that Asc2P played an
important role in the regulation of porcine al-
bumin mRNA level. b). The enhancing effect of
Asc2P on ammonium metabolic activity was
also observed in porcine, but not rat, mature
hepatocytes. The porcine ornithine transcar-
bamylase (OTC) and arginase mRNAs were
augmented by Asc2P, indicating that Asc2P had
a direct effect on the urea cycle. c). The porcine
collagen type I and type III mRNA, but not type
XII mRNA, were detected as well, sugessting
that Asc2P did not have the effect on the
non-parenchymal hepatocytes to induce colla-
gen type I and III mRNA expression. d). Our
RT-PCR analysis demonstrated that the porcine
hepatocytes expressed the sodium-ascorbate
co-transporters SVCT1 and SVCT2, however,
the intensities of porcine sodium-ascorbate
co-transporters SVCT1 and SVCT2 bands were
not changed markedly. These findings indicated
that the Asc2P had no effect on SVCT1 and
SVCT2 mRNA expression. e). The enhancing
effect of Asc2P on porcine albumin mRNA was
inhibited by staurosporine, a portein kinase in-
hibitor. We conclude that the enhanced albumin
mRNA by Asc2P might be due to activation of
tyrosine protein kinase and/or PKC and the
Asc2P enhanced porcine albumin mRNA mainly
at the transcriptional step.
Keywords: Albumin Secretion; Ammonium
Metabolic Activity; Ascorbic Acid 2-Phosphate;
Porcine Hepatocytes; Reverse
Transcriptase-Polymerase Chain Reaction
1. INTRODUCTION
Primary cultures of hepatocytes have been used as a
model system to investigate liver function, including
drug metabolism, hepatotoxicity, protein biosynthesis
and gene expression. Primary porcine hepatocytes are
currently used in research and therapeutic applications as
the biological component of extracorporeal liver assist
devices. Tateno and Yoshizato reported that a long-term
cultivation of adult rat small hepatocytes had been de-
veloped for more than two months without losing their
replicative potential and differentiation capacity [1].
They further indicated that the medium used supported
the continuous growth of small hepatocytes for an ex-
tended period [2]. The culture medium contained four
key substances in addition to fetal bovine serum, that is,
epidermal growth factor, nicotinamide, dimethyl sulfox-
ide and ascorbic acid 2-phosphate. They also co-cultured
human parenchymal hepatocytes with Swiss 3T3 cells in
the medium containing human serum, EGF, nicontina-
mide, and ascorbic acid 2-phosphate [3]. Katsura et al.
reported that primary human hepatocytes were cultured
in keratinocyte-stimulating factor medium supplemented
with 10% human serum, 10 mM nicotinamide, 10 ng/ml
epidermal growth factor, 0.5 microg/ml insulin, 10(-7)
M dexamethasone [4]. We previously reported that the
Y. Kumaki et al. / Natural Science 2 (2010) 1264-1273
Copyright © 2010 SciRes. OPEN ACCESS
1265
proliferation of porcine mature hepatocytes was ob-
served for an extended period using a medium, which
contains Williams’ medium E, fetal bovine serum, epi-
dermal growth factor, insulin, dexamethasone and ascor-
bic acid 2-phosphate.
L-ascorbic acid or vitamin C, a naturally occurring
major antioxidant, is one of the specialized products
from the secondary pathway of glucose oxidation.
Ascorbic acid 2-phosphate (Asc2P) is a stable vitamin C
derivative. In this study, we first tested the effect of
Asc2P on porcine and rat mature hepatocytes and no-
ticed that the albumin secretion released into the culture
medium from the porcine hepatocytes was increased by
Asc2P. Asc2P also increased the ammonium metabolic
activity of porcine hepatocytes. However, Asc2P did not
give any effect to rat hepatocytes on albumin secretion
and ammonium metabolic activity. Based on these ob-
servations, we therefore further investigated the mode of
action of Asc2P in vitro. Our data had a direct impact on
our understanding of the mechanism for vitamin C on
the porcine hepatocytes as well as on the transport of the
vitamin C across the intestinal barrier.
2. MATERIALS AND METHODS
2.1. Cells and Chemicals
Porcine hepatocytes were isolated by perfusion
method using dispase and collagenase. Rat hepatocytes
were isolated by the standard two-step collagenase per-
fusion method from male Wister rats (150-250 g). Iso-
lated hepatocytes were cultured in the Williams’ medium
E (Gibco BRL) supplemented with 10% fetal bovine
serum (FBS) (Sigma). This medium also contained insu-
lin (10-7 M) (Wako), dexamethasone (10-6 M) (Wako),
epidermal growth factor (EGF) (25 ng/ml) (Wako),
penicillin (100 U/ml) and streptomycin (100 µg/ml)
(Sigma). The isolated hepatocytes were finally sus-
pended at a concentration of 1.5 x 105 cells/ml. Four
milliliters of cell suspension were placed into 60-mm
culture Iwaki dishes coated with collagen type I and the
cells were incubated at 37°C and 5% CO2. The medium
was changed every other day. Hep G2 cells are a human
cell line, derived from a patient with hepatocellular car-
cinoma [5,6]. This cell line was maintained in Dul-
becco’s modified Eagle medium (DMEM) (Gibco BRL)
containing 10% FBS. Both sera were heat-inactivated
(56°C, 30 min) before use. Asc2P (Wako) was dissolved
in PBS(-) and sterilized through a 0.2 µm Millipore filter.
The solution was stored at –20°C until use.
