Vol.5, No.2, 285-291 (2013) Health
http://dx.doi.org/10.4236/health.2013.52038
The common pentanucleotide polymorphism of the
3’-untranslated region of the leptin receptor gene is
associated with obesity in Saudi females*
Maha H. Daghestani1,2#, Mazin H. Daghestani3, Pinar T. Ozand4, Ahmed R. Al-Himaidi5,
Mamoon H. Daghestani6, Nadia A. Aleisa1, Hana H. Hakami1, Abdelmoneim Eldali7,
Ali N. Al-odaib2
1Department of Zoology, Center for Scientific and Medical Female Colleges, King Saud University, Riyadh, KSA;
2Department of Genetics, King Faisal Specialist Hospital and Research Center, Riyadh, KSA; [email protected]
3Department of Obstetrics & Gynecology, Umm-Al-Qura University, Makkah, KSA; [email protected]
4Duzen Laboratories, Istanbul, Turkey; [email protected]
5Department of Zoology, Science College, King Saud University, Riyadh, KSA; [email protected]
6Department of Surgery, King Abdulaziz Medical City, National Guard Health Affairs, Jeddah, KSA; [email protected]
7Biostatistics, Epidemiology & Scientific Computing (MBC-03), King Faisal Specialist Hospital and Research Center, Riyadh, KSA;
Received 5 November 2012; revised 4 December 2012; accepted 12 December 2012
ABSTRACT
Obesity is due to the combined effects of genes,
environment, lifestyle, and the interactions of
these factors. Leptin receptor (LEPR) gene has
been intensively evaluated in the search of
variants that could be related to obesity. The
results of most of these studies have been con-
troversial. We investigated the effects of leptin
receptor gene 3’-untranslated region (3’-UTR)
polymorphism on phenotype, metabolic para-
meters and anthropometric measurements of
obese Saudi females. 122 healthy women aged
19 to 36 years. The subjects were divided into 3
groups according to their body mass index BMI;
lean (BMI 18 - 24), overweight (BMI 25 - 29) and
obese (BMI 30). There were 13 homozygotes
and 34 heterozygotes for the 3’-UTR insertion
allele amongst all 122 women. The results of this
study show that the allele frequency of the in-
sertion allele (I) of 3’UTR was significantly
higher in overweight (35.3) and obese females
(32.2) compared to the frequency in lean females
(15.6). The insertion allele was associated with
increased BMI in obese groups. The results ob-
tained from this study indicated that in the
obese subjects most variable values increased
in I/I homozygote but the significant high value
recorded among BMI (40.9 ± 7.11 kg/m2, P =
0.042). Our findings indicated that, the obesity in
Saudi females is influenced by alteration in the
leptin receptor gene 3’-UTR polymorphism.
Keywords: Pentanucleotide; Polymorphi sm; Leptin;
Obesity; Saudi Females
1. INTRODUCTION
Leptin, a peptide hormone encoded by the obesity
gene [1], is produced by adipocytes to regulate body
weight and energy balance [2,3]. In the fed state, circu-
lating leptin concentrations reflect the magnitude of fat
stores [4,5], and leptin levels are elevated in many mo-
dels of animal obesity and in obese humans, correlating
strongly with the degree of obesity [4-6]. Leptin acts
through the leptin receptor (OB-R) [7] that is expressed
in the nervous system and peripheral tissues such as adi-
pose tissue, skeletal muscles, pancreatic β-cells, and liver.
A single transcription unit of leptin receptor may serve to
generate more than one protein. For instance, several
isoforms can be derived from a single gene locus by al-
ternative hnRNA splicing, including a long isoform ex-
pressed primarily in the hypothalamus and several shor-
tisoforms with a much wider tissue distribution [7]. Al-
though the frequency of such mutations is very low,
common polymorphisms of the leptin and OB-R may
well contribute to a common form of obesity and, as a
consequence, obesity-related diseases [8,9].
Mutations in the genes encoding leptin (ob) and its re-
ceptor (db) have been found to cause early onset morbid
obesity, with related phenotypes such as type 2 diabetes
*The authors declare no conflict of interest.
