Direct pre-differentiation of rat mesenchymal stem cells into dopaminergic cells

doi:10.4236/scd.2013.32018

Paper Menu >>

Journal Menu >>

Vol.3, No.2, 133-138 (2013) Stem Cell Discovery

http://dx.doi.org/10.4236/scd.2013.32018

Direct pre-differentiation of rat mesenchymal stem

cells into dopaminergic cells

Judith Zavala-Arcos1, Maria Teresa Gonzalez-Garza1*, Janet Gutierrez-Alcala1,

Hector R. Martinez2, Jorge E. Moreno-Cuevas1

1Servicio de Terapia Celular, School of Medine and Health, CITES, Tecnológico de Monterrey, Monterrey, México;

*Corresponding author: [email protected]

2Servicio de Neurologia, Hospital San José Tec de Monterrey, Monterrey, México

Received 19 February 2013; revised 25 March 2013; accepted 15 April 2013

cense, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

ABSTRACT

The use of stem cells has been proposed as an

alternative treatment for certain neurodegenera-

tive disorders. It has also be en suggested th at in

the pre-differentiated state, stem cells might

provide a better therapeutic option than cells

that are undifferentiated or fully differentiated.

The purpose of this study was to develop a

protocol aimed at reducing the incubation time

required to induce the conversion of rat mes-

enchymal stem cells into immature dopaminer-

gic neurons. Stem cells obtained from rat bone

marrow were incubated in a control or induction

media for 2 - 24 h. Cells incubated for 24 h in

induction medium demonstrated an increase on

the levels of the neuronal protein markers nestin,

glial fibrillary acid protein, and β-tubulin III, as

well as increases in the expression of Pax3, EN1,

Thy1.1, and GEF10 genes. This manuscript pre-

sent s evidence that adult mesenchy mal cells are

capable to respond, in a short time period, to a

neuroinduction medium, and give raise to pre-

differentiated neuron like cells representing an

alternative for Parkinson disease cell therapy

transplantation.

Keywords: Cell Differentiation; Dopamine

Producing Ce l ls; N euro-Differentiation; Parkinson’s

Disease; Stem Cells

1. INTRODUCTION

Parkinson disease is a major neurodegenerative dis-

ease of the nervous system. It is characterized by motor

disability as a consequence of nigral neuronal death [1].

Pharmacological correction of the brain dopamine deficit

constitutes the first line of treatment for affected patients.

Unfortunately, this therapy does not stop the progression

of the disease. Other treatment options include deep sur-

gical brain stimulation [2]. Cell therapy has been pro-

posed as an alternative for treatment of this neurodegen-

erative disorder due to the fact that significant clinical

signs are caused by specific and selective loss of ni-

grostriatal dopaminergic neurons. The possibility of re-

placing those cells has been explored through the trans-

plantation of embryonic stem cells (ESCs), fetal stem

cells, induced pluripotential stem cells (iPSCs), and

mesenchymal stem cells (MSCs) in animal models. Of

these, ESCs proved to be capable to differentiate into

dopaminergic neurons, after transplantation into the

striatum in Parkinson disease rat models [3-6]. Human

clinical trials reported variable responses; in patients

implanted with ESCs into the putamen, significant clini-

cal improvements were observed based on standardized

tests for Parkinson disease [7]. Improvements have been

assessed in human subjects by either evaluations in their

motor function, or by the reduction of daily L-dopa dos-

ing [8-9]. However, this approach has not been widely

accepted. Besides ethical concerns, a large amount of

tissue is needed for each patient, because only 3% - 20%

of transplanted cells survive [10-12].

Reprogramm ing s omat ic cells to pluri pot ency gi ves the

opportunity to obtain iPSCs as a viable alternative for cell

therapy in patients with Parkinson disease [13-15]. Al-

though important results have been obtained with ESCs,

fetal stem cells and iPSCs, these cells present ethical and

genetic problems that need to be fully addressed before

they could be considered for clinical application.