2.2. Assay for the Albumin Secretion
The hepatocytes were seeded as mentioned above and
Asc2P was added to the each well at the concentrations
of 1.5 and 0.0 mM. The medium was collected during the
incubation and stored at –20°C until use. The secreted
porcine or rat albumin was determined by enzyme-linked
immunosorbent assay (ELISA). We used the two-anti-
body sandwich method. Briefly, 50 ng of goat anti-pig or
rabbit anti-rat albumin antibody (Bethyl) was bound to
each well of a high binding microtiter plate (Costar).
After incubation overnight, samples (1000-times-diluted
with culture medium) were applied to the wells. Porcine
or rat albumin (Sigma) was used as a standard. Then, 50
ng of goat anti-pig or rabbit anti-rat albumin antibody
conjugated to the horseradish peroxidase (Bethyl) was
added to each well. O-phenylendiamine (Sigma) solution
in 0.01% H2O2 (3 mg/ml) was used as a substrate and the
reaction was stopped by adding 50 µl of 1.0 mol/l H2SO4.
A microplate reader was used for measurement at 490 nm
wavelength.
2.3. Assay for Ammonium Metabolic
Activity
The hepatocytes were incubated in the presence or
absence of Asc2P. 0.4 ml of 100 mmol/l NH4Cl (Wako)
was added to the medium and 0.1 ml of medium was
collected 0, 3 and 6 hours later. Then, the medium was
replaced with fresh medium. The ammonium concentra-
tion was measured using a commercial kit (AMICHECK™
meter, Arkray Factory Inc., Japan). The same assay sys-
tem was carried out during the incubation.
2.4. RNA Extraction
The hepatocytes were seeded and Asc2P was added at
the concentrations of 15, 7.5, 1.5 and 0.0 mM. Total
RNA was isolated from hepatocytes with ISOGEN re-
agent (Nippon Gene), according to the manufacturer’s
instructions. The RNA was precipitated with 70% etha-
nol, resuspended in 20 µl of sterile distilled water con-
taining 0.1% (v/v) diethyl pyrocarbonate (DEPC) and
stored at –80°C before use. RNA was quantified spec-
trophotometrically and tested for integrity by using de-
naturing agarose-gel electrophoresis.
2.5. Analysis of Albumin and C/EBP alpha
mRNA Expression by RT-PCR
Each specific mRNA for the amplification was ana-
lysed by reverse transcriptase-polymerase chain reaction
(RT-PCR). Reverse transcriptase assay was carried out
using total RNA samples and Ready-To-Go RT-PCR
Beads (Amersham). Equal amounts of total cellular RNA
(2.0 µg) were used to be reverse-transcribed into cDNA
at 42°C for 60 min using pd(N)6 Random hexamer
(Amersham). Before PCR amplification, the reverse
transcriptase enzyme was inactivated at 95°C for 5 min.
PCR was performed in a total volume of 50 µl con-
Y. Kumaki et al. / Natural Science 2 (2010) 1264-1273
Copyright © 2010 SciRes. OPEN ACCESS
1266
taining 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM
MgCl2, 0.16 mM dNTP, 0.2 µM of each primer, 1 µl of
the cDNA reaction and 0.5 µl of Taq DNA polymerase
(5 U/µl; Toyobo) for amplification of the cDNA frag-
ment. Pairs of the oligonucleotide synthesized specific
primers for PCR were designed in the corresponding
cDNA sequences to porcine albumin [7], porcine
glyceraldehyde-3-phosphate dehydrogenase (GAPDH),
rat albumin [8], mouse GAPDH [9] and porcine C/EBP
alpha [10]. The sequences of the primers and lengths of
PCR products are given in Table 1. The synthesized
cDNA was denatured at 94°C for 5 min and the amplifi-
cation were performed at 94°C for 1 min, 55°C for 1 min
and 72°C for 1 min with GeneAmp PCR System 9700
machine (Perkin-Elmer Biosystems). The cycle numbers
of PCR were determined for each gene before the PCR
reached a plateau. The PCR products were separated on
1% agarose gel containing ethidium bromide and the
bands were viewed under ultraviolet (UV) light.
2.6. Analysis of Porcine Ornithine
Transcarbamylase (OTC), Arginase,
Sodium-Ascorbic Acid Transporter
SVCT1 and SVCT2 mRNA Expression
Oligonucleotides used as primers for PCR amplifica-
tion of cDNA specific for porcine OTC [11], human ar-
ginase [12], porcine sodium-ascorbic acid transporter
SVCT1 and SVCT2 [13] are also listed in Table 1. Five
microliters of the RT cDNA samples were used to per-
form the PCR reaction. For the arginase mRNA expres-
sion, the PCR reaction was initiated with a denaturation
step at 94°C for 5 min. This was followed by 28 cycles
at 94°C for 1 min, 58°C for 1 min, and 72°C for 2 min.
The PCR amplified products for SVCT1 and SVCT2
were electrophoresed on a 1.8% agarose gel.
Human collagen type I yielded a 500-bp product and
human collagen type III yielded a 400-bp product. Hu-
man collagen type XII was used as the control. These
primers were designed to conserved regions of the
mRNA sequences ascertained from public sources.
2.7. MTT Assay
The 3’-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazo-
lium bromide (MTT) assay were evaluated by a method
with slight modification. The porcine hepatocytes were
incubated at 37°C for the various time periods, then, 100
µl of MTT solution (5 mg/ml) was added to the cultures.
Two hours later, 500 µl of solvent (10% SDS) was added
to the cultures. After an overnight incubation, the ab-
sorbance of each well was measured using a microplate
reader at 570 nm and calculated as the concentration of
the Asc2P capable of reducing absorbance compared to
the untreated control. The porliferation of porcine hepa-
tocytes were determined as the number of viable cells
compared with the control.
2.8. Photographs of Cells
The cultured hepatocytes were photographed for the
time indicated on a phase-contrast microscope (Nikon
Optical Co., Japan).