Copyright © 2013 SciRes. OPEN ACCESS
M. H. Daghestani et al. / Health 5 (2013) 285-291
286
in animals [10] and humans [11,12]. The OB-R gene is a
polymorphic gene. Q223R (rs59347832), K109R
(rs59932898), and K656N (rs8179183) are among the
principal polymorphisms of this gene and are localized in
the extracellular region of the receptor in exons 6, 4, and
14, respectively. The trans-membrane region of the re-
ceptor is encoded by exon 18. A large number of studies
have been able to associate some of these polymer-
phisms with body weight gain [13], metabolic carbohy-
drate reduction [14], lower body weight, body mass in-
dex (BMI), body fat, and smaller waist circumference
[15]. Low body fat levels and elevated high-density cho-
lesterol [16]. The Q223R polymorphism appears to con-
tribute to a common form of obesity. In contrast, the
K109R and K656N polymorphisms have been observed
to be involved in the response to glucose and insulin
[17].
Studies in obese subjects have reported that heterozy-
gous carriers of a pentanucleotide insertion in the 3’-
UTR of the leptin receptor gene had lower serum insulin
concentrations than the homozygous carriers of the more
common deletion allele [18,19].
Obese humans are characterized by increased circu-
lating leptin levels [5,6], suggesting that human obesity
is associated with an insensitivity to endogenous leptin.
Since a defect in the leptin-mediated signaling pathway,
including the leptin receptor, could be the cause of leptin
resistance, the leptin receptor gene has been a plausible
candidate gene for obesity [6-20]. Therefore, we investi-
gated the effects of leptin receptor gene 3’-UTR poly-
morphism on phenotype, metabolic parameters and an-
thropometric measurements of obese Saudi females.
2. METHODS
2.1. Subjects
Inclusion Criteria: Saudis, age above 18 years, gave
consent to participate in the study, with no known illness.
Exclusion criteria: non-Saudis, children, suffering from
endocrine or genetic causes of obesity. One hundred and
twenty two Saudi females’ volunteers were participated
in this study. After being informed of the purpose and
procedures of the study, all subjects signed a consent
form. The study protocol was approved by the KFSH &
RC Research Ethical committees. The subjects were di-
vided into 3 groups according to their body mass index
BMI; lean (n = 60, BMI 18.5 - 24 kg/m2), overweight (n
= 17, BMI 25 - 29 kg/m2) and obese (n = 45, BMI 30
kg/m2). The general characteristics of the subjects are
summarized in Table 1. All subjects were healthy, free of
any medication with regular menstrual cycle, and no
history of gastrointestinal or endocrine disorders. After
an overnight fast (12 hrs) a venous blood sample was
obtained from all subjects in the morning between 08.00
h and 09.00 h for the determination of fasting serum
leptin, insulin and glucose. Serum was aliquoted, and
stored at 80˚C until required for assay.
2.2. Anthropometry and Body Composition
Measurement
For all subjects, weight and height were measured to
the nearest 0.5 kg and 0.5 cm, respectively. Body mass
index (BMI) was calculated as weight (kilograms)/height
(meters)2. Waist and hip circumferences were measured
to a precision of 0.1 cm, and the waist to hip ratio was
calculated [20].
2.3. Analytical Method
Plasma glucose was measured by a glucose oxidase
method using the Roche Glucose HK liquid assay on
Roche/Hitachi 917 automatic analyzer. Serum insulin
was measured with electrochemiluminescence immuno-
assay “ECLIA” technique, using Elecsys insulin kit on E
170 immunoassay analyzer (Roche). Serum leptin was
measured in duplicate using human leptin ELISA kit
from Linco Research, Inc. (St. Charles, MO), with a
lower limit of detection of 0.5 ng/mL.
Table 1. Mean comparisons of clinical and endocrine-metabolic characteristics between lean, overweight and obese groups.
