Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6 from Tobacco (<i>Nicotiana tabacum</i> L.) in Abiotic Strsss

doi:10.4236/ajps.2012.311183

Paper Menu >>

Journal Menu >>

American Journal of Plant Sciences, 2012, 3, 1520-1526

http://dx.doi.org/10.4236/ajps.2012.311183 Published Online November 2012 (http://www.SciRP.org/journal/ajps)

Molecular Cloning, Sequence Analysis and Expression

Analysis of an NtWRKY6 from Tobacco (Nicotiana

tabacum L.) in Abiotic Strsss

Liqin Li, Yubi Huang*, Wei Wang, Yaling Xu

College of Agronomy, Sichuan Agricultural University, Chengdu, China.

Email: *[email protected]

Received August 14th, 2012; revised September 17th, 2012; accepted October 8th, 2012

ABSTRACT

In higher plants, WRKY gene family plays a significant role in transcriptional regulation. They are widely involved in

biotic stress, abiotic stress, growth, development and metabolism regulation. In this study WRKY6 from tobacco is

cloned by homology cloning. 1647 nucleotide sequences were obtained. The deduced protein sequences show that this

protein belongs to the second group of WRKY family, only have one WRKY structure, and the zinc-finger structure is

C-X4-C-X23-H-X1-H. Phylogeny results show NtWRKY6 is much closer to NtWRKY1 generated 97% amino acids

similarity. RT-PCR analysis has revealed that expression levels of NtWRKY6 has increased rapidly at 3 h under NaCI

and PEG treatment. The results suggest that NtWRKY6 is an early responder and may be involved in NaCl and PEG

abiotic stress in tobacco.

Keywords: WRKY Protein; Molecular Cloning; Tobacco; RT-PCR; Expression Analysis

1. Introduction

WRKY protein was originally found in sweet potato and

named SPF1 [1], so far, this family protein was also

found in many plants such as Arabidopsis thaliana, po-

tato, Gossypium spp, Oryza sativa; Nicotiana tabacum

[2-6]. Until the 2005 year, WRKY homologues from two

non-plant eukaryotic species Giardia lamblia and Dic-

tyostelium discoideum were found [7]. WRKY proteins

have been reported to be involved in defense against

bacteria, fungi [8,9], wounding [10], senescence [11],

development [12] and abiotic stresses [13,14].

WRKY family proteins are characterized by one or

two highly conserved WRKYGQK domains, The WRKY

domain is about 60 amino acids in length and a Cys(2)

His(2) or Cys(2)HisCys zinc-binding motif [15]. The two

motifs of WRKY proteins are necessary for the high

binding affinity of WRKY proteins to DNA sequence

motif (W-boxes), which contain an invariant DNA se-

quence (T)(T)TGAC(C/T) [16].

Abiotic stress is an important factor which affects

plant growth, distribution, yield and quality in nature.

NtWRKY6 was identified in the native tobacco Nico-

tiana attenuate, whose wound responses was signifi-

cantly amplified when fatty acid amino acid conjugates

(FACs) in larval oral secretions was introduced into

wounds during feeding [17]. The report of NtWRKY6

involved in abiotic stresses had not been seen.

The tobacco Varieties K326 is the main cultivated

species in the world, our researches first reported that

WRKY6 gene was cloned from the species, 1647 nucleo-

tide sequences were obtained. The deduced protein se-

quence showed that this protein belonged to the second

group of WRKY family, only had one WRKY structure,

and the zinc-finger structure was C-X4-C-X23-H-X1-H.

RT-PCR analysis had revealed that expression levels of

NtWRKY6 had increased rapidly at 3 h under NaCI and

PEG abiotic stress treatment.

2. Materials and Methods

2.1. Plant Materials and Sample Preparation

Tobacco (Nicotiana tabacum L.) K326 was used in this

study. Seeding was sown on MS medium under a 16-h

light/8-h dark cycle at 28˚C. When the second leaves

were fully expanded, the tobacco tissues were collected

for investigation or frozen in liquid nitrogen immediately,

stored at −80˚C for further analysis. For NaCI and PEG

treatment, the seeding when had second leaves were

transferred to MS medium with 250 mM NaCI or 300 m

M PEG for 0, 3, 6, 12, 24 h treatment.

