Vol.2, No.7, 718-725 (2010) Natural Science
http://dx.doi.org/10.4236/ns.2010.27089
Copyright © 2010 SciRes. OPEN ACCESS
Residues of 862, 921 of VP3 are associated with
virulence in infectious bursal disease virus
strain Harbin-1
Renmao Li1,2, Haiying Wang1,3, Guangming Huang1, Manfu Zhang1*
1Lab for Animal Molecular Virology, College of Biological Sciences, China Agricultural University, Beijing, China; *Corresponding
2Life Sciences and Technology School, Zhanjiang Normal University, Zhanjiang, China
3Department of Biochemistry and Molecular Biology, Peking University Health Center, Beijing, China
Received 25 February 2010; revised 28 April 2010; accepted 6 May 2010.
ABSTRACT
Reverse genetics was used to study the effect of
particular amino acids of infectious bursal dis-
ease virus (IBDV) on virulence. Using site-di-
rected mutagenesis, altering of two amino acids
in VP2 (Q253H, A284T) and VP3 (H783Q, V862M,
I921V) in the segment A of a Chinese very virulent
IBDV field strain Harbin-1, 4 virus mutants in-
cluding H253/284, H783/862, H862/921, H921/783 were res-
cued. To evaluate the characteristics of the re-
covered viruses in vivo, we inoculated 4-week-old
chickens with virus mutants and rescued Harbin-
1 (rHarbin-1), analyzed their bursae for patho-
logical lesions 4 days postinfection. rHarbin-1
and H783/862, H253/284 caused severe bursal lesion,
milder lesion for H862/921, mildest for H921/783. How-
ever, H253/284 caused the lowest mortality. The re-
sults showed that residue at position Q253, A284
of VP2 and V862, I921 of VP3 gene are involved
with virulence, but there is difference between
VP2 and VP3’s role in virulence. The ability of 862
and 921 to control virulence in VP3 is stronger
than 253 and 284.
Keywords: IBDV; VP3; Mutagenesis; Reverse
Genetics; Virulence
1. INTRODUCTION
Infectious bursal disease (IBD) is a highly contagious
disease among young chickens and characterized by the
destruction of the bursa of Fabricius. IBD was first de-
scribed by Cosgrove [1], but in China the first case was
reported in 1979 [2]. Nowadays IBD has spread world-
wide and continues to threat the poultry industry. Infec-
tious bursal disease virus (IBDV) is the causative agent
of the disease, belonging to Avibirnavirus genus of the
Birnaviridae family [3]. Europe had experienced the
emergence of very virulent infectious bursal disease vi-
rus (vvIBDV) which can cause up to 70% flock mortal-
ity [4,5]. Meanwhile, vvIBDV infections also have been
observed in Asia and in South America [6].
The genome of IBDV consists of two segments of
double-stranded RNA (dsRNA), approximately 3.4 kb
(segment A) and 2.7 kb (segment B) in length [7]. Seg-
ment A contains two partially overlapping open reading
frames (ORFs). The larger ORF encodes a polyprotein
(1,012 amino acids, 110 kDa) that is autocatalytically
cleaved to yield the viral proteins pVP2 (VPX) (48 kDa),
VP4 (29 kDa) and VP3 (33 kDa). During virus matura-
tion, pVP2 is processed into matured VP2 (41 to 38
kDa), probably resulting from site-specific cleavage of
pVP2 by a host cell-encoded protease [8]. The smaller
ORF encodes the nonstructural protein VP5 (145 to 149
amino acids, 17 kDa). Segment B encodes VP1 (970
kDa) having putative RNA-dependent RNA polymerase
activity [9,10]. This protein is covalently linked to the 5'
ends of the genomic RNA segments or present at a free
form [11,12]. VP2 and VP3 are the major structural pro-
tein of the virion. The VP2 is the major host-protective
antigen of IBDV and contains the determinants respon-
sible for causing antigenic variation [13-15]. Position
279 and 284 amino acids in the VP2 variable region
possibly contribute to virulence of IBDV [16]. Residues
253 and 284 of the VP2 protein of the variant virus are
necessary for tissue culture infectivity [17]. The viru-
lence and pathogenic-phenotype markers of IBDV reside
in VP2 and residues at position 253 (Gln), 279 (Asp) and
284 (Ala) of VP2 are involved in the virulence and
*Part of the contents in this article was presented in Shanghai Univer-
sity in June of 2009.