Va ri a bl e Control lean
(n = 60) mean ± SE
Overweight
(n = 17) mean ± SEp value Obese
(n = 45) mean ± SE p value
Age (yr.) 23.95 ± 0.60 21.59 ± 0.94 0.06 26.49 ± 0.96 0.028
BMI (kg/m2) 20.85 ± 0.25 27.38 ± 0.37 <0.0001 35.90 ± 0.92 <0.0001
Waist (cm) 66.85 ± 0.70 81.59 ± 1.82 <0.0001 100.29 ± 2.14 <0.0001
Hip (cm) 94.59 ± 0.91 105.29 ± 1.78 <0.0001 121.96 ± 2.14 <0.0001
WH ratio 0.71 ± 0.01 0.78 ± 0.01 <0.0001 0.82 ± 0.01 <0.0001
Leptin (ng/ml) 11.70 ± 0.46 23.79 ± 1.55 <0.0001 46.04 ± 3.07 <0.0001
Fasting insulin (pmol/L) 52.57 ± 2.29 63.93 ± 9.95 0.09 104.69 ± 5.58 <0.0001
Fasting glucose (mmol/L) 4.54 ± 0.05 4.66 ± 0.15 0.32 4.99 ± 0.07 <0.0001
Copyright © 2013 SciRes. OPEN ACCESS
M. H. Daghestani et al. / Health 5 (2013) 285-291 287
2.4. DNA Analysis
The 3’-UTR pentanucleotide insertion/deletion poly-
morphism of the leptin receptor gene was analysed from
DNA extracted from EDTA-anticoagulated venous blood
samples using the QIAamp DNA Blood Mini Kit
(QIAgen Inc., Santa Clarita, CA). A DNA fragment of
114 or 119 bp in size (depending on the absence or pre-
sence of the insertion) was generated by polymerase
chain reaction using 5’ mismatch primer ATAATGGG-
TAATATAAAGTGTAATAGAGTA and 3’ primer AGA-
GAACAAACAGACAACATT, and analysed as des-
cribed in detail previously [19]. To confirm the results,
all heterozygous, homozygous and 10 samples from each
group of common deletion allele were sequenced. Oli-
gonucleotides primers were designed using web primer
DNA and purpose entry
(http://seq.yeastgenome.org/cgi-bin/SGD/web-primer)
Forward primer II. 5’-GACTTTTGCATCTTACATG-
CC-3’Reverse primer II. 5’-ATTGGTAGGCTTATGAA
-3’. The PCR conditions consisted of an initial denatura-
tion step at 95˚C for 15 minutes, followed by 34 cycles
of denaturation at 95˚C for 1 minute, annealing at 60˚C
for 1 minute, and extension at 72˚C for 1 minute, with a
final extension of 10 minutes at 72˚C, sequencing was
performed with the BigDye Terminator Cycle Sequenc-
ing Ready Reaction Kit (Applied Biosystems, Foster City,
CA) on the ABI 3100 Genetic Analyzer (Applied Bio-
systems).
2.5. Statistical Analysis
Data are presented as mean ± SEM. The comparisons
between obese subjects and matched control were done
using the independent t-test and ANOVA test. The dis-
tributions of the age, BMI, anthropometric measurements,
fasting serum insulin, leptin and glucose values of the
study subjects according to their leptin receptor 3’-UTR
genotype of each group were compared by the U Mann-
Whitney test. Frequency distribution analysis was per-
formed with chi square test. A probability value p 0.05
was considered statistically significant. All analyses were
run using the StatView program for Windows (version
8.0; SAS).
3. RESULTS
The mean age, BMI, anthropometric, mean leptin, in-
sulin concentrations, and fasting glucose of the groups
are shown in Ta ble 1. As presented in Table 1 student’s
t-test was applied and significant differences were found
in the waist, hip and waist/hip ratio among over weight
and obese subjects compared with lean control group.
Serum concentrations of leptin were markedly and sig-
nificantly higher in obese, overweight subjects compared
with lean controls. Serum fasting glucose and insulin
levels were significantly higher in obese group compared
to controls, no significantly different between overweight
and lean groups (Table 1).
The genotype distribution and allele frequencies for
the insertion/delition 3’UTR polymorphisms of the
LEPR gene are presented in Ta ble 2 . The genotype dis-
tribution was governed by Hardy-Weinberg equilibrium
law in this study. As shown in table there were 13 ho-
mozygotes and 34 heterozygotes for the 3’-UTR inser-
tion allele amongst all 122 women. The results of this
study show that the allele frequency of the insertion al-
lele (I) of 3’UTR was significantly higher in overweight
(35.3) and obese females (32.2) compared to the fre-
quency in lean females (15.6). The frequency of the (D)
allele in the lean group was 84.2%, 64.7% in the over-
weight group and 67.8% in the obese group, whereas the
frequency of the (I) allele in the different weight groups
was 15.8% in the lean group, 35.3% in the overweight
group and 32.2% in the obese group. When overweight
and obese results were compared to lean, the x2 was p =
0.01 and p = 0.005, respectively, and the difference was
statistically significant (Table 2).