*Corresponding author.

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6

from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss

1521

2.2. Isolation of the Tobacco WRKY6 Gene

The specific primers of NtWRKY6 were designed ac-

cording to the published sequences (Genebank accession

number: AY456272.1). The sequences of primers were

shown in Table 1. PCR product was purified and sub-

cloned into PMD-19T vector (Takara) for sequencing.

2.3. Bioinformatics Analysis

Sequence analysis was carried out by Blast software

(http://www.ncbi.nlm.gov/blast). Deduced anino acid se-

quences were aligned using Clustal W (http://npsa-pbil.

ibcp.fr) software [18]. A phylogenetic tree was construct-

ed based on full-length amino acid sequences using the

neighbor-joining method [19] and was drawn using

MEGA Version 4.1 [20].

2.4. RNA Extraction and Reverse Transcription

RT-PCR

Total RNA was extract from fresh or frozen samples of

tobacco using Trizol reagent (Invitrogen) according to

the standard protocol. In addition, total RNA was also

extracted from tobacco seeding at 0, 3, 6, 12, 24 h after

NaCI or PEG treatment. First-strand cDNA was synthe-

sized with the extracted RNA using M-MLV reverse

transcriptase (Promega) at 42˚C for 1 h and used as the

template for PCR [21]. Amplification was performed

using the following cycling parameters: 95˚C for 5 min

followed by 35 cycles of 95˚C for 30 S (denaturation),

55˚C for 30 S (annealing), 72˚C for 1 min and 40 S (elon-

gation). After the reaction, PCR products were analyzed

on 1.2% (w/v) agrose gels. Expression levels were as-

sessed using 18S rDNA as internal standards for normali-

zation of sample variation. The primers of NtWRKY6

and 18SrDNA for RT-PCR analysis are shown in Table 1.

3. Results

3.1. Amplification of Full Length cDNA of

NtWRKY6

To clone the full length cDNA of NtWRKY6. The full

Table 1. Primer sequence s and the ir uses.

Primer name Nucleotide sequence (5'  3') Purpose

NtWRKY6-F1 ATGAATTCTTTTACTAGCAA

NtWRKY6-R1 TCAGTTAAGGAAAGAGCTGA

Full length

cDNA

amplification

NtWRKY6-F2 TTCTTTTGGTGACGAGGACA

NtWRKY6-R2 CAAATCCTGA ATAACTTGAA

RT-PCR

expression

analysis

18SrDNA-F CCTACGCTCTGTATACATTA

18SrDNA-R GTGTTGAGTCAAATTAAGCC

RT-PCR

expression

analysis

length primers of NtWRKY6 were used to amplify this

gene, RT-PCR products were analyzed on 1.2% (w/v)

agarose gels, and obtained the expected size fragment

(Figure 1). PCR product was purified and subcloned into

PMD-19T vector (Takara) for sequencing using three

positive clones. The result of sequencing had revealed

the amplification product of PCR had 1647 base pairs

(bp).

3.2. Homologous Alignment and Phylogenetic

Analysis of NtWRKY6

To better understand the structure of the deduced amino

acid sequence encoded by tobacco WRKY6, a homolo-

gous alignment was carried out with Clustal W program

using the amino acid sequences of WRKY6 and 19 pro-

teins (Figure 2). Sequence alignment revealed that all

proteins discussed above appeared to be rather conserved

in structure. These proteins all had only one WRKY

structure (WRKYGQK) and the zinc-finger structure is

C-X4-C-X23-H-X1-H. Additionally, the NtWRKY6

shared a very high identity of NtWRKY1 (BAA82107.1)

with 97%, and lower identity of ZmWRKY53 (NP

001147949.1) and Gm WRKY2 (XP 003526383.1) with

41%.