On the other hand, MSCs do not present any of those

ethical concerns. To prove its possible efficacy as an al-

ternative treatment for Parkinson disease, several studies

have been performed in an animal model. Results

showed that grafted undifferentiated human MSCs ex-

erted neuroprotective effects against nigrostriatal degen-

J. Zavala-Arcos et al. / Stem Cell Discovery 3 (2013) 133-138

134

eration induced by 6-hydroxydopaminehydr obromide (6-

OHDA), but did not transform into functional dopa-

miner gi c neu rons [16,17].

Although MSCs do not present ethical concern, it has

been reported that prolonged in vitro culture could in-

creased genetic and epigenetic abnormalities, therefore, it

is important to consider their use on the first passages

[18]. The general aim of this study was to develop a pro-

tocol to induce rat bone marrow MSCs conversion into

immature neural dopaminergic-like cells in short time

periods.

2. METHODS

2.1. Ethics Statement

Animal studies were performed after approved by the

Animal Ethics Committee from the Medical School at

the “Instituto Tecnológico y de Estudios Superiores de

Monterrey” (ITESM), Reg. 2009-Re-001. All surgeries

performed in the animals were under anesthesia and all

efforts were made to minimize animal suffering. Animals

were housed five per cage at 20˚C - 22˚C on a 12/12 h

light/dark cycle, with food and water ad libitum.

2.2. Mesenchymal Cell Isolation and Culture

MSCs were obtained from adult male Wistar rats,

weighing ~220 g. Hank’s balanced salt solution (Gibco,

Grand Island, NY) was used to extrude the bone marrow

from femurs and the suspension was filtered using a 70

μm pore size cell strainer (BD Falcon, Bedford, MA).

After centrifugation, cells were resuspended in Dul-

becco’s modified Eagle’s medium (DMEM-F12; Gibco)

containing 20% fetal bovine serum (FBS; Gibco) and 1%

antibiotics (streptomycin-penicillin) (Gibco). Cells were

seeded in 100 mm culture dishes (Corning Inc., New

York, NY) at 37˚C and 5% CO2 in a humid chamber for

24 h. To remove nonadherent cells, cultures were washed

with phosphate-buffered saline (PBS; pH 7.4) and the

culture medium was replaced with DMEM-F12 contain-

ing 10% FBS and 1% antibiotics.

2.3. Control Medium (CM)

Before induction, cells on their fourth passage were

placed in DMEM-F12 containing 5% FBS and 1% anti-

biotics for 24 h, which was used as the CM. Cells were

then washed with PBS (pH 7.4) and the medium was

replaced with induction medium (IM).

2.4. Induction Medium (IM)

IM consisted of CM plus 0.1 μM RA (Sigma-Aldrich,

St. Louis, MO), 1 mM

-mercaptoethanol (Sigma-Al-

drich), 2 mM glutamine (Invitrogen, Grand Island, NY),

10 ng/mL fibroblast growth factor 8 (FGF8) (Sigma-

Aldrich), 0.2% dimethyl sulfoxide (Sigma-Aldrich), 40

ng/mL of epithelial growth factor (Invitrogen), 0.5 mM

3-isobutyl-1-methylxanthine (Sigma-Aldrich), 5 μg/mL

insulin-transferrin-selenium (Gibco), 2 μg/mL heparin

(Pisa, Guadalajara, Jal, Mexico), 10 ng/mL brain-derived

neurotrophic factor (Invitrogen), 4.5 mg/mL glucose

(Sigma-Aldrich ) and 10 ng /mL of son ic he dgehog ( SHH)

protein (R& D Sy st ems, Minneapolis, MN ).

2.5. Immunocytochemistry

Circular glass slides treated with poly-L-lysine

(Sigma-Aldrich) were placed in 24-well microplates

(Corning Inc.) for immunocytochemistry and cells were

cultured at a density of 1 × 105 cells/well for 2 or 24 h.

Cells were fixed in 4% paraformaldehyde for 10 min and

were washed three times with PBS (pH 7.4). Cells were

permeabilized using 0.3% Triton X-100 in PBS for 5 min.