The distributions of the age, BMI, anthropometric
measurements, fasting serum insulin, leptin and glucose
values of the study subjects according to their leptin re-
ceptor 3’-UTR genotype of each group are presented in
Tables 3-5 in the obese subjects most variable values
Table 2. 3’UTR pentanucleotide insertion/deletion polymorphism of the human leptin receptor gene. Genotype and allele frequencies
in lean, over weight and obese subjects.
Control lean Overweight Obese
3’UTR
Frequency (%) Frequency (%) p value Frequency (%) p value
Genotype D/D 43 (71.67%) 9 (52.94%) 23 (51.11%)
Genotype D/I 15 (25%) 4 (23.53%) 15 (33.33%)
Genotype I/I 2 (3.33%) 4 (23.53%)
0.02
7 (15.56%)
0.03
Allele D (84.2%) (64.7%) (67.8%)
Allele I (15.8%) (35.3%)
0.01
(32.2%)
0.005
Copyright © 2013 SciRes. OPEN ACCESS
M. H. Daghestani et al. / Health 5 (2013) 285-291
288
Table 3. Leptin receptor gene 3’UTR deletion/insertion polymorphism in relation to anthropometry, hormone and metabolic variables
in control lean group.
Variables D/D (n = 43) D/I (n = 15) I/I (n = 2) p-value
Age (years) 23.0 ± 4.35 26.0 ± 4.50 27.0 ± 9.90 0.064
BMI (kg/m2) 20.7 ± 1.95 21.1 ± 1.95 21.0 ± 1.41 0.768
Waist (cm) 67.2 ± 5.39 65.7 ± 5.65 66.0 ± 5.66 0.627
Hip (cm) 94.5 ± 7.12 95.1 ± 6.94 92.5 ± 10.6 0.877
W/H ratio 0.71 ± 0.042 0.69 ± 0.049 0.71 ± 0.014 0.302
Leptin (ng/ml) 11.7 ± 3.86 11.4 ± 3.13 11.7 ± 0.35 0.948
Fasting insulin (pmol/L) 53.1 ± 18.9 50.0 ± 15.0 59.2 ± 7.42 0.736
Fasting glucose (mmol/L) 4.56 ± 0.39 4.50 ± 0.40 4.35 ± 0.21 0.700
Table 4. Leptin receptor gene 3’UTR deletion/insertion polymorphism in relation to anthropometry, hormone and metabolic variables
in overweight group.
Variables D/D (n = 9) D/I (n = 4) I/I (n = 4) p-value
Age (years) 22.4 ± 5.13 20.75 ± 1.26 20.50 ± 1.73 0.640
BMI (kg/m2) 27.1 ± 1.63 27.90 ± 1.33 27.48 ± 1.60 0.471
Waist (cm) 80.8 ± 7.52 85.50 ± 7.14 79.25 ± 8.22 0.380
Hip (cm) 103.5 ± 8.68 107.75 ± 3.77 106.75 ± 7.32 0.576
W/H ratio 0.78 ± 0.047 0.80 ± 0.055 0.74 ± 0.075 0.341
Leptin (ng/ml) 22.7 ± 6.28 24.2 ± 7.09 26.3 ± 7.37 0.716
Fasting insulin (pmol/L) 66.7 ± 45.7 69.5 ± 45.7 46.0 ± 17.7 0.729
Fasting glucose (mmol/L) 4.55 ± 0.65 4.78 ± 0.50 4.80 ± 0.75 0.755
Table 5. Leptin receptor gene 3’UTR deletion/insertion polymorphism in relation to anthropometry, hormone and metabolic variables
in obese group.
Variables D/D (n = 23) D/I (n = 15) I/I (n = 7) p-value
Age (years) 26.9 ± 6.77 25.6 ± 6.23 26.8 ± 6.67 0.815
BMI (kg/m2) 35.6 ± 6.33 33.9 ± 4.17 40.9 ± 7.11 0.042
Waist (cm) 101.0 ± 16.0 94.7 ± 6.47 109.7 ± 16.7 0.066
Hip (cm) 121.1 ± 16.1 118.7 ± 10.5 131.5 ± 12.6 0.137
W/H ratio 0.83 ± 0.044 0.80 ± 0.045 0.83 ± 0.068 0.163
Leptin (ng/ml) 44.1 ± 19.7 40.5 ± 12.7 64.1 ± 28.7 0.31
Fasting insulin (pmol/L) 111.0 ± 34.1 90.8 ± 37.2 113.4 ± 45.1 0.214
Fasting glucose(mmol/L) 5.03 ± 0.45 4.96 ± 0.40 4.88 ± 0.54 0.723
increased in I/I homozygote but the significant high
value recorded among BMI (40.9 ± 7.11 kg/m2, p =
0.042).