Table 1. Polymerase chain reaction and sequencing primer: primers used for specific amplification.
Genes Primer sequence
(5’ - 3’)
Genbank
accession No.
Length of
PCR products
albumin TGTGTTGCTGATGAGTCAGC
TCAGCAGCAATGAGACAGAG X12422 883
GAPDH CCTTCATTGACCTCCACTACAT
CCAAAGTTGTCATGGATGACC U48832 400
albumin ATACACCCAGAAAGCACCTC
CACGAATTGTGCGAATGTCAC V01222 436
GAPDH GTGGCAAAGTGGAGATTGTTGCC
GATGATGACCCGTTTGGCTCC M32599 290
C/EBP-α GGTGGACAAGAACAGCAACG
AGGCACCGGAATCTCCTAGT AF103944 370
OTC CTCGTGTGTTGTCTAGCATG
TGAGGCGAGTAATCTGTCAG Y13045 660
arginase CTTGTTTCGGACTTGCTCGG
CACTCTATGTATGGGGGCTTA M14502 330
SVCT1 TACCTGACATGCTTCAGTGG
CGGCTGCCCACCTTGGTAAT AF410935 1037
SVCT2 GTCCATCGGTGACTACTA
ATGCCATCAAGAACACAGGA AF411585 114
Y. Kumaki et al. / Natural Science 2 (2010) 1264-1273
Copyright © 2010 SciRes. OPEN ACCESS
1267
3. RESULTS AND DISCUSSION
3.1. Effect of Asc2P on Albumin Secretion
We first examined the effect of Asc2P on porcine al-
bumin secretion from the culture fluids of porcine hepa-
tocytes. The porcine albumin secretion was augmented
by Asc2P (Figure 1). Albumin secretion rate was ap-
proximately 10-fold less in the absence or presence of
Asc2P on day 1 than in its presence on day 5, 32-fold
less than in its presence on day 7. The albumin secretion
rate in the presence of Asc2P was 1.4-fold that in con-
trols day 5 and 7 after plating. The enhancing effect had
been remained until day 20. However, Asc2P did not
affect the rat albumin secretion at all (Figure 2).
Mitaka et al. have reported that the rat small hepato-
cytes were proliferated for more than two months in the
medium contained 10 mM nicotinamide, 10% fetal bo-
vine serum, 1 mM Asc2P and 10 ng/ml epidermal
growth factor [14-17]. The albumin in the medium from
rat small hepatocytes increased with time in culture and,
was detected about 10 days after plating. Hino et al. also
0
50
100
150
200
250
0510152025
Days after plating
control
1.5 mM
Figure 1. Determination of porcine albumin secre-
tion. Asc2P was added to seeded porcine hepato-
cytes at different concentrations. The albumin se-
cretion into the medium was determined by ELISA
using the goat anti-pig albumin antibody.
0
25
50
75
100
0246810
Days after plating
control
1.5 mM
Figure 2. Determination of rat albumin secretion.
Asc2P was added to seeded rat hepatocytes at dif-
ferent concentrations. The albumin secretion into
the medium was determined by ELISA using the
rabbit anti-rat albumin antibody.
confirmed that the human small hepatocytes secreted
albumin of which level continued to increase during the
culture [18]. These human hepatocytes retained normal
liver functions at least for 70 days. We found the en-
hancing effect of Asc2P on albumin secretion released
into the culture medium from the porcine mature hepa-
tocytes.
3.2. Effect of Asc2P on Ammonium
Metabolic Activity
We next examined the effect of Asc2P on ammonium
metabolic activity of porcine and rat hepatocytes. When
the porcine hepatocytes were incubated in the presence
of Asc2P at concentration of 1.5 mM, the ammonium
metabolic activity was also increased (Figure 3). 1.5
mM Asc2P increased the ammonium metabolic rate
compared to the control from the day 4. This enhancing
effect had been remained until day 20. When rat hepa-
tocytes were treated with 1.5 mM Asc2P, the ammonuim
metabolic activity, however, was not increased (Figure
4). The ammonium metabolic rate became almost unde-
tectable in the medium irrespective of the presence or ab-
-0.3
0.0
0.3
0.6
0.9
1.2
1.5
0510 1520 25
Days after plating
control
1.5 mM
Figure 3. Asc2P was added to seeded porcine
hepatocytes at different concentrations. The ammo-
nium concentration was measured using a commer-
cial kit and the ammonium metabolic rate was cal-
culated.
-0.3
0.0
0.3
0.6
0.9
1.2
1.5
0246810
Days after plating
control
1.5 mM
Figure 4. Asc2P was added to seeded rat hepatocytes
at different concentrations. The ammonium concen-
tration was measured using a commercial kit and the
ammonium metabolic rate was calculated.
Y. Kumaki et al. / Natural Science 2 (2010) 1264-1273
Copyright © 2010 SciRes. OPEN ACCESS
1268
sence of Asc2P from day 5. Thus, the enhancing effect of
Asc2P on ammonium metabolic activity appeared not to
be related to rat hepatocytes.
3.3. Effect of Asc2P on Porcine Albumin
and C/EBP alpha mRNA Expression
We further tested whether Asc2P would affect the por-
cine albumin mRNA expression. Figure 5 (above)
showed that the agarose gel electrophoresis of the PCR
products revealed single band corresponding to porcine
albumin mRNA expression (883 bp). The clear bands
were detected when the porcine hepatocytes were treated
with Asc2P at the different concentrations on day 5 (lane
1 to 4) and 10 (lane 5). The thinner bands were detected
when the porcine hepatocytes were incubated in the
presence or absence of Asc2P on day 10 (lane 6 to 8), 15
(lane 9 to 11) and 20 (lane 13). The bands were not de-
tected on day 15 (lane 12) and 20 (lane 14 to 16). No
band was detected when PCR product was omitted from
the cDNA synthesis reaction (data not shown). The in-
tensities of bands were not changed on day 5, but
changed markedly on day 10, 15 and 20. The expression
of porcine GAPDH mRNA (400 bp) was also shown in
Figure 5 (below). GAPDH levels remained unchanged
in the presence or absence of Asc2P.