R. M. Li et al. / Natural Science 2 (2010) 718-725
Copyright © 2010 SciRes. OPEN ACCESS
719
719
pathogenic phenotype of virulent IBDV [18-20]. How-
ever, recent study demonstrated VP2 is not the sole de-
terminant of the very virulent phenotype [21]. C-termi-
nal part of VP3 may play a decisive role in controlling
the virulence [22]. VP3 could play an important role in
receptor-mediated virus-cell attachment, which implied
that VP3 has relation with virulence [23].
In order to verify if VP3 have molecular determi-
nant of virulence for Chinese vvIBDV strain Harbin-1,
amino acids in VP3 among Harbin-1, D78 (vaccine
strain), TY89 (IBDV serotype II) were aligned, the
different amino acids among them were listed in Ta-
ble 1. TY89 could not infect B lymphocytes, having
no virulence to B lymphocytes, and D78 has mild
virulence to B lymphocytes. Based on the result of
alignment the amino acids in VP3 that maybe in-
volved in virulence could be found. Position 783 and
862 in Harbin-1 have different amino acids from D78,
however, position 921 is different from TY89. To
prove their role in virulence, position 783, 862 and
921 in VP3 were mutated subsequently to obtain the
combination of two points mutation. As a control,
position 253 and 284 in VP2 hypervarible region was
mutated at the same time. By use of cRNA-based re-
verse-genetics system for IBDV [20], four virus mu-
tants were recovered. Furthermore, the characteristics
of recovered virus in vitro and in vivo were described
and the amino acids responsible for virulence. In this
paper we report the discovery that residues of 783,
862, 921 of VP3 are associated with virulence of
IBDV.
2. MATERIALS AND METHODS
2.1. Virus and Cells
The very virulent strain Harbin-1 was kindly given by
Harbin Veterinary Research Institute of the Chinese Aca-
demy of Agricultural Sciences. Harbin-1 causes 100%
morbidity and mortality of specific-pathogen-free (SPF)
chickens, the mean infection lethal dose (ILD50) for SPF
embryo is 10-4/0.2 ml. Primary bursal cells were derived
from 18-day-old embryonated SPF eggs (Merial, Beijing,
China) and were grown in Dulbecco’s minimal essential
medium (DMEM, Sigma Aldrich, St. Louis, MO, USA)
supplemented with 10% fetal calf serum (FCS) and
maintained with DMEM with 5% FBS [22]. Transfec-
tion experiments were performed on primary bursal cells.
All virus mutants including H253/284, H783/862, H862/921,
H921/783 and rHarbin-1, Harbin-1 were used as the viruses
for challenge at a dose of 1200 pfu per animal via eye
and nose drop.
2.2. Construction of Full-Length CDNA
Clones
Several clones for segment A and segment B of Harbin-
1 were constructed, pGEM-T-HA (coding sequence of
segment A clone), pGEM-T-H5-A (5 non-coding se-
quence of segment A clone), and pGEM-T-H3A (3
non-coding sequence of segment A clone), pGEM-T-HB
(coding sequence of segment B clone), pGEM-T-H5B
(5 non-coding sequence of segment B clone), pG
EM-T-H3B (3 non-coding sequence of segment B
clone). All recombinant plasmids were based on pGEM-
T (Promega, Madison, WI, USA). There is partly over-
lapped area between CR (coding region) clone and NCR
(non-coding region) clone for segment A and B. But the
overlapped area lack appropriate restriction site, thus
fusion PCR was used to ligate the NCR and CR to obtain
the full length cDNA clone for segment A and B. Oli-
gonucleotides HACR1, HACR2, HANCR1, HAN CR2,
HBCR1, HBCR2, HBNCR1, HBNCR2 (Table 2) were
adopted for segment A and B. For transcription in vitro,
EcoRI site and T7 promoter was introduced into 5 end
of oligonucleotides; XbaI site at 3 end in segment A and
XhoI site at 3 end in segment B. The fusion PCR prod-
uct of segment A and B was ligated into the T-vector
(Takara Bio, Dalian, China) to obtain full-length cDNA
clone named as pRHA and pRHB respectively. The se-
quence of final products was determined by Takara Bio
Ltd.
2.3. Site-Directed Mutagenesis
Mutations were introduced into the cDNA of segment A
of Harbin-1 according to the manufacture’s instruction
of QuickChange site-directed mutagenesis kit (Strata-
gene, La Jolla, CA, USA) with minor modification.
Amino acid residues 253, 284, 783, 862, 921 were lo-
cated in large open reading frame of segment A and their
Table 1. Different AA in VP3 for Harbin-1 and vaccine strain, serotype II strain.
AA site 767 773 783 787 815 862 899 905 921 947 981 990 992 1005 AA site
strain strain
Harbin-1 S E H S R V D L I K P V T A Harbin-1
D78 S E Q S R M D L I K L A T A D78
TY89 D D R Q K M E P V R P A S T TY89
R. M. Li et al. / Natural Science 2 (2010) 718-725
Copyright © 2010 SciRes. OPEN ACCESS
720
Table 2. Oligonucleotides used for amplification of Harbin-1 sequence*.