4. DISCUSSION
Since 1997, several single nucleotide polymorphisms
(SNPs) in coding region and a pentanucleotide (CTTTA)
insertion/deletion polymorphism in the 3’-untranslated
region of the human OB-R gene have been reported in
different ethnic groups [21-25]. Two studies confirmed
the existence of the CTTTA pentanucleotide I/D poly-
morphism at the 3’UTR of the OB-R gene [18,19].
Leptin gene and leptin receptorgene products, respec-
tively, have defined a new biological pathway for the
regulation of food intake and energy expenditure. Leptin
acts at distinct sites and through different mechanisms
within the central nervous system (CNS) to mediate en-
ergy homeostasis and feeding behavior [26,27]. It ap-
pears that leptin controls feeding not just by providing
physiological satiety signal, but also by mediating “syn-
aptic plasticity” as well as modulating the perception of
reward associated with feeding [26-28].
This is the first study to suggest an association be-
tween a polymorphism of the leptin receptor gene and
Copyright © 2013 SciRes. OPEN ACCESS
M. H. Daghestani et al. / Health 5 (2013) 285-291 289
obesity. The present study revealed significant differ-
ences in allele and genotype frequencies between the
normal group on one hand and overweight and obese
groups on the other hand (p < 0.05). The allele frequency
of the insertion allele was higher in overweight (0.35)
and obese females (32.2) when compared to the fre-
quency in lean females (15.6). In contrast to our findings
a previous study performed on Finnish individuals showed
that there was no significant difference in the frequency
of the insertion allele (I) between obese (0.124) and
normal weight subjects (0.120) [29]. In the Finnish study,
four obese, but none of the normal weight subjects were
homozygous for the insertion allele [29]. In our study, 5
of the overweight and 9 obese individuals were homo-
zygous for the insertion allele and 3 of the normal weight
individuals were also homozygous. Our results show
significant differences in the genotype and allele fre-
quency of leptin receptor gene pentanucleotide poly-
morphism in Saudi females compared to the Finnish
population. This pointed to genetic variations in the
leptin receptor gene polymorphism between populations.
The results of this study show that the insertion allele
could be considered as a marker for obesity in Saudi fe-
males. Even though, the insertion allele also occurs at a
fairly high frequency in non-obese Saudis, these results
indicate that it can be used as a significant marker of
obesity in Saudis, due to the fact that, it may be possible
that these normal weight individuals have a higher sensi-
tivity to develop obesity, but since they are avoiding the
precipitating environmental factors, they are not obese.
In addition, they may develop obesity more easily in
older age if the predisposing factors are present. This
confirmation requires a long-term investigation and fol-
low-up studies on individuals with different alleles of the
leptin receptor gene, which is a major problem with a
study of genetic markers for non-communicable diseases.
A person with a particular genotype may not have the
disease at present, but may be susceptible to it or may
develop it later.
The association of pentanucleotide insertion/deletion
polymorphism with metabolic parameters and anthro-
pometric measurements was earlier studied by many re-
searchers, [29] reported better insulin sensitivity in obese
subjects carrying the I allele because they had lower in-
sulin and insulin-to-glucose ratio levels. [25] concluded
that obese heterozygous women had lower insulin values
at 30 minutes in the oral glucose tolerance test (OGTT).
[29] found that healthy men carrying the I allele had a
79% reduced risk of type 2 diabetes. A Finnish study had
shown that the carriers of the insertion allele had a 79%
reduced risk of diabetes when compared to non-carriers;
this is due to the lesser extent of leptin’s action on the
pancreatic ß-cells to inhibit insulin secretion. The study
revealed that this 3’-UTR insertion was common in the
healthy population since the carrier frequency was a high
as 23.5% amongst the controls [29].
In contrast to previous reports [20] did not find a rela-
tionship between the I/D LEPR polymorphism and the
con- version to type 2 diabetes. However, they found that
the I allele was associated with greater reduction in
weight, BMI, and waist circumference during the 3-year
follow-up. Similarly, [31] reported that the association
between I/D-LEPR and prevalent impaired glucose tol-
erance or type 2 diabetes did not reach statistical signifi-
cance, and they did not find significant associations with
other features of the metabolic syndrome.