We also evaluated the effect of Asc2P on rat albumin
mRNA expression. As shown in Figure 6A (above),
agarose gel electrophoresis of the PCR products revealed
single band corresponding to rat albumin mRNA expres-
400 bp
883 bp
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
370 bp
Figure 5. Detection of porcine albumin (above), C/EBP alpha
(mid) and GAPDH (below) mRNA expression. Total RNA of
porcine hepatocytes treated with Asc2P was subjected to
RT-PCR, electrophoresed in agarose gel and stained with
ethidium bromide. Lanes 1 to 4, 5 to 8, 9 to 12 and 13 to 16
represent treatment of porcine hepatocytes with Asc2P after
incubation for 5, 10, 15 and 20 days, respectively. Concentra-
tions of Asc2P for each lane: 1, 5, 9 and 13, 15.0 mM; 2, 6, 10
and 14, 7.5 mM; 3, 7, 11 and 15, 1.5 mM; 4, 8, 12 and 16, 0.0
mM.
290 b
p
436 bp
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
Figure 6. Detection of rat albumin (above) and GAPDH (be-
low) mRNA expression. Lanes 1 to 4, 5 to 8, 9 to 12 and 13 to
16 represent treatment of rat hepatocytes with Asc2P after in-
cubation for 1, 4, 7 and 10 days, respectively. Concentrations
of Asc2P for each lane: 1, 5, 9 and 13, 15.0 mM; 2, 6, 10 and
14, 7.5 mM; 3, 7, 11 and 15, 1.5 mM; 4, 8, 12 and 16, 0.0 mM.
sion (436 bp). The clear bands were detected when the
rat hepatocytes had been treated with Asc2P at the dif-
ferent concentrations on day 1 and 4 (lane 1 to 8). The
thinner bands were detected on day 7 (lane 9 to 12). The
bands were not detected clearly on day 10 (lane 13 to
16). The intensities of bands were not changed markedly
when the rat hepatocytes had been plated in the presence
or absence of Asc2P. The effect of Asc2P on the expres-
sion of GAPDH mRNA (290 bp) was also as shown in
Figure 6 (below). GAPDH levels were unchanged as
well. The growth rate of both hepatocytes was not af-
fected at all by 15 mM Asc2P compared to 1.5 mM
Asc2P.
It has been previously reported that four different
kinds of transcription factors bind to closely spaced
binding sites of the albumin promoter [19-22], and three
different kinds of factors bind to four central binding
sites of the albumin enhancer [22,23]. The hepatocyte
nuclear factor family also played an important role in the
regulation of albumin synthesis [24,25]. In this experi-
ment, Asc2P might enhance the porcine albumin mRNA
at the step of transcription. For this, we further checked
the effect of Asc2P on porcine C/EBP alpha mRNA level.
As shown in the Figure 5 (mid), the enhancing effect of
Asc2P on porcine C/EBP alpha mRNA was also detected.
These data suggested that Asc2P was involved in the
regulation of porcine albumin mRNA level.
We observed the enhancing effect of Asc2P on albu-
min mRNA expression of porcine hepatocytes, but not
rat, using RT-PCR technique. Mitaka et al. had demon-
strated that the expression of albumin mRNA from the
rat mature hepatocytes was detected on day 1, but not on
day 5 and 10 [26]. Our findings are consistent with their
report. To ensure cDNA integrity and concentration,
which might differ each other between RNA samples,
the expression of the housekeeping gene GAPDH was
additionally quantified as an endogenous control. No
Y. Kumaki et al. / Natural Science 2 (2010) 1264-1273
Copyright © 2010 SciRes. OPEN ACCESS
1269
significant differences of GAPDH transcription were
found in both porcine and rat hepatocytes treated in the
presence or absence of Asc2P for the time indicated. It
has been reported recently that the ascorbate treatment
for 48 h at 50 mg/l was the best concentration in the
study for primary culture of chicken hepatpcyte with
non-serum L-15 medium [27].
In order to confirm the enhancing effect of Asc2P on
plating of porcine albumin mRNA expression, Hep G2
cells were plated in treatment conditions similar to those
shown in Figure 5 and 6. Hep G2 cells were treated
with Asc2P at 75, 37.5, 15, 1.5 and 0.0 mM for 4 days
and total RNA was isolated from them. Asc2P slightly
affected the cellular growth at a concentration of 75 mM
but was not cytotoxic to the cells under these condition.
Then RT-PCR analysis specific for porcine albumin and
mouse GAPDH primers was carried out. Computer-
directed densitometry was performed using NIH Image
Analysis 1.62 Software to determine the intensity of
each DNA band. Similar results were obtained when
Hep G2 cells had been treated with Asc2P (Figure 7).
The effect of Asc2P on the expression of GAPDH
mRNA is also shown in Figure 7, GAPDH levels were
also unchanged.