In order to determine the relationship between

WRKY6 and 19 proteins, phylogenetic analysis was fur-

ther carried out by Clustal W program with default pa-

rameters using the amino acid sequences. The phyloge-

netic relationship among 20 WRKY Protein (Figure 3)

showed that the NtWRKY6, NtWRKY1, PcWRKY1 and

HaWRKY7 had relatively close relationship. Fourther-

more, the NtWRKY6, ZmWRKY53 and OsWRKY53

had a relatively far relationship.

3.3. Expression Levels of NtWRKY6 in

Different Tissues

In order to get an insight into the potential function of

NtWRKY6 in tobacco, tissue distribution of NtWRKY6

M 1

2000bp

1000bp

750bp

500bp

250bp

100bp

Figure 1. RT-PCR result of NtWRKY6. M DL2000 DNA

olecular marker, 1 product of RT-PCR. m

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6

from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss

1522

Figure 2. An Alignments of the NtWRKY6 conserved amino acid sequences with homologous 19 WRKY proteins. NtWRKY1

(GenBank accession no, BAA82107.1), DlWRKY17 (GenBank accession no, AEO31478.1), VvWRKY33 (GenBank accession

no, XP_002264974.1), GmWRKY33 (GenBank accession no, XP_003544908.1), PcWRKY1 (GenBank accession no,

AAC49527.1), NtWRKY7 (GenBank accession no, AEX49954.1), BnWRKY33 (GenBank accession no, ACI14397.1), At-

WRKY33 (GenBank accession no, AAM34736.1), NtWRKY2 (GenBank accession no, BAA77383.1), NtWRKY3 (GenBank

accession no, AAS13439.1), GmWRKY39 (GenBank accession no, ABS18436.1), OsWRKY8 (GenBank accession no,

BAB61266.1), TaWRKY27 (GenBank accession no, ACD80363.1), HaWRKY7 (GenBank accession no, AFL91071.1),

TaWRKY10 (GenBank accession no, AAQ57645.1), OsWRKY53 (GenBank accession no, DAA05118.1), ZmWRKY53 (Gen-

Bank accession no, NP_001147949.1), AsWRKY1 (GenBank accession no, AAD32677.1), GmWRKY2 (GenBank accession no,

XP_003526383.1), were aligned by Clustal program version 1.83. According to the degree of conservation, dark gray and

ight gray are indicated. l

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6

from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss

1523

Figure 3. Phylogenetic analysis of the deduced amino acid

sequence betw een NtWRKY6 and 19 WRKY protein.

was studied by semi-quantitative RT-PCR (Figure 4).

The results showed that NtWRKY6 was ubiquitously

expressed in tobacco tissues including root, stem, leaf,

and flower. NtWRKY6 transcripts seemed to be much

abundant in root, leaf, and flower. At the same time, the

lower expression level in stem.

3.4. Stress Induced Expression Patterns of

NtWRKY6

To further investigate whether the expression of

NtWRKY6 was induced by abiotic stresses, we first

monitored the mRNA transcript level of NtWRKY6 un-

der different abiotic stress treatments, including NaCl

and PEG by RT-PCR (Figures 5 and 6). As shown in

Figure 5, the expression level of NtWRKY6 transcripts

under NaCl stress reached the highest level at 3 h. It kept

at 6, 12 h and decreased at 24 h. As shown in Figure 6,

the expression level of NtWRKY6 transcripts under PEG

stress reached the highest level at 3 h. Then, decreased

gradually at 6, 12 h, and declined rapidly at 24 h. These

results revealed the expression level of the NtWRKY6

was increased rapidly at 3 h by the NaCl and PEG stress

treatment, suggesting NtWRKY6 was an early respond-

ers and may be involved in NaCl and PEG stress in to-

bacco. Clearly, this will be an important clue for future

investigation.

18S

NtWRKY6

1 2 3 4

Figure 4. RT-PCR analysis of expression level of NtWRKY6

in tobacco tissues using the specific primers of NtWRKY6.

18S was used for endogenous control. 1: root; 2: stem; 3:

leaf; 4: flower.

NtWRKY6

18S

0 3 6 12 2 4

Figure 5. RT-PCR analysis of expression level of NtWRKY6

in tobacco seeding at 0, 3, 6, 12 and 24 h after 250 mM

NaCI treatment. 18 S was use d for endoge nous c o ntr ol.