Oligonucleotides Qrientation Position Name
CTCCTCCTTCTACAACGCTATCAT sense 71-94 HACR1
GAATCTAGAGGGGACCCGCGAACG XbaI antisense 3246-3260 HACR2
GGAATTCTAATACGACTCACTATAGGGGGGATACGATCGGTCTG sense 1-20 HANCR1
EcoRI
GATCTTGCAGGTTCGTCATCGC antisense 128-149 HANCR2
TGGCTACTAGGGGCGATGC sense 42-6 HBCR
CTTCTTGAGTGGTTCCCATC antisense 2756-2775 HBCR2
GGAATTCTAATACGACTCACTATAGGATACGATGGGTCTGACCCT sense 1-21 HBNCR1
EcoRI
GTCACTCATGGTGGCAGAATCAT antisense
98-120
HBNCR2
AAACAAGCGTCCAtGGCCTTATACTGGGTGCTA sense 876-908 253mut1
TAGCACCCAGTATAAGGCCATgGACGCTTGTTT antisense 876-908 253mut2
GACAATGGGCTAACGACcGGCACTGACA sense 965-992 284mut1
TGTCAGTGCCgGTCGTTAGCCCATTGTC antisense 965-992 284mut2
GACCCACTGTTCCAaTCTGCGCTCAG sense 2465-2490 783mut1
CTGAGCGCAGAtTGGAACAGTGGGTC antisense 2465-2490 783mut2
CTCAAAGAAGaTGGAGACTATGGG sense 2704-2727 862mut1
CCCATAGTCTCCAtCTTCTTTGAG antisense 2704-2727 862mut2
CATCAGAAGAACAAgTCCTAAGGGCAG sense 2877-2903 921mut1
CTGCCCTTAGGAcTTGTTCTTCTGATG antisense 2625-2652 921mut2
TAACCGTCCTCAGCTTACCC sense 625-644 outside1
TCAGGATTTGGGATCAGCTC antisense 1246-1265 outside2
CCAACCAGCGAGATAACC sense 1019-1036 inside 1
GGCGACCGTAACGACAG antisense 1212-1228 inside 2
TTCTCAGCTAATATCGATGC sense 842-861 53,84 inupper
GATGTGATTGGCTGGGTT antisense 1057-1074 53,84 inlower
GTCCAACTGGGCGACGTT sense 2296-2313 vp3 outupper
CTGGGATTGCGATGCTTCA antisense 3069-3087 vp3 outlower
CTTCCACCCAATGCAGGAC sense 2378-2396 783 inupper
CTTTGGCGACTTCGTCTATGA antisense 2976-2996 62,21 inlower
*Sequence and location of the oligonucleotide used in the study. Underlined nucleotides are virus-specific. Altered nucleotides for mutagene-
sis are in lowercase, the altered coding nucleotide triplets are highlighted in boldface. Used restriction sites are highlighted in boldface and
appropriate restriction enzymes are named. The positions where the primers bind (nucleotide number) are in accordance with the sequence of
strain P2 (Mundt et al., 1995).
base sites were in position 893(AT), 984(GA),
2483(TA), 2718(GA), 2895(AG) respectively in
segment of Harbin-1. First, single site-directed muta-
genesis was introduced into the segment A of Harbin-1
with oligonucleotides 253 mut, 783 mut, 862 mut, 921
mut (Table 2); the mutants were sequenced to verify the
R. M. Li et al. / Natural Science 2 (2010) 718-725
Copyright © 2010 SciRes. OPEN ACCESS
721
721
resultant mutation; after then the second site-directed
mutagenesis was introduced into the first mutation
product with oligonucleotides 284 mut, 862 mut, 921
mut, 783 mut (Table 2) to obtain two point mutagenesis
clone named p253/284 m, p783/862 m, p862/921 m,
p921/783 m respectively. The second mutation products
were sequenced by the company (Takara). The obtained
muta-genized plasmids with the alteration of two amino
acids, Q253H-A284T, H783Q-V862M, V862M-I921V,
H783 Q-I921V were used for subsequent transcription in
vitro and transfection experiments.