We also checked the effect of staurosporine, a potent
inhibitor of the protein kinase C (PKC) [28], on the en-
hancement of albumin mRNA induced by Asc2P using
Hep G2 cells. Staurosporine (50 nM) inhibited the en-
hancement of albumin mRNA by Asc2P, but hardly af-
fect cellular viability by the Asc2P-free control culture
(Figure 7). Thus Asc2P may exert its effect on albumin
mRNA through a system which is sensitive to stauro-
sporine. Little study has been done with respect to the
effect of Asc2P on the hepatocytes. Our experiments
suggested that the enhanced albumin mRNA by Asc2P
might be due to activation of tyrosine protein kinase
Concentrations of Asc2P (mM)
Amount of each PCR product determine
d
densitometrically (relative number)
0
3000
6000
9000
12000
15000
18000
001.51537.575
Asc2P on
albumin
Asc2P on
GAPDH
Asc2P +
Staurosporine
on albumin
Figure 7. Detection of porcine albumin and GAPDH mRNA
expression using Hep G2 cells. Hep G2 cells were seeded into
6-well plates containing indicated concentrations of Asc2P and
staurosporine. Total RNA of Hep G2 cells was isolated and
subjected to RT-PCR. The amount of each PCR product was
determined densitometrically.
and/or PKC. Because its enhancing effect was blocked
by a protein kinase inhibitor and the activation of protein
kinase is known to be necessary for promotion of tran-
scription, Asc2P may activate some protein kinase in
thecells that will lead to enhanced transcription of por-
cine albumin mRNA level.
3.4. Effect of Asc2P on the Urea Cycle
Ammonium metabolism is a complex process. The
structural basis of the process of enhancement by Asc2P
remains to be further understood. In this study, one ques-
tion that could be asked is whether Asc2P had a direct
effect on the urea cycle, or it enhanced the porcine al-
bumin mRNA level with which it interacted which in
turn affected the ammonium metabolism. We further
tested the effect of Asc2P on OTC and arginase mRNA
level. We noticed that porcine OTC mRNA was in-
creased from day 10 and arginase mRNA was increased
from day 20, suggesting that the Asc2P had a direct ef-
fect on OTC and arginase to increase their mRNA (Fig-
ure 8).
3.5. Effect of Asc2P on Porcine Collagen
Type I, III and XII
Extracellular matrix (ECM) is well known to play an
important role in the growth and differentiation of hepa-
tocytes [29]. Isolated mature hepatocytes become flat-
tened rapidly, and show dramatically reduced liver-
specific functions when the cells are cultured in plastic
dishes [30]. The hepatocytes can also retain their normal
cellular conditions and express certain differentiated
functions for prolonged times when they are cultured in
plastic dishes coated with a synthetic substratum [31].
However, dishes coated with high amounts of purified
ECM molecules do not appear to be sufficient to induce
330 bp
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
660 bp
Figure 8. Detection of porcine ornithine transcarbamylase
(above) and arginase (below) mRNA expression. Lanes 1 to 3,
4 to 6, 7 to 9, 10 to 12 and 13 to 15 represent treatment of por-
cine hepatocytes with Asc2P after incubation for 5, 10, 15, 20
and 25 days, respectively. Concentrations of Asc2P for each
lane: 1, 4, 7, 10 and 13, 15.0 mM; 2, 5, 8, 11 and 14, 1.5 mM;
3, 6, 9, 12 and 15, 0.0 mM; 16, the control.
Y. Kumaki et al. / Natural Science 2 (2010) 1264-1273
Copyright © 2010 SciRes. OPEN ACCESS
1270
hepatocyte differentiation [32]. Mitaka et al reported that
the small hepatocytes could differentiate to mature
hepatocytes by interacting with ECM [26]. Collagen
type I and type III are made by fibroblasts and
fat-storing (Ito) cells in normal liver were found to con-
tain collagens I and III [33,34]. Collagen Type XII, a
fibril-associated collagen, help to organize the fibrils in
some other tissues [34]. Since vitamin C is required for
the synthesis of collagen, our data showed that the por-
cine collagen type I and type III mRNA, but not type XII
mRNA, were detected as well (Figure 9), suggesting
that Asc2P did not have the effect on the non-parenchy-
mal hepatocytes to induce collagen type I and III mRNA
expression.
3.6. Effect of Asc2P on the Porcine
Sodium-Ascorbate Co-Transporters
SVCT1 and SVCT2
Vitamin C exists in two chemically distinct forms in
human plasma, the reduced ascorbate ion form (ascorbic
acid, AA) and the oxidized non-ionic form (dehy-
droascorbic acid, DHA). Human cells acquire both
chemical forms of vitamin C by transporting them across
cell membrane with the participation of two different
transporter systems that show absolute specificity for
one or the other vitamin form [35]. These two different
transporter systems are first transporter system, the fa-
cilitative glucose transporters for dehydroascorbic acid,
and second transporter system, the sodium-ascorbic acid
co-transporters for ascorbic acid. Second transport sys-
tem for vitamin C is a high affinity, low capacity sodium
dependent system (SVCTs) which corresponds to a re-
400 bp
500 bp
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
Figure 9. Detection of porcine collagen type I (above), type III
(mid) and type XII (below) mRNA expression. Lanes 1 to 3, 4
to 6, 7 to 9, 10 to 12 and 13 to 15 represent treatment of por-
cine hepatocytes with Asc2P after incubation for 5, 10, 15, 20
and 25 days, respectively. Concentrations of Asc2P for each
lane: 1, 4, 7, 10 and 13, 15.0 mM; 2, 5, 8, 11 and 14, 1.5 mM;
3, 6, 9, 12 and 15, 0.0 mM; 16, the control.
cently described family of mammalian sodium-ascorbic
acid co-transporters composed of two members, SVCT1
and SVCT2. These transporters display affinity for re-
duced vitamin C [35-39].