NtWRKY6

18S

0 3 6 12 2 4

Figure 6. RT-PCR analysis of expression level of NtWRKY6

in tobacco seeding at 0, 3, 6, 12 and 24 h after 300 mM PEG

treatment. 18 S was used for endogenous co ntr o l.

4. Discussion

According to WRKY domain number and zinc-binding

motif type, WRKY protein were divided three groups,

group I members contained two WRKY domains and

contained a Cys2His2 zinc-finger motif. Group II and

group III contained one WRKY domain, the second

group zinc-binding motif type was same to the first,

group III zinc-binding motif was Cys2HisCys zinc-finger

motif [15]. Its amino acids sequence was different from

group I and group II. At the present, most of WRKY

proteins were the number of the group II, it was specu-

lated that the first group WRKY proteins were produced

because of WRKY domain lost and mutation, the third

group was produced, probably H was mutated to C in

zinc-binding motif type of the second group. So group I

was the most conservative and group III was the most

active in evolutionary history of WRKY family [22].

Previous studies about some WRKY proteins of tobacco

had indicated their roles in biotic stress. For instance, the

expression level of NtWIZZ (Wound-induced Leucine

Zipper Zinc finger) was rapid accumulation at ten min-

utes and arrived peak at 30 min upon wounding [10].

NtWRKY1 and NtWRKY2 had the same expression pat-

tern with NtWIZZ upon wounding [23].

NtTIZZ was an early responsive gene and hypersensi-

tive responders to tobacco mosaic virus, this protein

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6

from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss

1524

maybe play an important role in defense response [24].

NtWRKY3 and NtWRKY9 were induced by pathogen

and salicylic acid, this suggested they were participated

in pathogen and salicylic acid pathway [6]. NtWRKY3

was downstream genes of MAPK, silencing of tobacco

WRKY8 decreased the expression of defense-related

genes and increased disease susceptibility to the patho-

gens Phytophthora infestans and Colletotrichum orbicu-

lare [25]. Only one report about WRKY from tobacco

was involved in abiotic stress, which had showed a

WRKY gene expression was active by drought stress and

heat shock together, but not by only one factors [26].

We had cloned NtWRKY6 from tobacco Varieties

K326, NtWRKY6 encoded a protein of 549 amino acids.

Phylogenetic analysis showed that the NtWRKY6,

NtWRKY1, PcWRKY1 and HaWRKY7 had a relatively

close relationship. RT-PCR analysis had revealed that

NtWRKY6 was ubiquitously expressed in tobacco tis-

sues including root, stem, leaf, and flower. To further

explore the function of NtWRKY6, RT-PCR was also

used to examine the expression of NtWRKY6 under

NaCl and PEG treatments for 0, 3, 6, 12, 24 h. we had

observed that the expression of NtWRKY6 reached the

highest level at 3 h. It kept 6, 12 h and decreased at 24 h

under NaCl treatment, indicating that NtWRKY6 was a

rapidly responder to NaCl stress. Previous studies had

detected that transcript levels of BcWRKY46 (Brassica

campestrisssp Chinensis.) was induced after 2 h of 150

mM NaCl treatment with real-time RT-PCR [27].

Drought is one of the major factors to limit the plant

growth and development in China, the expression level

of NtWRKY6 transcripts under PEG stress reached the

highest level at 3 h. Then, decreased gradually at 6, 12 h,

and declined rapidly at 24 h. This result showed that

NtWRKY6 was participated in drought stress. Recently

there are many researches about WRKY genes involved

in PEG stress, such as Zhang have showed the transcrip-

tion of HbWRKY1 (Hevea brasiliensis Muell. Arg.) in

leaves was gradually up-regulated and came to its peak at

12 h after 20% PEG 6000 treatment [28]. So, we can

conclude NtWRKY6 might be upstream regulator in salt

and drought pathway. When tobacco faces this two stress,

the expression level of NtWRKY6 rising will increase or

decrease downstream target gene expression, some re-

searches had reported the expression of BcWRKY46

(Brassica campestrisssp Chinensis.) and LtWRKY21

(Larrea tridentata) were both enhanced by drought and

high salinity [27,29]. On the other hand, under drought

and salt stress, no obviously change of the GhWRKY3

expression was observed [30]. OsWRKY80 expression

was up-regulated by drought stress and there was no

change under 100 mM NaCl stress [31]. These results

suggested WRKY protein from different plants had many

different expression patterns and functions.