Non-specific antibody reactions were blocked with 5%

BSA in PBS for 1 h. Next, cells were incubated over-

night at 4˚C with primary mouse monoclonal antibodies

diluted in PBS containing 1% BSA. The used mono-

clonal mouse antibodies and dilutions were anti-nestin

(10 μg/mL; R&D Systems), anti-glial fibrillary acid pro-

tein (GFAP) (5 μg/mL; Chemicon International Inc.,

Billerica, MA), anti-conjugated dopamine (1:5000; Se-

rotec, Kidlington, Oxford, UK) and anti-

-tubulin III

(1:2000; Promega, Madison, WI). Cells were washed

three times with PBS and incubated with secondary goat

anti-mouse Fc-fluorescein isothiocyanate (1:400; Thermo

Fisher Scientific, Pierce Biotechnology, Rockford, IL)

for 2 h in the dark. Cells were incubated for 1 min in

propidium iodide (0.01 mg/mL; Fluka, Toluca, Mexico)

to counterstain the nuclei. Cells were analyzed using a

fluorescence microscope (Imager Z1; Zeiss, Jena, Ger-

many). Images were obtained using an Axiocam HRm

camera system (Zeiss, New York, NY) coupled to the

microscope.

2.6. RNA Isolation and Reverse

Transcription Polymerase Chain

Reaction (RT-PCR)

MSCs were cultured in six-well microplates (Corning

Inc.) treated with poly-L-lysine at a density of 5 × 105

cells/well for 2 or 24 h. Total RNA was isolated from

undifferentiated mesenchymal cells and cells incubated

in induction media using a binding silica column kit

(GenElute Mammalian Total RNA; Sigma-Aldrich). The

amount and quality of RNA was determined using a

GeneQuant pro spectrophotometer (Amersham Biosci-

ences, Cambridge, UK). RT-PCR was performed using a

PX2 Thermo thermal cycler (Thermo Fisher Scientific),

one-step reactions (Qiagen, Crawley, UK). All primers

were obtained from MWG-Biotech, Huntsville, A L , USA ,

and are described on Table 1.

J. Zavala-Arcos et al. / Stem Cell Discov ery 3 (2013) 133-138

135

Table 1. Primers used for RT-PCR gene detection.

Gene Sense Antisense

GAPDH GGTGAAGGTCGGTGTGA CATGAGCCCTTCCACGA

En1 TCAAAACTGACTCGCAGCA ACTCCGCCTTGAGTCTCTGC

Pax3 GCCTCAGACCGACTATGCTC CCACGGCTTACTTTGTCCAT

Thy1.1 CAGGGCTGCTGTCTTCCTAC GGGCTGTCCAGTACGTCAAT

AADC GGATTCAGGGCTTATCACTGACTACC TTCATTCACTTTGTTGGAACCCTTTAGC

Aldh1 TGTTAGCTGATGCCGACTTG TTCTTAGCCCGCTCAACACT

GEF10 CAGGGCTGCTGTCTTCCTAC GGGCTGTCCAGTACGTCAAT

The GAPDH gene served as an internal control.

RT-PCR reactions were performed in a final volume of

50 μL using 1 μg of total RNA, according to the Qiagen

One-Step RT-PCR protocol. Reverse transcription was

performed at 50˚C for 30 min. PCR conditions were:

activation at 95˚C for 1 min, 35 cycles of amplification

(1 min at 94˚C, 1 min at 60˚C (54.6˚C for GAPDH) and

1 min at 72˚C) and 10 min at 72˚C for final extension.

PCR reactions were resolved on 2% agarose gels. The

bands were observed under ultraviolet (UV) light and

photographed in a UVP High Performance UV Transil-

luminator (Di g iDocIt, Cambridge, UK).