There is no information on the mechanism of vitamin
C transport across the intestinal barrier. It has been re-
cently reported that the colon carcinoma cell line
CaCo-2 was used as an in vitro model for vitamin C
transport and the RT-PCR analysis indicated that CaCo-2
cells express the sodium-ascorbate co-transporters SVCT1
and SVCT2 [40]. The human vitamin C transporters
expressed in COS-1 cells is regulated by protein kinase
C [41]. Our RT-PCR analysis showed that the porcine
hepatocytes expressed the sodium-ascorbate co-transpor-
ters SVCT1 and SVCT2, however, the intensities of por-
cine sodium-ascorbate co-transporters SVCT1 and
SVCT2 bands were not changed markedly (Figure 10).
These findings indicated that the Asc2P had no effect on
SVCT1 and SVCT2 mRNA expression.
3.7. Effect of Asc2P on MTT Assay
We further examined the effect of Asc2P on the pro-
liferative rate by MTT assay at the various concentra-
tions. A tetrazolium salt has been used to develop a
quantitative colorimetric assay for mammalian cell sur-
vival and proliferation. The assay detects living, but not
dead cells and the signal generated is dependent on the
degree of activation of the cells [42]. In this study, the
cellular growth and proleferation were significantly in-
creased by Asc2P during the long-term culture (data not
shown).
3.8. Phase-Contrast Microscopic
Observation
Liver cell suspensions were prepared and freshly iso-
lated cells were plated on type I collagen-coated 60-mm
1037 bp
M 1 2 3 4 5 6 7 8 9 10 11 12
114 bp
Figure 10. Detection of porcine sodium-ascorbate co-trans-
porters SVCT1 (above) and SVCT2 (below) mRNA expression.
Lanes 1 to 3, 4 to 6, 7 to 9 and 10 to 12 represent treatment of
porcine hepatocytes with Asc2P after incubation for 5, 10, 15
and 20 days, respectively. Concentrations of Asc2P for each
lane: 1, 4, 7 and 10, 15.0 mM; 2, 5, 8 and 11, 1.5 mM; 3, 6, 9
and 12, 0.0 mM.
Y. Kumaki et al. / Natural Science 2 (2010) 1264-1273
Copyright © 2010 SciRes. OPEN ACCESS
1271
Figure 11. Morphological variation of porcine hepatocytes treated with ascorbic acid 2-phosphate.
culture dishes. The hepatocytes were checked and pho-
tographed on a phase-contrast microscope. The hepato-
cytes displayed a normal spreading rate and began to
proliferate and scatter on day 3 and 4. The hepatocytes-
maintained their normal shapes until day 10. Thereafter,
the cells, which were not treated with Asc2P, were mor-
phologically changed compared to those treated with
Asc2P at 1.5 and 15 mM on day 15. In addition, not only
the cells untreated with Asc2P, but also those treated
with Asc2P at 1.5 mM were morphologically changed on
day 20 and 25. The hepatocytes began to be disappeared
gradually and the fibroblasts grew rapidly at this stage.
The hepatocytes, which had been treated with Asc2P at
15 mM, remained almost unchanged after further time in
this culture system (Figure 11).
We developed this culture method by which adult por-
cine hepatocytes can be maintained up to at least one
month. There was one important improvement in our
method. The cells cultured were the porcine mature
hepatocytes. Several types of bioartificial livers have
been deviced to treat patients with liver failures [43-45].
Demetriou et al. [43,44] and Sussman et al [45]. have
developed bioartificial livers that are clinically applica-
ble as a bridge to transplants. These investigators have
utilized porcine hepatocytes or a transformed human
liver cell line (Hep G3), which makes the use of these
devices limited to transient treatments. Further im-
provements of our method to grow porcine mature
hepatocytes should make it possible to obtain prolifera-
tive normal hepatocytes more effciently which can be
used to reconstruct bioartificial livers.
4. ACKNOWLEDGEMENTS
The authors are grateful to Dr. J. Kano (Tsukuba University) for
providing porcine C/EBP alpha cDNA and Dr. S. Miyaki (Tissue En-
gieering Research Center) for providing human collagen type I, III and
XII cDNAs. We also thank Mr. K. Sakurai and Ms. Y. Asanuma for
kindly providing technical assistance, and Ms. K. Miyazaki for excel-
lent secretarial help.
REFERENCES
[1] Tateno, C. and Yoshizato, K. (1999) Long-term cultiva-
tion of adult rat hepatocytes that undergo multiple cell
divisions and express normal parenchymal phenotypes.
American Journal of Pathology, 148, 383-392.
[2] Tateno, C. and Yoshizato, K. (1999) Growth potential
and differentiation capacity of adult rat hepatocytes in vi-
tro. Wound Repair Regen, 7, 36-44.
[3] Yamasaki, C., Tateno, C., Aratani, A., Ohnishi, C., Kata-
yama, S., Kohashi, T., Hino, H., Marusawa, H., Asahara,
T. and Yoshizato, K. (2006) Growth and differentiation of
colony-forming human hepatocytes in vitro. Journal of
Hepatology, 44, 749-757.
[4] Katsura, N., Ikai, I., Mitaka, T., Shiotani, T., Yamanoku-
chi, S., Sugimoto, S., Kanazawa, A., Terajima, H., Mo-
Day 10
Day 15
Day 25
0.0 mM 1.5 mM 15.0 mM
Day 20
Y. Kumaki et al. / Natural Science 2 (2010) 1264-1273
Copyright © 2010 SciRes. OPEN ACCESS
1272
chizuki, Y. and Yamaoka, Y. (2002) Long-term culture of
primary human hepatocytes with preservation of prolif-
erative capacity and differentiated functions. The Journal
of surgical research, 106, 115-123.
[5] Aden, D.P., Fogel, A., Plotkin, S., Damjanov, I. and
Knowles, B.B. (1979) Controlled synthesis of HBsAg in
a differentiated human liver carcinoma-derived cell line.