In conclusion, we have isolated and characterized

NtWRKY6 from tobacco (Nicotiana tabacum L.), then

have examined the tissue distribution and expression

pattern of NtWRKY6 with RT-PCR. According to our

results, NtWRKY6 may play a vital role in the NaCl and

PEG stress of tobacco.

However, for further study, detailed investigations

should be carried out to clarify the function of NtWRKY6,

such as acquiring transgenic plants of over-expression

NtWRKY6 and prokaryotic expression NtWRKY6, these

experiments will be very important in our future work.

5. Acknowledgements

This work was supported by Natural Science Foundation

of China (No. 31070244).

REFERENCES

[1] S. Ishiguro and K. Nakamura, “Characterization of a

cDNA Encoding a Novel DNA-Binding Protein, SPF1,

That Recognizes 1SP8 Sequences in the 50 Upstream Re-

gions of Genes Coding for Sporamin and Beta-Amylase

from Sweet Potato,” Molecular Genetics and Genomics,

Vol. 244, No. 6, 1994, pp. 563-571.

doi:10.1007/BF00282746

[2] S. Robatzek and I. E. Somssich, “A New Member of the

Arabidopsis WRKY Transcription Factor Family, At-

WRKY6, Is Associated with Both Senescence- and De-

fense-Related Processes,” The Plant Journal, Vol. 28,

2001, pp. 123-133.

[3] M. Lagacé and D. P. Matton, “Characterization of a

WRKY Transcription Factor Expressed in Late Torpedo

Stage Embryos of Solanum chacoense,” Planta, Vol. 219,

No. 1, 2004, pp. 185-189.

doi:10.1007/s00425-004-1253-2

[4] Y. H. Xu, J. W. Wang, S. Wang, J. Y. Wang and X. Y.

Chen, “Characterization of GaWRKY1, a Cotton Tran-

scription Factor That Regulates the Sesquiterpene Syn-

thase Gene (+)-δ-Cadinene Synthase-A,” Plant Physiol-

ogy, Vol. 135, No. 1, 2004, pp. 507-515.

doi:10.1104/pp.104.038612

[5] Z. L. Zhang, Z. Xie, X. L. Zou, J. Casaretto, T. H. David

and Q. X. Shen, “A Rice WRKY Gene Encodes a Tran-

scriptional Repressor of the Gibberellin Signaling Path-

way in Aleurone Cells,” Plant Physiology, Vol. 134, No.

4, 2004, pp. 1500-1513.

[6] C. Chen and Z. Chen, “Isolation and Characterization of

Two Pathogen and Salicylic Acid-Induced Genes Encod-

ing WRKY DNA-Binding Proteins from Tobacco,” Plant

Molecular Biology, Vol. 42, No. 2, 2000, pp. 387-396.

doi:10.1023/A:1006399311615

[7] Y. Zhang and L. Wang, “The WRKY Transcription Fac-

tor Superfamily: Its Origin in Eukaryotes and Expansion

in Plants,” BMC Evolutionary Biology, Vol. 5, 2005, pp.

1-12. doi:10.1186/1471-2148-5-1

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6

from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss

1525

[8] P. Z. Yang, C. H. Chen, Z. P. Wang, B. F. Fan and Z. X.

Chen, “A Pathogen and Salicylic Acid-Induced WRKY

DNA-Binding Activity Recognizes the Elicitor Response

Element of the Tobacco Class I Chitinase Gene Pro-

moter,” The Plant Journal, Vol. 18, No. 2, 1999, pp. 141-

149.

[9] L. Du and Z. Chen, “Identification of Genes Encoding

Receptorlikeprotein Kinases as Possible Targets of Patho-

gen-Andsalicylic Acid-Induced WRKY DNA-Binding

Proteins in Arabidopsis,” The Plant Journal, Vol. 24, No.