2.4. Transcription and Transfection of
Synthetic RNAs
The experiment was performed by the protocol de-
scribed by Mundt with minor alterations [24]. For tran-
scription in vitro, non-mutation and mutated plasmids of
segment A and intact segment B were linearized by
cleavage with XbaI and XholI respectively. After re-
strictive digestion, the products were adjusted to 0.5%
SDS and incubated with proteinase K (0.5 mg/ml) for 1
hr at 37. The linearized DNA templates were recov-
ered by ethanol precipitation, and 1 μg linearized DNA
was used for transcription. Segment A and segment B
was transcribed respectively. Transcription reaction mix-
ture (30 µl) containing 40 mM Tris-HCl (pH 7.9), 10
mM NaCl, 6 mM MgCl2, 2 mM spermidine, 0.5 mM
ATP, 0.5 mM CTP, 0.5 mM UTP, 0.1 mM GTP, 0.25
mM cap analog [m7G(5)ppp(5)G] (Promega), 20 units
RNasin, 130 units T7 RNA polymerase (Promega), and
incubated at 37 for 1 hr. As controls, the transcription
products were treated with either DNase or RNase
(Promega).
After primary bursal cells were grown to 80% con-
fluency in 35-mm dishes, the cells were washed with
DMEM (free serum) and incubated at 37 for 10 min-
utes in a CO2 incubator. The process was repeated again.
Simultaneously, 60 μl DMEM (free serum) was incu-
bated with 6 μl of Lipofectin reagent (Invitrogen, Carls-
bad, CA, USA) for 60 min in a polystyrene tube at room
temperature to form Lipofectin-DMEM mixture. Syn-
thetic RNA transcripts of both segments resuspended in
30 μl of DEPC treated water were mixed and added to
the DMEM-Lipofectin mixture, mixed gently and incu-
bated on ice for 5 min. After removing the DMEM from
the monolayers in the 35-mm dishes and replacing it
with fresh 800 μl of DMEM, the nucleic acid-containing
mixture was added drop-wise to the cells and swirled
gently. After 2 hours of incubation at 37, the mixture
was replaced with DMEM containing 5% FCS (without
rinsing the cells), and further incubated at 37 for de-
sired time intervals.
2.5. Virus Recovery from cRNA and Detect
the Presence of Virus by AC-ELISA,
RT-PCR and Plaque Assay
Two days after transfection, cells were frozen -thawed
and centrifuged at 700 g to remove cellular debris. The
supernatant was passaged for 4 times in the primary bur-
sal cells, harvesting the cells for ELISA. In order to
screen the recombinant virus from many samples AC-
ELISA was performed. Each well of 96-wells polysty-
rene ELISA plates (Costar, Cambridge, MA, USA) were
coated with 100 μl of chicken polyclonal IBDV antise-
rum, diluted in PBS at a ratio of 1:4000. After incubation
at 37 for 1 hour, the plate was washed three times with
washing buffer (1% Tween 80 in PBS) and each well
was blocked by 100 μl of blocking buffer (0.5% gelatin
in PBS) at 37 for 0.5 h. After three washes of the plate
with washing buffer, 100 μl sample including positive
and negative control was added in duplicate. The plate
was then incubated at room temperature for 1 h and
washed with washing buffer before 50 μl of MAbs M6
or B29 [25,26]., diluted 1:2500 and 1:1000 in antibody
diluent (5% NaCl and 4% BSA in washing buffer) re-
spectively, were added to the wells in duplicate. After
incubation for 1 h at room temperature, the plate was
washed three times with washing buffer. Subsequently,
50 μl of goat anti-mouse IgG-horseradish peroxidase
(Sigma) diluted 1:1000 with antibody diluent was added.
One hour later at room temperature, the plate was
washed three times with washing buffer. After addition
100 μl TMB peroxidase substrate (Kirkegaard and Perry
Laboratories Inc., Gaithersburg, MD, USA) and incu-
bated at 37 for 15 min, the reaction was stopped by
adding 100 μl 1 M H3PO4. The result was read by an
ELISA reader at the optical density at 450 nm (OD450).
If OD value of sample is greater than mean OD value
plus 3 times standard deviation of negative control sam-
ple, then the sample is considered as positive and was
stocked at 86 for future use.
The titre of virus mutants was determined using
plaque assay [27] and prepared for future animal ex-
periment. The titre is represented as PFU/ml.
IBDV mutants were reversely transcribed using out-
side 1 and nested PCR was amplified using outside 1,
outside 2, inside 1 and inside 2 primer (Table 2).
2.6. Genetic Stability Analysis
If changes in the amino acid sequence occurred during
passaging viral RNA of IBDV before challenge, the
identity of virus have to be confirmed. The virus mutants
were subjected to RT-PCR using oligonucleotides out-
side 1 and outside 2 for IBDV with VP2 mutation, VP3
outupper and VP3 outlower for IBDV with VP3 muata-
tion before challenge (Table 2). Nested PCR was ampli-
R. M. Li et al. / Natural Science 2 (2010) 718-725
Copyright © 2010 SciRes. OPEN ACCESS
722
fied with 783 inupper and 62, 21 inlower to identify vi-
rus with VP3 alteration (Table 2). Cloned PCR frag-
ments of IBDV mutants were sequenced and obtained
sequences were analyzed with DNAStar.