Nature, 282, 615-616.
[6] Knowles, B.B., Howe, C.C. and Aden, D.P. (1980) Hu-
man hepatocellular carcinoma cell lines secrete the major
plasma proteins and hepatitis B surface antigen. Science,
209, 497-499.
[7] Weinstock, J. and Baldwin, G.S. (1988) Nucleotide se-
quence of porcine liver albumin. Nucleic Acids Research,
16, 9045.
[8] Sargent, T.D., Yang, M. and Bonner, J. (1981) Nucleotide
sequence of cloned rat serum albumin messenger RNA.
Proceedings of National Academy of Science of the
United States of America, 78, 243-246.
[9] Sabath, D.E., Broome, H.E. and Prystowsky, M.B. (1990)
Glyceraldehyde-3-phosphate dehydrogenase mRNA is a
major interleukin 2-induced transcript in a cloned
T-helper lymphocyte. Gene, 91, 185-191.
[10] Ding, S.T., McNeel, R.L. and Mersmann, H.J. (1999)
Expression of porcine adipocyte transcripts: tissue dis-
tribution and differentiation in vitro and in vivo. Com-
parative Biochemistry and Physiology Part B: Biochem-
istry and Molecular Biology, 123, 307-318.
[11] Koger, J.B., Howell, R.G., Kelly, M. and Jones, E.E.
(1994) Purification and properties of porcine liver or-
nithine transcarbamylase. Archives of Biochemistry and
Biophysics, 309, 293-299.
[12] Haraguchi, Y., Takiguchi, M., Amaya, Y., Kawamoto, S.,
Matsuda, I. and Mori, M. (1987) Molecular cloning and
nucleotide sequence of cDNA for human liver arginase.
Proceedings of National Academy of Science of the
United States of America, 84, 412-415.
[13] Clark, A.G., Rohrbaugh, A.L., Otterness, I. and Kraus,
V.B. (2002) The effects of ascorbic acid on cartilage me-
tabolism in guinea pig articular cartilage explants. Matrix
Biology, 21, 175-184.
[14] Mitaka, T., Sattler, C.A., Sattler, G.L., Sargent, L.M. and
Pitot, H.C. (1991) Multiple cell cycles occur in rat hepa-
tocytes cultured in the presence of nicotinamide and epi-
dermal growth factor. Hepatology, 13, 21-30.
[15] Mitaka, T., Mikami, M., Sattler, G.L., Pitot, H.C. and
Mochizuki, Y. (1992) Small cell colonies appear in the
primary culture of adult rat hepatocytes in the presence
of nicotinamide and epidermal growth factor. Hepatology,
16, 440-447.
[16] Mitaka, T., Kojima, T., Mizuguchi, T. and Mochizuki, Y.
(1995) Growth and maturation of small hepatocytes iso-
lated from adult rat liver. Biochemical and biophysical
research communications, 214, 310-317.
[17] Mitaka, T., Mizuguchi, T., Sato, F., Mochizuki, C. and
Mochizuki, Y. (1998) Growth and maturation of small
hepatocytes. Journal of Gastroenterology Hepatology, 13,
S70-77.
[18] Hino, H., Tateno, C., Sato, H., Yamasaki, C., Katayama,
S., Kohashi, T., Aratani, A., Asahara, T., Dohi, K. and
Yoshizato, K. (1999) A long-term culture of human hepa-
tocytes which show a high growth potential and express
their differentiated phenotypes. Biochemical and Bio-
physical Research Communications, 256, 184-191.
[19] Babiss, L.E., Herbst, R.S., Bennett, A.L. and Darnell, Jr.,
J.E. (1987) Factors that interact with the rat albumin pro-
moter are present both in hepatocytes and other cell types.
Genes Development, 1, 256-267.
[20] Cereghini, S., Raymondjean, M., Carranca, A.G., Her-
bomel, P. and Yaniv, M. (1987) Factors involved in con-
trol of tissue-specific expression of albumin gene. Cell,
50, 627-638.
[21] Lichtsteiner, S., Wuarin, J. and Schibler, U. (1987) The
interplay of DNA-binding proteins on the promoter of
the mouse albumin gene. Cell, 51, 963-973.
[22] Liu, J.K., DiPersio, C.M. and Zaret, K.S. (1991) Ex-
tracellular signals that regulate liver transcription factors
during hepatic differentiation in vitro. Molecular Cell Bi-
ology, 11, 773-784.
[23] Herbst, R.S., Friedman, N., Darnell, J.E. and Babiss, Jr.,
L.E. (1989) Positive and negative regulatory elements in
the mouse albumin enhancer. Proceedings of National
Academy of Science of the United States of America, 86,
1553-1557.
[24] Pontoglio, M., Barra, J., Hadchouel, M., Doyen, A.,
Kress, C., Bach, J.P., Babinet, C. and Yaniv, M. (1996)
Hepatocyte nuclear factor 1 inactivation results in hepatic
dysfunction, phenylketonuria, and renal Fanconi syn-
drome. Cell, 84, 575-585.
[25] Samadani, U. and Costa, R.H. (1996) The transcriptional
activator hepatocyte nuclear factor 6 regulates liver gene
expression. Molecular Cell Biology, 16, 6273-6284.
[26] Mitaka, T., Sato, F., Mizuguchi, T., Yokono, T. and Mo-
chizuki, Y. (1999) Reconstruction of hepatic organoid by
rat small hepatocytes and hepatic nonparenchymal cells.
Hepatology, 29, 111-125.
[27] Sasaki, K., Kitaguchi, Y., Fukuda, T. and Aoyagi, Y.