Interestingly, the results of this study demonstrate that
there was no association of serum leptin, glucose or insu-
lin levels with the pentanucleotide genotype in the obese
individuals. However, most variable values increased in
I/I homozygote but the significant high value recorded
among BMI (40.9 ± 7.11 kg/m2, P = 0.042). It is unfor-
tunate that there have been no functional studies on the
effects of this 3’-UTR polymorphism. Although stem-
loop sequences usually de-stabilize mRNA [30-32], it is
unclear whether those in 3’-UTR of the leptin receptor
gene, which would be formed by the pentanucleotide
insertion allele, might stabilize or de-stabilize the mRNA.
[19] hypothesized that this polymorphism might stabilize
the mRNA level of the leptin receptor.
5. CONCLUSION
The results obtained from this study indicated that in
the obese subjects most variable values increased in I/I
homozygote but the significant high value recorded
among BMI (40.9 ± 7.11 kg/m2, p = 0.042). Our findings
support the hypothesis that alterations in the leptin sig-
naling system could contribute to the obesity in Saudi
Females.
6. ACKNOWLEDGEMENTS
This research project was supported by a grant from the “Research
Center of the Center for Female Scientific and Medical Colleges”,
Deanship of Scientific Research, King Saud University.
REFERENCES
[1] Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold,
L. and Friedman, J.M. (1994) Positional cloning of the
mouse obese gene and its human homologue. Nature, 372,
425-432. doi:10.1038/372425a0
[2] Campfield, L.A., Smith, F.J., Guisez, Y., Devos, R. and
Burn, P. (1995) Recombinant mouse OB protein: Evi-
dence for a peripheral signal linking adiposity and central
neutral networks. Science, 269, 546-549.
doi:10.1126/science.7624778
[3] Pelleymounter, M.A., Cullen, M.J., Baker, M.B., Hecht,
R., Winters, D., Boone, T. and Collins, F. (1995) Effects
Copyright © 2013 SciRes. OPEN ACCESS
M. H. Daghestani et al. / Health 5 (2013) 285-291
290
of the obese gene product on body weight regulation in
ob/ob mice. Science, 269, 540-543.
doi:10.1126/science.7624776
[4] Frederich, R.C., Lollmann, B., Hamann, A., Napolitano-
Rosen, A., Kahn, B.B., Lowell, B.B. and Flie, J.S. (1995)
Expression of ob mRNA and its encoded protein in ro-
dents. Journal of Clinical Investigation, 96, 1658-1663.
doi:10.1172/JCI118206
[5] Maffei, M., Halaas, J., Ravussin, E., Pratley, R.E., Lee,
G.H., Zhang, Y., Fei, H., Kim, S., Lallone, R., Rangana-
than, S., Kern, P.A. and Friedman, J.M. (1995) Leptin
levels in human and rodent: Measurement of plasma lep-
tin and ob RNA in obese and weight-reduced subjects.
Nature Medicine, 1, 1155-1161.
doi:10.1038/nm1195-1155
[6] Considine, R.V., Sinha, M.K., Heiman, M.L., Kriauciunas,
A., Stephens, T.W., Nyce, M.R., Ohannesian, J.P., Marco,
C.C., McKee, L.J., Bauer, T.L. and Caro, J.F. (1996) Se-
rum immunoreactive-leptin concentrations in normal-
weight and obese humans. New England Journal of Me-
dicine, 334, 292-295.
doi:10.1056/NEJM199602013340503
[7] Chung, W.K., Power-Kehoe, L., Chua, M., Chu, F., Aronne,
L., Huma, Z., Sothern, M., Udall, J.N., Kahle, B. and
Leibel, R.L. (1997) Exonic and intronic sequence varia-
tion in the human leptin receptor gene (LEPR). Diabetes,
46, 1509-1511.
[8] Guízar-Mendoza, J.M., Amador-Licona, N., Flores-Mar-
tínez, S.E., López-Cardona, M.G., Ahuatzin-Trémary, R.
and Sánchez-Corona, J. (2005) Association analysis of
the Gln223Arg polymorphism in the human leptin recap-
tor gene, and traits related to obesity in Mexican adoles-
cents. Journal of Human Hypertension, 19, 341-346.
doi:10.1038/sj.jhh.1001824
[9] van der Vleuten, G.M., Kluijtmans, L.A., Hijmans, A.,
Blom, H.J., Stalenhoef, A.F. and de Graaf, J. (2006) The
Gln223Arg polymorphism in the leptin receptor is asso-
ciated with familial combined hyperlipidemia. Interna-
tional Journal of Obesity (Lond), 30, 892-898.