3. RESULT S Figure 1. Immunofluorescence microscopy of MSCs cultured

in control medium or induction medium. (A) Nestin detection

(green) in cells incubated in control medium; (B) Cells incu-

bated in induction medium for 2 h and (C) cells incubated in

induction medium for 24 h; (D) Tubulin detection (green) in

cells incubated in control medium; (E) in induction medium for

2 h and (F) in induction medium for 24 h; (G) Glial fibrillary

acid protein (GFAP) detection in cells incubated in control

medium; (H) in induction medium for 2 h and (I) in induction

medium for 24 h. Nuclei are counterstained with propidium

iodide (red).

3.1. Immunocytochemical Detection of

Neural Proteins

Immunohistochemistry was performed to determine

whether an association existed between the morphologi-

cal changes observed in cells, and the expression of pro-

teins related to neural lineages. Fluo rescence microscopy

analysis showed a slight po sitive nestin signal around the

nuclei of MSCs cultured in CM (Figure 1(A)). Some

MSCs incubated with IM showed a significant increase

in nestin after 2 h of induction (Figure 1(B)). After 24 h

of incubation in IM, most of the MSCs showed positive

expression for nestin in the cytoplasm (Figure 1(C)).

Immunocytochemistry for

-tubulin III showed a similar

distribution: some of the MSCs incubated in CM showed

a thin fibrous pattern surrounding the nucleus (Figure

1(D)). After 2 h in IM, most of the MSCs became posi-

tive (Figure 1(E)) and those incubated in IM for 24 h

showed a marked increase in the fibrous pattern

throughout the cytoplasm (Figure 1(F)). Immunochem-

istry for GFAP showed an abundant expression of the

protein, even in MSCs incubated in CM (Figure 1(G)).

After 2 h, this staining became more abundant (Figure

1(H)) and after 24 h of incubation in IM, abundant GFAP

distribution throughout the cytoplasm was observed, al-

lowing us even to detect dendritic extensions on the cell

surface as well as cell interconnections (Figure 1(I)). Do-

pamine detection was negative on MSCs cultured in CM

as well as in MSCs incubated in IM for 2 h; however,

after 24 h, the neurotransmiter was detected inside small

cytoplasm vesicles (Figur e 2).

3.2. Expression of Neural Genes

We evaluated the expression of genes for the following

neural markers: Pax3, En1, GEF10 and Aldh1. Results

showed positive expression for Pax3 and En1 in cells

cultured in CM, as well as in IM, without apparent in-

creases in the expression of those genes as a result of

incubation in either medium. GEF10 gene expression

was not detected from cells cultured in CM or IM after 2

h; however, after culture in IM for 24 h, expression was

detected. Expression of the gene for Aldh1 was not de-

tected with any medium on cells. The cells were also ana-

OPEN AC CESS

J. Zavala-Arcos et al. / Stem Cell Discovery 3 (2013) 133-138

136

Figure 2. Immunofluorescence detection of dopamine in MSCs.

(A) MSCs after 2 h of culture in induction medium. No dopa-

mine was detected. Propidium iodide was used to counterstain

nuclei (orange); (B) Representative images showing the pres-

ence of conjugated dopamine (green) in MSCs cultured in ex-

perimental media to induce neurodifferentiation; dopamine

immunostaining appears as small vesicles (arrows) in the cyto-

plasm. Scale bar = 20 μm.

lyzed for AADC and Thy1.1 gene expression to de termine

whether they belonged to a dopaminergic lineage. Gel

analysis showed positive expression levels for Thy1.1 in

cells incubated in IM for 24 h. AADC gene expression

was negative for all media (Figure 3).