2.7. Virulence of IBDV Mutants in Young
SPF Chickens
Forty eight 4-week-old SPF White Leghorn chickens
were divided randomly into six groups including posi-
tive control group. Chickens were infected via eye and
nose drop with total 1200 PFU. Non-inoculated hatch-
mates were used as negative controls. During the course
of the experiment animals were observed daily for clini-
cal signs and mortality. At 4 days p.i., all alive chickens
from each group were bled and euthanized. The bursa of
each chicken (include alive and dead) was removed,
weighed and subdivided into two parts. One part was
used for detecting the presence of IBD viral antigen by
means of an AC-ELISA and RT-PCR. The second part
was fixed in 10% neutral-buffered formalin for histology.
Formalin-fixed bursal samples were embedded in paraf-
fin, sectioned and stained with haematoxylin and eosin
(H&E). Microscopic bursal lesion score (BLS) was de-
termined by histopathological analysis of the bursa. BLS
was evaluated on a scale of 0 to 5 as follows: 0, no ab-
normalities; 1, 1-20%; 2, 21-40%; 3, 41-60%; 4, 61-80%;
and 5, 81-100% lymphocyte depletion [28].
2.8. Detection of Viral Antigen in Bursae
after Challenge
Bursae were homogenized with homogenizer. The
presence of virus in the bursal homogenate was de-
tected with AC-ELISA which incorporated Mab 6
recognizing VP2-located epitopes [25].
3. RESULTS
3.1. Determination of Nucleotide Sequence
of Harbin-1 Mutant
To establish a reverse genetics system the complete ge-
nomic sequence of Harbin-1 mutants was determined.
The mutagenized plasmids were obtained with the al-
teration of two amino acids, Q253H-A284T, H783Q-
V862M, V862M-I921V, H783Q-I921V.
3.2. Rescue of Recombinant Virus from
cDNA
Primary bursal cells were transfected with synthesized
cRNA of mutated segment A and intact segment B by
means of lipofectin (Invitrogen). After every transfection,
the resultant supernatant was used for RT-PCR and AC-
ELISA to detect the presence of viruses. The samples
were performed to RT-PCR after IBDV antigen was de-
tectable using AC-ELISA. Electrophoresis result showed
that there is one 209 bp band, whose sequence located in
VP2 hypervarible region, on 1.2% agarose gel. The re-
sult of RT-PCR and AC-ELISA demonstrated that virus
mutants were successfully recovered. From 10 transfec-
tion samples we obtained four mutant viruses designated
as H253/284, H783/862, H862/921, H921/783 and rescued Harbin-1
named rHarbin-1.
3.3. Genetic Stability Analysis
Sequence analysis of the RT-PCR products confirmed
the identity of the IBDV used. No amino acid substitu-
tions compared to the sequence of the used plasmids
(p253/284 m, p783/862 m, p861/921 m, p921/783 m)
were found within the region flanked by primers used
for RT-PCR, proving the genetic stability of the virus
during virus pass aging.
3.4. Virulence Determinants for VP2 and
VP3 in Chinese vvIBDV Strain
To evaluate the virulence of all virus mutants animal
experiments were performed. Animals infected with
vvIBDV (rHarbin-1) and H783/862 showed severe clinical
signs of IBD. The mortality rates were 7/8 for rHarbin-1,
5/8 for H783/862, 1/8 for H253/284 and H862/921. In contrast,
none of the animals infected with H921/783 died or showed
clinical signs of IBD. Bursae of chickens infected with
the different virus mutants showed depletion of bursal
cells in lymph nodule with remarkable differences (Fig-
ure 1). rHarbin-1 and H253/284, H783/862 induced severe
bursal lesion (BLS of 5, 1.6, 3.1 respectively); H862/921
induced mild lesion (BLS 1.5); H921/783 hardly induce
lesion (BLS 0). As to the ration of bursal weight and
body weight, rHarbin-1 and H783/862 showed severe bur-
sal atrophy (3.39, 3.94 respectively). There was no re-
markable difference among H253/284, H862/921, H921/783 and
negative control (4.0, 4.8, 4.94, 4.71 respectively) (Ta-
ble 3). The above-mentioned results demonstrated that
V862 and I921 in VP3 are probably the major virulence
determinants, furthermore, 862 and 921 in VP3 has the
stronger ability to manage virulence than 253 and 284 in
VP2.