[10] Friedman, J.M. and Halaas, J.L. (1998) Leptin and the re-
gulation of body weight in mammals. Nature, 395, 763-
770. doi:10.1038/27376
[11] Montague, C.T., Farooqi, I.S., Whitehead, J.P., Soos, M.A.,
Rau, H., Wreham, N.J., Sewter, C.P., Digby, J.E., Mo-
hammed, S.N., Hurst, J.A., Cheetham, C.H., Early, A.R.,
Barnett, A.H., Prins, J.B. and O’Rahilly, S. (1997) Con-
genital leptin deficiency is associated with severe early-
onset obesity in humans. Nature, 387, 903-908.
doi:10.1038/43185
[12] Wauters, M., Mertens, I., Chagnon, M., Rankinen, T.,
Considine, R.V., Chagnon, Y.C., Van Gaal, L.F. and Bou-
chard, C. (2001) Polymorphisms in the leptin receptor
gene, body composition and fat distribution in overweight
and obese women. International Journal of Obesity and
Related Metabolic and Disorders, 25, 714-720.
doi:10.1038/sj.ijo.0801609
[13] van Rossum, C.T., Hoebee, B., van Baak, M.A., Mars, M.,
Saris, W.H. and Seidell, J.C. (2003) Genetic variation in
the leptin receptor gene, leptin, and weight gain in young
Dutch adults. Obesity and Research, 11, 377-386.
doi:10.1038/oby.2003.51
[14] Wauters, M., Considine, R.V., Chagnon, M., et al. (2002)
Leptin levels, leptin receptor gene polymorphisms, and
energy metabolism in women. Obesity and Research, 10,
394-400. doi:10.1038/oby.2002.54
[15] de Luis Roman, D., de la Fuente, R.A., Sagrado, M.G.,
Izaola, O. and Vicente, R.C. (2006) Leptin receptor
Lys656Asn polymorphism is associated with decreased
leptin response and weight loss secondary to a lifestyle
modification in obese patients. Archives of Medical Re-
search, 37, 854-859. doi:10.1016/j.arcmed.2006.03.009
[16] Angel-Chávez, L.I., Tene-Pérez, C.E. and Castro, E. (2012)
Leptin receptor gene K656N polymorphism is associated
with low body fat levels and elevated high-density cho-
lesterol levels in Mexican children and adolescents. En-
docrine Research, 37, 124-134.
[17] Wauters, M., Mertens, I., Rankinen, T., Chagnon, M.,
Bouchard, C. and VanGaal, L. (2001) Leptin receptor
gene polymorphisms are associated with insulin in obese
women with impaired glucose tolerance. Journal of Clini-
cal Endocrinology & Metabolism, 86, 3227-3232.
doi:10.1210/jc.86.7.3227
[18] Francke, S., Clement, K., Dina, C., Inoue, H., Behn, P.,
Vatin, V., Basdevant, A., Guy-Grand, B., Permutt, M.A.,
Froguel, P. and Hager, J. (1997) Genetic studies of the
leptin receptor gene in morbidly obese French Caucasian
families. Human Genetics, 100, 491-496.
doi:10.1007/s004390050540
[19] Oksanen, L., Kaprio, J., Mustajoki, P. and Kontula, K.A.
(1998) common pentanucleotide polymorphism of the 3’-
untranslated part of the leptin receptor gene generates a
putative stem-loop motif in the mRNA and is associated
with serun insulin levels in obese individuals. Interna-
tional Journal of Obesity, 22, 634-640.
doi:10.1038/sj.ijo.0800639
[20] WHO (1988) Measuring obesity: Classification and de-
scription of anthropometric data. Copehhagen, WHO, EUR/
ICP/NUT 125.