4. DISCUSSION

Previous studies with adult hMSCs have demonstrated

that these cells express neural genes at low, nonfunc-

tional basal levels, suggesting that they have a neural

predisposition [19]. Several culture media have been

proposed to induce MSCs into neuron-like cells. Those

media have been supplemented with chemicals and bio-

logical growth factors, such as DMSO, SHH, FGF8 and

RA. Media containing chemicals such as DMSO have

raised some questions about the effective differentiation

observed in terms of cell morpholog y. Authors claim that

these morphological changes could be artifacts induced

by the direct effect of this compound on the cytoskeleton

[20]. Regardless of this presumption, it has been demon-

strated that such changes in the cytoskeleton can stimu-

late the expression of neural genes [21-24]. Nevertheless,

in order to avoid these possible toxic and artificial effects,

DMSO concentrations included in the IM were reduced

by one order of magnitude from that previously reported

to induce morphological changes [20] in the present

study. The IM used in our protocol also contained SHH

and FGF8. It has been shown that during mammalian

embryogenesis, an interaction between SHH and FGF8

induces the development of the most important dopa-

mine-synthesizing areas: the substantia nigra and the

ventral tegmental area (VTA) [25,26]. SHH signaling

also plays a role in axonal projection of dopaminergic

neurons from the substantia nigra and the VTA to rostral

target tissue, which plays an essential role in mammalian

motor neurons [27]. Another factor added to our IM was

BDNF, which plays a role in phenotypic maturation and

increases the survival of dopaminergic neurons in the

Figure 3. Reverse transcription polymerase

chain reaction (RT- PCR) assays for En1, Pax3,

Thy1.1, GEF10 and GAPDH expressions. (CM)

RT-PCR from MSCs cultured in control me-

dium. (IM) RT-PCR from MSCs cultured in

induction medium for 2 h and 24 h. En1 ex-

pression was detected in all media, as well as

Pax3. Thy1.1 and GEF10 were only detected

after 24 h of incubation in induction medium.

developing substantia nigra [28,29]. This evidence infers

that the presence of BDNF, SHH, and FGF8 in IM may

have enhanced the expression of dopaminergic neural

markers.

After 2 h of incubation in IM, there were some mor-

phological changes and an increased concentration of

neural markers such as GFAP,

-tubulin III, and nestin.

After 24 h of cultiv ation with IM, no t only th ose pro teins

showed a notable concentration increase but the expres-

sion of the genes encoding TH, GEF 10 and Pax3 were

also detected. We looked for the presence of these pro-

teins for their known participation during neuron differ-

entiation.

Pax3 plays an important role in pattern formation in

the vertebrate central nervous system and in the mor-

phological differentiation of neural cells [30,31], as well

as in the production of tyrosine hydroxylase. Tyrosine

hydroxylase is the rate-limiting enzyme for dopamine

synthesis in mature dopaminergic neurons [32]. GEF10

belongs to the guanine nucleotide exchange factor family

and plays a role in the connectivity and morphogenesis

of neural cells, including axonal growth, dendrite elabo-

ration, plasticity, and synapse formation [33,34]. En1

maintains the survival of mature midbrain dopaminergic

neurons in a terminal differentiation state during neuro-

genesis [35]. In this study, cells were positive for the

intermediate filament, nestin, which is expressed during

the early developmental stage by neural progenitor cells

and downregulated upon differentiation [30,35]. This

J. Zavala-Arcos et al. / Stem Cell Discov ery 3 (2013) 133-138 137

could reflect an ongoing stage of maturity of cells cul-

tured in IM for 24 h.

The presence of all of those markers indicates an im-

mature neuronal state, which is desirable for transplanta-

tion programs, for it has been reported that immature

cells could be a better therapeutic option than mature

cells in allowing engraftment [36,37]. It is noteworthy

that cells cultured for 2 4 h in IM showed conjugated do-

pamine distributed in smaller cytoplasmic inclusions

detected by immunocytochemistry and this was consis-

tent with an elevated expression of Thy1.1, according to

our RT-PCR analysis. However, further research using

specific markers of dopamine vesicles such as vesicular

monoamine transporter 2 is required to verify whether

the visualized deposits are presynaptic vesicles.

More detailed experiments are required to elucidate

the pathway by which dopamine is synthesized in in-

duced MSCs.

Aldh1 is an enzyme related to RA synthesis and is a

marker of midbrain dopaminergic neurons in the late

stages of fetal development and adulthood [36]. This

marker was not detected in MSCs or in pre-differentiated

MSCs, suggesting that these MSC-derived dopaminergic

neurons did not exhibit a complete midbrain identity.