(2000) Ascorbic acid supplementation to primary culture
of chicken hepatocytes with non-serum medium. The In-
ternational Journal of Biochemistry & Cell Biology, 32,
967-973.
[28] Seki, J., Ikeda, R. and Hoshino, H. (1996) Dimethyl sul-
foxide and related polar compounds enhance infection of
human T cells with HIV-1 in vitro. Biochemical and bio-
physical research communications, 227, 724-729.
[29] Stamatoglou, S.C. and Hughes, R.C. (1994) Cell adhe-
sion molecules in liver function and pattern formation.
The FASEB Journal, 8, 420-427.
[30] Bissell, D.M., Arenson, D.M., Maher, J.J. and Roll, F.J.
(1987) Support of cultured hepatocytes by a laminin-rich
gel. Evidence for a functionally significant subendothe-
lial matrix in normal rat liver. The Journal of Clinical
Investigation, 79, 801-812.
[31] Tobe, S., Takei, Y., Kobayashi, K. and Akaike, T. (1992)
Receptor-mediated formation of multilayer aggregates of
primary cultured adult rat hepatocytes on lac-
tose-substituted polystyrene. Biochemical and Biophysi-
cal Research Communications, 184, 225-230.
[32] Sudhakaran, P.R., Stamatoglou, S.C. and Hughes, R.C.
(1986) Modulation of protein synthesis and secretion by
substratum in primary cultures of rat hepatocytes. Ex-
perimental Cell Research, 167, 505-516.
[33] Bentley, S.A. (1982) Collagen synthesis by bone marrow
stromal cells: A quantitative study. British Journal of
Y. Kumaki et al. / Natural Science 2 (2010) 1264-1273
Copyright © 2010 SciRes. OPEN ACCESS
1273
Haematology, 50, 491-497.
[34] Vuorio, E. and de Crombrugghe, B. (1990) The family of
collagen genes. The Annual Review of Biochemistry, 59,
837-872.
[35] Daruwala, R., Song, J., Koh, W.S., Rumsey, S.C. and
Levine, M. (1999) Cloning and functional characteriza-
tion of the human sodium-dependent vitamin C trans-
porters hSVCT1 and hSVCT2. FEBS Letters, 460,
480-484.
[36] Faaland, C.A., Race, J.E., Ricken, G., Warner, F.J., Wil-
liams, W.J. and Holtzman, E.J. (1998) Molecular charac-
terization of two novel transporters from human and
mouse kidney and from LLC-PK1 cells reveals a novel
conserved family that is homologous to bacterial and
Aspergillus nucleobase transporters. Biochimica et Bio-
physica Acta, 1442, 353-360.
[37] Tsukaguchi, H., Tokui, T., Mackenzie, B., Berger, U.V.,
Chen, X.Z., Wang, Y., Brubaker, R.F. and Hediger, M.A.
(1999) A family of mammalian Na+-dependent
L-ascorbic acid transporters. Nature, 399, 70-75.
[38] Wang, H., Dutta, B., Huang, W., Devoe, L.D., Leibach,
F.H., Ganapathy, V. and Prasad, P.D. (1999) Human
Na(+)-dependent vitamin C transporter 1 (hSVCT1):
primary structure, functional characteristics and evidence
for a non-functional splice variant. Biochimica et Bio-
physica Acta, 1461, 1-9.
[39] Wang, Y., Mackenzie, B., Tsukaguchi, H., Weremowicz,
S., Morton, C.C. and Hediger, M.A. (2000) Human vita-
min C (L-ascorbic acid) transporter SVCT1. Biochemical
and Biophysical Research Communications, 267, 488-
494.
[40] Maulen, N.P., Henriquez, E.A., Kempe, S., Carcamo, J.G.,
Schmid-Kotsas, A., Bachem, M., Grunert, A., Busta-
mante, M.E., Nualart, F. and Vera, J.C. (2003)
Up-regulation and polarized expression of the so-
dium-ascorbic acid transporter SVCT1 in post-confluent
differentiated CaCo-2 cells. The Journal of Biological
Chemistry, 278, 9035-9041.
[41] Liang, W.J., Johnson, D., Ma, L.S., Jarvis, S.M. and
Wei-Jun, L. (2002) Regulation of the human vitamin C
transporters expressed in COS-1 cells by protein kinase
C [corrected]. American Journal of Physiology Cell
Physiology, 283, C1696-1704.
[42] Mosmann, T. (1983) Rapid colorimetric assay for cellular
growth and survival: application to proliferation and cy-
totoxicity assays. The Journal of Immunological Methods,
65, 55-63.
[43] Watanabe, F.D., Mullon, C.J., Hewitt, W.R., Arkadopou-
los, N., Kahaku, E., Eguchi, S., Khalili, T., Arnaout, W.,
Shackleton, C.R., Rozga, J., Solomon, B. and Demetriou,
A.A. (1997) Clinical experience with a bioartificial liver
in the treatment of severe liver failure. A phase I clinical
trial. Annals of Surgery, 225, 484-491.
[44] Detry, O., Arkadopoulos, N., Ting, P., Kahaku, E., Wata-
nabe, F.D., Rozga, J. and Demetriou, A.A. (1999) Clini-
cal use of a bioartificial liver in the treatment of aceta-
minophen-induced fulminant hepatic failure. Annals of
Surgery, 65, 934-938.
[45] Ellis, A.J., Hughes, R.D., Wendon, J.A., Dunne, J., Lang-
ley, P.G., Kelly, J.H., Gislason, G.T., Sussman, N.L. and
Williams, R. (1996) Pilot-controlled trial of the extra-
corporeal liver assist device in acute liver failure. Hepa-
tology, 24, 1446-1451.