6, 2000, pp. 837-847.

[10] K. Hara, M. Yagi, T. Kusano and H. Sano, “Rapid Sys-

temic Accumulation of Transcripts Encoding a Tobacco

WRKY Transcription Factor upon Wounding,” Molecu-

lar Genetics and Genomics, Vol. 263, No. 1, 2000, pp.

30-37. doi:10.1007/PL00008673

[11] S. Robatzek and I. E. Somssich, “Targets of AtWRKY6

Regulation during Plant Senescence and Pathogen De-

fense,” Genes & Development, Vol. 16, 2002, pp. 1139-

1149. doi:10.1101/gad.222702

[12] M. Luo, E. S. Dennis, F. Berger, W. J. Peacock and A.

Chaudhury, “A MINI SEED3 (MINI3), a WRKY Family

Gene, and HAIKU2 (IKU2), a Leucine-Rich Repeat

(LRR) Kinase Gene, Are Regulators of Seed Size in

Arabidopsis,” Proceedings of the National Academy of

Sciences of the USA, Vol. 102, No. 48, 2005, pp. 17531-

17536. doi:10.1073/pnas.0508418102

[13] B. N. Devaiah, A. S. Karthikeyan and K. G. Raghothama,

“WRKY75 Transcription Factor Is a Modulator of Phos-

phate Acquisition and Root Development in Arabidop-

sis,” Plant Physiology, Vol. 143, No. 4, 2007, pp. 1789-

1801.

[14] Y. F. Chen, L. Q. Li, Q. Xu, Y. H. Kong, H. Wang and W.

H. Wu, “The WRKY6 Transcription Factor Modulates

PHOSPHATE1 Expression in Response to Low Pi Stress

in Arabidopsis,” The Plant Cell, Vol. 21, No. 11, 2009,

pp. 3554-3566. doi:10.1105/tpc.108.064980

[15] T. Eulgem, P. J. Rushton, S. Robatzek and I. E. Somssich,

“The WRKY Superfamily of Plant Transcription Fac-

tors,” Trends in Plant Science, Vol. 5, No. 5, 2000, pp.

199-206. doi:10.1016/S1360-1385(00)01600-9

[16] P. J. Rushton, H. Macdonald, A. K. Huttly, C. M. Lazarus

and R. Hooley, “Members of a New Family of DNA-

Binding Proteins Bind to a Conserved cis-Element in the

Promoters of Alpha-Amy2 Genes,” Plant Molecular Bi-

ology, Vol. 29, No. 4, 1995, pp. 691-702.

[17] M. Skibbe, N. Qu, I. Galis and I. T. Baldwin, “Induced

Plant Defenses in the Natural Environment: Nicotiana

Attenuata WRKY3 and WRKY6 Coordinate Responses

to Herbivory,” The Plant Cell, Vol. 20, No. 7, 2008, pp.

1984-2000. doi:10.1105/tpc.108.058594

[18] Y. L. Zhuang, G. J. Ren, C. M. He, X. Y. Li, Q. M. Meng,

C. F. Zhu, R. C. Wang and J. Zhang, “Cloning and Char-

acterization of a Maize cDNA Encoding Glutamate De-

carboxylase,” Plant Molecular Biology Reporter, Vol. 28,

No. 4, 2010, pp. 620-626.

[19] X. M. Liu, J. M. Anderson and P. M. Pijut, “Cloning and

Characterization of Prunus serotina AGAMOUS, a Puta-

tive Flower Homeotic Gene,” Plant Molecular Biology

Reporter, Vol. 28, No. 2, 2010, pp. 193-203.

doi:10.1007/s11105-009-0140-1

[20] K. Tamura, J. Dudley, M. Nei and S. Kumar, “MEGA4:

Molecular Evolutionary Genetics Analysis (MEGA)

Software Version 4.0,” Molecular Biology and Evolution,

Vol. 24, No. 8, 2007, pp. 1596-1599.

[21] L. J. Wu, X. T. Wang, L. C. Wu, P. G. Wang and Y. H.