However, neurogenesis in adult progenitors cannot be

fully compared with developmental neurogenesis for the

former is solely under environmental control whereas the

latter is coordinated by morphogenetic signaling mole-

cules produced by localized signaling centers [25].

Methods that combine chemicals with neurotrophic

factors have been reported to result in the expression of

neural markers, such as Tuj-1, GFAP, NSE, nestin, and

NF [38]. However, these treatments require long culture

times (3 - 14 d) or multistep differentiation protocols. In

the present study, cells incubated in our medium allowed

us to obtain immature dopaminergic cells in a short time

(48 h), representing an advantage for autologous or het-

erologous transplantation procedures in terms of elimi-

nating excessive manipulation of cells and prolonged

culture times.

5. CONCLUSION

Although further studies are needed to verify its full

efficacy in animal model, the results are encouraging for

the use of pre-differentiated MSCs, as a possible alterna-

tive for Parkinson’s disease cell therapy.

6. ACKNOWLEDGEMENTS

This work was partially funded by endowments from ITESM

(cat-134) and the Zambrano-Hellion Foundation. The funders had no

role in study design, data collection and analysis, decisi o n t o p u bl i s h , or

preparation of the manuscript. No additional external funding was

received for this study. The authors express their appreciation to Rosa

Maria de la Rosa for technical assistance.

REFERENCES

[1] Mizuno, Y., Hattori, N., Kubo, S., et al. (2008) Progress

in the pathogenesis and genetics of Parkinson’s disease.

Philosophical Transactions of the Royal Society B: Bio-

logical Sciences, 363, 2215-2227.

doi:10.1098/rstb.2008.2273

[2] Savitt, J.M., Dawson, V.L. and Dawson, T.M. (2006)

Diagnosis and treatment of Parkinson disease: Molecules

to medicine. Journal of Clinical Investigation, 116,

1744-1754. doi:10.1172/JCI29178

[3] Bjorklund, L.M., Sánchez-Pernaute, R., Chung, S., et al.

(2002) Embryonic stem cells develop into functional

dopaminergic neurons after transplantation in a Parkinson

rat model. Proceedings of the National Academy of Sci-

ences of the United States of America, 99, 2344-2349.

doi:10.1073/pnas.022438099

[4] Cho, Y.H., Kim, D.S., Kim, P.G., Hwang, et al. (2006)

Dopamine neurons derived from embryonic stem cells ef-

ficiently induce behavioral recovery in a Parkinsonian rat

model. Biochemical and Biophysical Research Commu-

nications, 341, 6-12. doi:10.1016/j.bbrc.2005.12.140

[5] Mine, Y., Hayashi, T., Yamada, M., Okano, H. and

Kawase, T. (2009) Environmental cue-dependent dopa-

minergic neuronal differentiation and functional effect of

grafted neuroepithelial stem cells in parkinsonian brain.

Neurosurgery, 65, 741-753.

doi:10.1227/01.NEU.0000351281.45986.76

[6] Ben-Hur, T., Idelson, M., Khaner, H., et al. (2004) Trans-

plantation of human embryonic stem cell-derived neural

progenitors improves behavioral deficit in Parkinsonian

rats. Stem Cells, 22, 1246-1255.

doi:10.1634/stemcells.2004-0094

[7] Freed, C.R., Greene, P.E., Breeze, R.E., et al. (2001)

Transplantation of embryonic dopamine neurons for se-

vere Parkinson’s disease. New England Journal of Medi-

cine, 344, 710-719. doi:10.1056/NEJM200103083441002

[8] Kordower, J.H., Freeman, T.B., Snow, B.J., et al. (1995)

Neuropathological evidence of graft survival and striatal

reinnervation after the transplantation of fetal mesence-

phalic tissue in a patient with Parkinson’s disease. New

England Journal of Medicine, 332, 1118-1124.

doi:10.1056/NEJM199504273321702

[9] Brundin, P., Pogarell, O., Hagell, P., et al. (2000) Bilateral

caudate and putamen grafts of embryonic mesencephalic

tissue treated with lazaroids in Parkinson’s disease. Brain,

123, 1380-1390. doi:10.1093/brain/123.7.1380

[10] Piccini, P., Pavese, N., Hagell, P., et al. (2005) Factors

affecting the clinical outcome after neural transplantation

in Parkinson’s disease. Brain, 128, 2977-2986.