[21] Matsuoka, N., Ogawa, Y., Hosada, K., Matsuda, J., Ma-
suzaki, H., Miyawaki, T., Azuma, N.N., Natsui, K., Ni-
shimura, H., Yoshimasa, Y., Nishi, N., Thompson, D.B.
and Nakao, K. (1997) Human leptin receptor gene in
obese Japanese subjects: Evidence against either obe-
sity-causing mutations or association of sequence variants
with obesity. Diabetologia, 40, 1204-1210.
doi:10.1007/s001250050808
[22] Thompson, D.B., Ravussin, E., Bennett, P.H. and Bogar-
dus, C. (1997) Structure and sequence variation at the
human leptin receptor gene in lean and obese Pima Indi-
ans. Human Molecular Genetics, 6, 675-679.
doi:10.1093/hmg/6.5.675
[23] Quinton, N.D., Lee, A.J., Ross, R.J.M., Eastell, R. and
Blakemore, A.I.F. (2001) A single nucleotide polymer-
phism (SNP) in the leptin receptor is associated with BMI,
fat mass and leptin levels in postmenopausal Caucasian
women. Human Genetics, 108, 233-236.
doi:10.1007/s004390100468
[24] Heo, M., Leibel, R.L., Fontaine, K.R., Boyer, B.B., Chung,
Copyright © 2013 SciRes. OPEN ACCESS
M. H. Daghestani et al. / Health 5 (2013) 285-291
Copyright © 2013 SciRes. OPEN ACCESS
291
W.K., Koulu, M., Karvonen, M.K., Pesonen, U., Rissanen,
A., Laakso, M., Uusitupa, M.I., Chagnon, Y., Bouchard,
C., Donohoue, P.A., Burns, T.L., Shuldiner, A.R., Silver,
K., Andersen, R.E.R.E., Pedersen, O., Echwald, S., So-
rensen, T.L., Behn, P., Permutt, M.A., Jacobs, K.B., Elston,
R.C., Hoffman, D.J., Gropp, E. and Allison, D.B. (2002)
A meta-analytic investigation of linkage and association
of common leptin receptor (LEPR) polymorphisms with
body mass index and waist circumference. International
Journal of Obesity and Related Metabolic Disorders, 26,
640-646. doi:10.1038/sj.ijo.0801990
[25] Lakka, H.M., Oksanen, L., Tuomainen, T.P., Kontula, K.
and Salonen, J.T. (2000) The common pentanucleotide
polymorphism of the 3-untranslated region of the leptin
receptor gene is associated with serum insulin level and
the risk of type 2 diabetes in non-diabetic men, a pro-
spective case-control study. Journal of Internal Medicine,
248, 77-83. doi:10.1046/j.1365-2796.2000.00696.x
[26] Oswal, A. and Yeo, G. (2010) Leptin and the control of
body weight: A review of its diverse central targets, sig-
naling mechanisms, and role in the pathogenesis of obesity.
Obesity (Silver Spring), 18, 221-229.
doi:10.1038/oby.2009.228
[27] Huang, H., Kong, D., Byun, K.H., Ye, C., Koda, S., Lee,
D.H., Oh, B.C., Lee, S.W., Lee, B., Zabolotny, J.M., Kim,
M.S., Bjørbæk, C., Lowell, B.B. and Kim, Y.B. (2012)
Rho-kinase regulates energy balance by targeting hypo-
thalamic leptin receptor signaling. Nature Neuroscience,
15, 1391-1398. doi:10.1038/nn.3207
[28] Velloso, L.A. and Schwartz, M.W. (2011) Altered hypo-
thalamic function in diet-induced obesity. International
Journal of Obesity (Lond), 35, 1455-1465.
doi:10.1038/ijo.2011.56
[29] Zacharova, J., Todorova, B.R., Chiasson, J.L. and Laakso,
M. (2005) The G-250A substitution in the promoter region
of the hepatic lipase gene is associated with the con-
version from impaired glucose tolerance to type 2 dia-
betes: The STOP-NIDDM trial. Journal of Internal Me-
dicine, 257, 185-193.
doi:10.1111/j.1365-2796.2004.01435.x
[30] Nannipieri, M., Posadas, R., Williams, K., Politi, E.,
Gonzales-Villalpando, C., Stern, M.P. and Ferrannini, E.
(2003) Association between polymorphisms of the atrial
natriuretic peptide gene and proteinuria: A population-
based study. Diabetologia, 46, 429-432.
[31] Ross, J. (1995) mRNA stability in mammalian cells. Mi-
crobiological Review, 59, 423-450.
[32] Brown, C.Y., Lagnado, C.A. and Goodall, G.J. (1996) A
cytokine mRNA-destabilizing element that is structurally
and functionally distinct from A + U-rich elements. Pro-
ceedings of the National Academy Sciences USA, 93, 13721-
13725.