Chen, “Molecular Cloning and Expression Analysis of an

HINT1Homologue from Maize (Zea mays L.),” Plant

Molecular Biology Reporter, Vol. 29, 2011, pp. 1006-

1012.

[22] B. Ulker and I. E. Somssich, “WRKY Transcription Fac-

tors: From DNA Binding towards Biological Function,”

Current Opinion in Plant Biology, Vol. 263, No. 5, 2004,

pp. 491-498. doi:10.1016/j.pbi.2004.07.012

[23] T. Nishiuchi, H. Shinshi and K. Suzuki, “Rapid and Tran-

sient Activation of Transcription of the ERF3 Gene by

Wounding in Tobacco Leaves Possible Involvement of

NtWRKYs and Auto Repression,” Journal of Biological

Chemistry, Vol. 279, No. 53, 2011, pp. 55355-55361.

doi:10.1074/jbc.M409674200

[24] H. Yoda, M. Ogawa, Y. Yamaguchi, N. Koizumi, T. Ku-

sano and H. Sano, “Identification of Early-Responsive

Genes Associated with the Hypersensitive Response to

Tobacco Mosaic Virus and Characterization of a WRKY-

Type Transcription Factor in Tobacco Plants,” Molecular

Genetics and Genomics, Vol. 267, No. 2, 2002, pp. 154-

161. doi:10.1007/s00438-002-0651-z

[25] N. Ishihama, R. Yamada, M. Yoshioka, S. Katou and H.

Yoshioka, “Phosphorylation of the Nicotiana Bentha-

miana WRKY8 Transcription Factor by MAPK Functions

in the Defense Response,” The Plant Cell, Vol. 23, No. 3,

2011, pp. 1153-1170.

[26] L. Rizhsky, H. Liang and R. Mittler, “The Combined

Effect of Drought Stress and Heat Shock on Gene Ex-

pression in Tobacco,” Plant Physiology, Vol. 130, No. 3,

2012, pp.1143-1151. doi:10.1104/pp.006858

[27] F. Wang, X. L. Hou, J. Tang, Z. Wang, S. M. Wang, F.

Jiang and Y. Li, “A Novel Cold-Inducible Gene from

Pak-Choi (Brassica campestrisssp. chinensis), BcWRKY46,

Enhances the Cold, Salt and Dehydration Stress Toler-

ance in Transgenic Tobacco,” Molecular Biology Reports,

Vol. 39, No. 4, 2012, pp. 4553-4564.

doi:10.1007/s11033-011-1245-9

[28] Q. Q. Zhang, J. H. Zhu, Y. M. Ni, Y. B. Cai and Z. L.

Zhang, “Expression Profiling of HbWRKY1, an Ethe-

phon-Induced WRKY Gene in Latex from Hevea brasil-

iensis in Responding to Wounding and Drought,” Trees,

Vol. 26, No. 2, 2012, pp. 587-595.

doi:10.1007/s00468-011-0623-1

[29] X. L. Zou, Q. Shen and D. Neuman, “An ABA Inducible

WRKYgene Integrates Responses of Creosote Bush (Lar-

rea tridentata) to Elevated CO2 and Abiotic Stresses,”

Plant Science, Vol. 172, No. 5, 2004, pp. 997-1004.

doi:10.1016/j.plantsci.2007.02.003

[30] R. Y. Guo, F. F. Yu, Z. Gao, H. L. An, X. C. Cao and X.

Q. Guo, “GhWRKY3, a Novel Cotton (Gossypium hirsu-

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6

from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss

1526

tum L.) WRKY Gene, Is Involved in Diverse Stress Re-

sponses,” Molecular Biology Reports, Vol. 38, No. 1,

2011, pp. 49-58. doi:10.1007/s11033-010-0076-4

[31] K. Felipe, R. Ricachenevsky, S. Antonio, K. Paloma, J.

Menguer and F. Palma, “Identification of Fe-Excess-In-

duced Genes in Rice Shoots Reveals a WRKY Transcrip-

tion Factor Responsive to Fe, Drought and Senescence,”

Molecular Biology Reports, Vol. 37, No. 8, 2010, pp.

3735-3745.