doi:10.1093/brain/awh649

[11] Chu, Y., & Kordower, J.H. (2010) Lewy body pathology

in fetal grafts. Annals of the New York Academic of Sci-

ence, 1184, 55-67.

d oi:10.1111/j.1749-6632.2009.05229.x

J. Zavala-Arcos et al. / Stem Cell Discovery 3 (2013) 133-138

138

[12] Li, J.Y., Englund, E., Widner, H., et al. (2010) Charac-

terization of lewy body pathology in 12- and 16-year-old

intrastriatal mesencephalic grafts surviving in a patient

with Parkinson’s disease. Movement Disorder, 25, 1091-

1096. doi:10.1002/mds.23012

[13] Vierbuchen, T., Ostermeier, A., Pang, Z.P., Kokubu, Y.,

Südhof, T.C. and Wernig, M. (2010) Direct conversion of

fibroblasts to functional neurons by defined factors. Na-

ture, 463, 1035-1041. doi:10.1038/nature08797

[14] Pfisterer, U., Kirkeby, A., Torper, O., et al. (2011) Direct

conversion of human fibroblasts to dopaminergic neurons.

Proceedings of the National Academy of Sciences of the

United States of America, 108, 10343-10348.

doi:10.1073/pnas.1105135108

[15] Pang, Z.P., Yang, N., Vierbuchen, T., et al. (2011) In-

duction of human neuronal cells by defined transcription

factors. Nature, 476, 220-223. doi:10.1038/nature10202

[16] Blandini, F., Cova, L., Armentero, M.T., et al. (2010)

Transplantation of undifferentiated human mesenchymal

stem cells protects against 6-hydroxydopamine neurotox-

icity in the rat. Cell Transplantation, 19, 203-217.

doi:10.3727/096368909X479839

[17] Khoo, M.L., Tao, H., Meedeniya, A.C., Mackay-Sim, A.

and Ma, D.D. (2011) Transplantation of neuronal-primed

human bone marrow mesenchymal stem cells in hemi-

parkinsonian rodents. PLoS One, 6, e19025.

doi:10.1371/journal.pone.0019025

[18] Binato, R., de Souza Fernandez, T., Lazzarotto-Silva, C.,

et al. (2013) Stability of human mesenchymal stem cells

during in vitro culture: Considerations for cell therapy.

Cell Proliferation, 46, 10-22. d oi:10.1111/cpr. 1200 2

[19] Montzka, K., Lassonczyky, N., Tshöke, B., et al. (2009)

Neural differentiation potential of human bone marrow-

derived mesenchymal stromal cells. BMC Neuroscience,

10, 16. doi:10.1186/1471-2202-10-16

[20] Lu, P., Blesch, A. and Tuszynski, M. (2004) Induction of

bone marrow stromal cells to neurons: Differentiation,

transdifferentiation or artifact? Journal of Neuroscience

Research, 77, 174-191. doi:10.1002/jnr.20148

[21] Croft, A. and Przyborski, S. (1999) Formation of neurons

by non-neural adult stem cells: Potential mechanism im-

plicates an artifact of growth in culture. Stem Cells, 24,

1841-1851. doi:10.1634/stemcells.2005-0609

[22] Ren, X.D., Kiosses, W.B. and Schwartz, M.A. (1999)

Regulation of the small GTP binding protein Rho by cell

adhesion and the cytoskeleton. EMBO Journal, 18, 578-

585. doi:10.1093/emboj/18.3.578

[23] Yujiri, T., Fanger, G.R., Garrington, T.P., Schlesinger, T.K.,

Gibson, S. and Johnson, G.L. (1999) MEK kinase 1

(MEKK1) transduces c-Jun NH2-terminal kinase active-

tion in response to changes in the microtubule cytoskele-

ton. Journal of Biological Chemistry, 274, 12605-12610.