4. DISCUSSION
In recent years, many investigators have shown that mu-
tations in the viral genome often lead to changes in the
virulence, pathogenesis of animal viruses. A single
amino acid substitution in the West Nile Virus Nonstru-
ctural protein NS2A disables its ability to inhibit Al-
pha/Beta interferon induction and attenuates virus in
mice [18]; point mutations in an infectious bovine viral
diarrhoea virus type2 cDNA transcript yields an attenu-
R. M. Li et al. / Natural Science 2 (2010) 718-725
Copyright © 2010 SciRes. OPEN ACCESS
723
723
Table 3. Results of chicken challenged by four recombinant viruses.
Virus Number of
Chickens* Mortality Avg bursa/body wt,
Ratio (SD), 103
Avg BLS**
(SD) Pathological Lesions
H253/284 8 1/8 4.0 (2.0) ab 1.6 (1.1)b individual lymphatic nodule necrosis and atrophy in dead chicken
H783/862 8 5/8 3.9 (1.5) ab 3.1 (2.6)c lymphatic nodule severe necrosis and atrophy in dead chickens
H862/921 8 1/8 4.8 (1.4) b 1.5 (1.4)b lymphatic nodule partly necrosis and slightly atrophy in dead chicken
H921/783 8 0/8 4.9 (0.9)b 0 (0.0)a lymphatic nodule slightly atrophy and widen interstice close to
normal
rHarbin-1 8 7/8 3.4 (0.9) a 5 (0.0)d lymphatic nodule appear necrosis, congest and hemorrhage
Native
Harbin-1 8 7/8 3.1 (0.4)a 5 (0.0)d lymphatic nodule appear necrosis, congest and severe hemorrhage,
atrophy
Negative
control 8 0/8 4.7 (0.3)b 0 (0.0)a normal
*The indicated number of 4-week-old SPF chickens were infected via the eye and nose drop; **BLS of BF of each chicken investigated. Values within
the same row with the same superscript letters are not significant (P < 0.05).
Figure 1. Microscopic pathological effect in bursae challenged
by virus mutants (10 × 20) (a) H253/284 single lymph nodule
necrosis, atrophy, BLS 4; (b) H783/862 lymph nodule severe ne-
crosis, atrophy, BLS 4.5; (c) H862/921 lymph nodule partly ne-
crotize, BLS 2.3; (d) H921/783 close to normal, BLS 0; (e) rHar-
bin-1 lymph nodule necrosis, congest and hemorrhage BLS 5;
(f) CK (negative); (g) Harbin-1 (positive control) lymph nod-
ule necrosis, congest and severe hemorrhage, atrophy BLS 5.
ated and protective viral progeny. Virulence of swine
vesicular disease virus is determined at two amino acids
in capsid protein VP1 and 2A protease [14]. Above men-
tioned phenomena elicit researchers on IBDV and they
dedicated to study the virulence mechanism. A number
of researchers such as Brandt, Yamaguchi, Lim, Mundt
and so forth assumed position 253, 279, 284 amino acids
in VP2 hypervarible region control phenotype, and could
bind with B lymphocyte [3,17,21,29]. Lots of evidence
showed that hypervarible region in VP2 involved in
conformation dependent epitope and stimulate the chi-
cken to produce protective neutralizing antibody [10,
29].
The result of chickens challenged with viruses showed
that H253/284 could induced slighter lesion than parental
virus vvIBDV (Harbin-1), but in H783/862 group, there are
two kinds of appearance ,the bursa in alive chickens had
not showed pathological sign, which could be due to the
individual difference, but the bursae of dead chickens
showed severe necrosis and atrophy, B lymphocyte de-
pletion was up to the same 80-90% as Harbin-1; in
H862/921 group, a bursa of dead chicken had the same
pathological lesion as Harbin-1, lymphocyte depletion
up to above 90%, in other bursae of alive chickens de-
pletion is only 10-20%, and appear partly necrosis and
atrophy; in H921/783 group bursae had very slightly
pathological lesion except minor widening interstice,
suggesting bursa was slight swollen. Therefore, H921/783
virus appeared the slightest pathological lesion among
all virus mutants. Compared with mDT-VP3C and
mDCT-VP3C rescued by Boot who substituted the C-
terminal part of VP3 of serotype 1 vvIBDV (isolate
D6948) for the corresponding part of serotype 2 IBDV
[22], H921/783 induced slighter pathological lesion than
R. M. Li et al. / Natural Science 2 (2010) 718-725
Copyright © 2010 SciRes. OPEN ACCESS
724
mDT-VP3C and mDCT-VP3C. mDT-VP3C and mDCT-
VP3C could induced same bursa lesion as wild type
D6948 and rD6948, suggesting mDT-VP3C and mDCT-
VP3C had stronger residential virulence, but H921/783
virus hardly has no residential virulence.