doi:10.1074/jbc.274.18.12605

[24] Subbaramaiah, K., Hart, J.C. and Norton, L. (2000) Dan-

nenberg AJ Microtubule-interfering agents stimulate the

transcription of cyclooxygenase-2. Evidence for in-

volvement of RK1/2 AND p38 mitogen-activated protein

kinase pathways. Journal of Biological Chemistry, 275,

14838-14845. doi:10.1074/jbc.275.20.14838

[25] Gale, E. and Li, M. (2008) Midbrain dopaminergic neu-

ron fate specification: Of mice and embryonic stem cells.

Molecular Brain, 1, 8. doi:10.1186/1756-6606-1-8

[26] Björklund, A. and Dunnett, S. (2007) Dopamine neuron

systems in the brain: An update. Trends in Neuroscience,

30, 194-202. doi:10.1016/j.tins.2007.03.006

[27] Hammond, R., Blaes, S. and Abeliovich, A. (2009) Sonic

hedgehog is a chemoattractant for midbrain dopaminergic

axons. PLoS One, 4, e7007.

doi:10.1371/journal.pone.0007007

[28] Hyman , C., Hofe r, M., Bar de, Y., et al. (1991) BDNF is a

neutrophic factor for dopaminergic neurons of the sub-

stantia nigra. Nature, 350, 230-232.

doi:10.1038/350230a0

[29] Volpicelli, F., Caiazzo, M., Greco, D., et al. (2007) BDNF

gene is a downstream target of Nurr1 transcription factor

in rat midbrain neurons in vitro. Journal of Neurochemis-

try, 102, 441-453.

d oi:10.1111/j.1471-4159.2007.04494.x

[30] Bang, A., Papalopulu, N., Kintner, C. and Goulding, M.

(1997) Expression of Pax3 is initiated in the early neural

plate by posteriorizing signals produced by the organizer

and by posterior non-axial mesoderm. Development, 124,

2075-2085.

[31] Goulding, M., Chalepakis, G., Deutsch, U., Erselius, J.R.

and Gruss, P. (1991) Pax3, a novel murine DNA-binding

protein expressed during early neurogenesis. EMBO

Journal, 10, 1135-1147.

[32] Daubner, S.C., Le, T. and Wang, S. (2011) Tyrosine hy-

droxylase and regulation of dopamine synthesis. Ar-

chieves of Biochemistry and Biophysics, 508, 1-12.

doi:10.1016/j.abb.2010.12.017

[33] Verhoeven, K., Jonghe, P., Putte, T., et al. (2003) Slowed

conduction and thin myelination of peripheral nerves as-

sociated with mutant Rho guanine-nucleotide exchange

factor 10. American Journal of Human Genetics, 73, 926-

932. doi:10.1086/378159

[34] Schmidt, A. and Hall, A. (2002) Guanine nucleotide ex-

change factors for Rho GTPases: Turning on the switch.

Genes and development, 16, 1587-1609.

doi:10.1101/gad.1003302

[35] Michalczyk, K. and Ziman, M. (2005) Nestin structure

and predicted function in cellular cytoskeletal organisa-

tion. Histology and histopathology, 20, 665-671.

[36] Canola, K., Angenieux, B., Tekaya, M., et al. (2007)

Retinal stem cells transplanted into models of late stages

of retinitis pigmentosa preferentially adopt a glial or a

retinal ganglion cell fate. Investigative ophthalmology

and visual science, 48, 446-454.

doi:10.1167/iovs.06-0190

[37] MacLaren, R.E., Pearson, R.A., MacNeil, A. et al. (2006)

Retinal repair by transplantation of photoreceptor pre-

cursors. Nature, 444, 203-207. doi:10.1038/nature05161

[38] Sanchez-Ramos, J., Song, S., Cardozo-Pelaez, F., et al.

(2000) Adult bone marrow stromal cells differentiate into

neural cells in vitro. Experimental Neurology, 164, 247-

256. doi:10.1006/exnr.2000.7389