Our experiment demonstrated that VP3 and VP2 con-
tain the determinant for virulence too besides VP2 in one
strain. However, up to now most researches assume VP2
play an important role in virulence. The reason for this
paradox about virulence controlling mechanism is un-
known. Molecular determinant of virulence may depend
the strains used. In addition we used two alterations of
amino acid in this paper. Single alterations of aa 783,
862 and 921 were not tested, further study may be nec-
essary to identify if single amino acid function or both of
them function in virulence at the same time.
5. CONCLUSIONS
V862, I921 in VP3 is obvious virulence marker how-
ever I921 has more potential ability to control viru-
lence than V862 and H783. Through animal challenge
test we make clear the site in VP2 and VP3 involved in
virulence, furthermore, the ability of 862 and 921 to
control virulence in VP3 is more powerful than 253
and 284 in VP2.
6. ACKNOWLEDGEMENTS
We thank Professor Zhizhong Cui in Shandong Agricultural University
for his assistance in animal experiment. Professor Zhao Deming in
National Animal TSE Lab in China Agricultural University is grate-
fully acknowledged for his assistance in Quantitative realtime PCR
experiment. This study was supported by Chinese NSFC grant No.
9893290 and INCO-China grant ERBIC18CT98-0330.
REFERENCES
[1] Cosgrove, A.S. (1962) An apparently new disease of
chickens: Avian nephrosis. Avian Diseases, 6(3), 385-
389.
[2] Wei, Y.W., Yu, X.P., Zheng, J.T., Chu, W.Y., Xu, H.,
Yu, X.M. and Yu, L. (2008) Reassortant infectious bursal
disease virus isolated in China. Virus Research, 131(2),
279-282.
[3] Delmas, B. (2005) Birnaviridae. In: Virus Taxonomy, 8th
Report of the International Committee on Tax- onomy of
Viruses, Fauquet, C.M., Mayo, M.A., Maniloff, J.,
Desselberger, U. and Ball, L.A., Eds, Elsevier Aca-
demic, London, 561-569.
[4] Müller, H. (2003) Research on infectious bursal disease-
the past, the present and the future. Veterinary Micro-
biology, 97(1-2), 153-165.
[5] Yamaguchi, T., Ogawa, M., Miyoshi, M., Inoshima, Y.,
Fukushi, H. and Hirai, K. (1997) Sequence and phy-
logenetic analyses of highly virulent infectious bursal
disease virus. Archives of Virology, 142(7), 1441-1458.
[6] Ikuta, N., El-Attrache, J., Villegas, P., Garcia, E.M.,
Lunge, V.R., Fonseca, A.S., Oliveira, C. and Marques,
E.K. (2001) Molecular characterization of Brazilian
infectious bursal disease viruses. Avian Diseases, 45(2),
297-306.
[7] Dobos, P., Hill, B.J., Hallett, R., Kells, D.T.C., Becht, H.
and Teninges, D. (1979) Biophysical and biochemical
characterization of five animal viruses with bisegmented
double-stranded RNA genomes. Journal of Virology,
32(2), 593-605.
[8] Kibenge, F.S., Qian, B., Cleghorn, J.R. and Martin, C.K.
(1997) Infectious bursal disease virus polyprotein pro-
cessing does not involve cellular proteases. Archives of
Virology, 142(12), 2401-2419.
[9] Spies, U., Müller, H. and Becht, H. (1987) Properties of
RNA polymerase activity associated with infectious
bursal disease virus and characterization of its reaction
products. Virus Research, 8(2), 127-140.
[10] Von Einem, U.I., Gorbalenya, A.E., Schirrmeier, H.,
Behrens, S.E., Letzel, T. and Mundt, E. (2004) VP1 of
infectious bursal disease virus is an RNA-dependent
RNA polymerase. Journal of General Virology, 85(8),
2221-2229.
[11] Dobos, P. (1993) In vitro guanylylation of infectious
pancreatic necrosis virus polypeptide VP1. Virology,
193(1), 403-413.
[12] Spies, U. and Müller, H. (1990) Demonstration of enzy-
me activities requiredfor cap structure formation in infec-
tious bursal disease virus, a member of the birnavirus
group. Journal of General Virology, 71(Pt4), 977-981.
[13] Brown, M.D., Green, P. and Skinner, M.A. (1994) VP2
sequences of recent European ‘very virulent’ isolates of
infectious bursal disease virus are closely related to each
other but are distinct from those of ‘classical’ strains.
Journal of General Virology, 75(Pt3), 675-680.
[14] Fahey, K.J., Erny, K. and Crooks, J. (1989) A con-
formational immunogen on VP2 of infectious bursal
disease virus that induces virus-neutralizing antibodies
that passively protect chickens. Journal of General Viro-
logy, 70(Pt6), 1473-1481.
[15] Letzel, T., Coulibaly, F., Rey, F.A., Delmas, B., Jagt,
E.W., van Loon, A.A.M. and Mundt, E. (2007) Mole-
cular and structural bases for the antigenicity of VP2 of
infectious bursal disease virus. Journal of Virology,
81(23), 12827-12835.
[16] Yamaguchi, T., Ogawa, M., Inoshima, Y., Miyoshi, M.,
Fukushi, H. and Hirai, K. (1996) Identification of
sequence changes responsible for the attenuation of
highly virulent infectious bursal disease virus. Virology,
223(1), 219-223.
[17] Mundt, E. (1999) Tissue culture infectivity of different
strains of infectious bursal disease virus is determined by
distinct amino acids in VP2. Journal of General Virology,
R. M. Li et al. / Natural Science 2 (2010) 718-725
Copyright © 2010 SciRes. OPEN ACCESS
725
725
80(8), 2067-2076.
[18] Jackwood, D.J., Sreedevi, B., Lefever, L.J. and Sommer-
Wagner, S.E. (2008) Studies on naturally occurring
infectious bursal disease viruses suggest that a single
amino acid substitution at position 253 in VP2 increases
pathogenicity. Virology, 377(1), 110-116.
[19] Brandt, M., Yao, K., Liu, M., Heckert, R.A. and Vak-
haria, V.N. (2001) Molecular determinants of virulence,
cell tropism, and pathogenic phenotype of infectious
bursal disease virus. Journal of Virology, 75(24), 11974-
11982.
[20] Van Loon, A.A.W.M., de Haas, N., Zeyda, I. and Mundt,
E. (2002) Alteration of amino acids in VP2 of very
virulent infectious bursal disease virus results in tissue
culture adaptation and attenuation in chickens. Journal of
General Virology, 83(1), 121-129.
[21] Boot, H.J., ter Huurne, A.A., Hoekman, A.J., Peeters, B.P.
and Gielkens, A.L. (2000) Rescue of very virulent and
mosaic infectious bursal disease virus from cloned cDNA:
VP2 is not the sole determinant of the very virulent
phenotype. Journal of Virology, 74(15), 6701-6711.
[22] Boot, H.J., ter Huurne, A.A., Hoekman, A.J., Pol, J.M,
Gielkens, A.L. and Peeters, B.P. (2002) Exchange of the
C-terminal part of VP3 from very virulent infectious
bursal disease virus results in an attenuated virus with a
unique antigenic structure. Journal of Virology, 76(20),
10346-10355.
[23] Yamaguchi, T., Kondo, T., Inoshima, Y., Ogawa, M.,
Miyoshi, M., Yanai, T., Masegi, T., Fukushi, H. and
Hirai, K. (1996) In vitro attenuation of highly virulent
infectious bursal disease virus: Some characteristics of
attenuated strains. Avian Diseases, 40(3), 501-509.
[24] Mundt, E. and Vakharia, V.N. (1996) Synthetic trans-
cripts of double-stranded Birnavirus genome are infec-
tious. Proceedings of National Academy of Sciences of
USA, 93(11-12), 11131-11136.
[25] Nunoya, T., Tajima, M. and Itakura, C. (1991) Primary
culture of chicken bursal plical epithelium. Research in
Veterinary Science, 50(3), 352-354.
[26] Eterradossi, N., Toquin, D., Rivallan, G. and Guittet, M.
(1997) Modified activity of a VP2-located neutralizing
epitope on various vaccine, pathogenic and hypervirulent
strains of infectious bursal disease virus. Archives of
Virology, 142(2), 255-270.
[27] Synder, D.B., Lana, D.P., Cho, B.R. and Marquardt,
W.W. (1988) Group and strain-specific neutralization
sites of infectious bursal disease virus defined with mo-
noclonal antibodies. Avian Diseases, 32(5), 527-534.
[28] Hierholzer, J.C. and Killington, R.A. (1996) Suspension
assay method. Virology Methods Manual, Academic, San
Diego, 39-40.
[29] Schröder, A., van Loon, A.A.W.M., Goovaerts, D. and
Mundt, E. (2000) Chimeras in noncoding regions
between serotypes I and II of segment A of infectious
bursal disease virus are viable and show pathogenic
phenotype in chickens. Journal of General Virology,
81(23), 533-540.