American Journal of Plant Sciences, 2012, 3, 1225-1231
http://dx.doi.org/10.4236/ajps.2012.39148 Published Online September 2012 (http://www.SciRP.org/journal/ajps) 1225
Genetic Transformation Studies on Avocado Cultivar
“Hass” (Persea americana)
Muhammad F. Ahmed1, Arumugam S. Kantharajah2*, Paul Holford1
1University of Western Sydney, South Penrith DC, Australia; 2Department of Agricultural Sciences, American University of Beirut,
Beirut, Lebanon.
Received March 16th, 2012; revised April 10th, 2012; accepted April 26th, 2012
ABSTRACT
The use of traditional breeding for improvement of avocado cultivars is time consuming, hence other methods such as
genetic transformation by Agrobacterium is indispensable to adop t. The str ain GV3850 /pBI12 1gav e best tran sfor mation
outcome compared to five other binary vectors (AGL1/pCGP904; AGL1/pBI121; GV3850/pCGP904; LBA4404/pCG-
P904 and LBA4404/pBI121) under different pH and acetosyringone concentrations. The optimal condition for reliable
transformation was by using 200 µM acetosyringone and a pH of 5.2. Transformed embryonic shoots co-cultivated with
GV3850/pBI121 were tested using th e histochemical x-gluc assay. Fur ther analysis was conducted by polymerase ch ain
reaction using specific primers for the rep orter gene (GUS).
Keywords: Avocado; Persea; Binary Vectors; GUS Reporter
1. Introduction
The avocado is a major horticu ltural crop in tropical parts
of the world. Although avocado has a high economic and
nutritional importance, there are genetic problems asso-
ciated with its production. The successful incorporation
of transfer-DNA (T-DNA) from wild-type strains of
Agrobacterium tumefaciens to avocado tissues has been
observed. However the wild-type Ti-plasmids are not
suitable as gene vectors as they produce disorganized
growth of recipient plant cells owing to the effects of the
oncogenes in the T-DNA. Consequently, such tumour
cells have proven recalcitrant to attempts to induce re-
generation into plantlets or normal tissues. In order to
regenerate plants effectively, the T-DNA has to be dis-
armed. This is achieved by deleting all of its oncogenic
hormone biosynthesis genes without interfering with its
ability to integrate into p lant chromosomes [1,2].
There are two types of disarmed tumor-inducing (Ti)
plasmid vectors currently in use; these are co-integrative
and binary vectors. The T-DNA and vir functions are
maintained within the same Ti plasmid in co-integrative
vectors. In contrast, binary vectors have the vir and T-
DNA regions on separate replicons. In this latter system,
the T-DNA borders are located on a replicon that will
function in both E. coli and Agrobacterium, a feature that
greatly facilitates construct formation. Although the vir
and T-DNA regions are in trans, the inserted DNA be-
tween the T-DNA borders is efficiently transferred to the
plant’s genome [3].
pGV3850 is an example of a co-integrative vector [4].
Zambryski et al. [4] created a deletio n mutant of pTiC58
where mo st o f the DNA be tween th e righ t and lef t border
sequences of the T-DNA had been lost, including the
genes for hormone production. The nopaline synthase
gene remained and acts as a T-DNA specific marker. In
addition, the cloning vector, pBR322, was inserted in the
T-DNA region. The pBR322 sequence can act as an ac-
ceptor site for the insertion of genes to be transferred to
the plant through a single recombination even t with plas-
mids containing homologous sequences. Using this vec-
tor, Zambryski et al. [4] were able to transform plant
tissues and regenerate fertile adult p lants. Hoekema et al.
[5] developed the binary vector strategy by creating the
plasmid pAL1050. pAL1050 is a derivative of pTiAch5
that can replicate in both E. coli and A. tumefaciens and
contains the T-DNA region. This plasmid was introduced
into the cell line, LBA44 04, which harbours the plasmid,
pAL4404. This latter plasmid was isolated as a sponta-
neous deletion mutant of an octopine-type Ti plasmid
that had lost its entire T-DNA but retained a complete
comple ment of vir functions [6]. The combination of the
two plasmids induced tumour formation on tomatoes,
Kalanchoë, tobacco and peas despite the fact that the
T-DNA and vir regions were on separate plasmids [5].
Since this time, several disarmed binary vector systems
have been produced.
*Corresponding author.
Copyright © 2012 SciRes. AJPS
Genetic Transformation Studies on Avocado Cultivar “Hass” (Persea americana)
1226
Genetic transformation in a co-integrative system of
avocado using Agrobacterium strain 9749 ASE2 with
pMON9749 has been reported [7]. This study trans-
formed embryonic cultures of ‘Thomas’ cultivar, but has
failed to generate mature plantlets. There has been sub-
stantial gap between the uses of different methodology
for potential genetic transformation systems for avocado s
were evident from the previous researches. It is also
more or less clear that there has not consequently been
enough research in Agrobacterium mediated transforma-
tion of avocado. Investigations were made to find: 1)
which disarmed strains of Agrobacterium is most viru-
lent on avocado cultivar “Hass”; and 2) what culture
conditions give maximum transformation. Therefore, the
main purposes of this study were to d etermine the condi-
tions for successful transformation using disarmed vec-
tors containing the
-glucuroni dase (GUS) reporter gene.
2. Materials and Methods
2.1. Triparental Mating
Cultures of donor (E. coli strains containing pBI121 or
pCGP904), recipient (A. tumefaciens strains AGL1, GV-
3850 and LBA4404), and helper (E. coli containing
pRK2013) strains were grown overnight at 28˚C in 10
mL of lysogeny broth (LB) containing the appropriate
level of the relevant antibio tic. On the following day, the
bacterial strains were streaked each onto LB agar con-
taining kanamycin or rifampicin to test their antibiotic
sensitivities: cell lines showing the appropriate antibiotic
sensitivities were incub ated again overnight at 28˚C. The
overnight cultures were transferred to sterile 10mL cen-
trifuge tubes and the bacteria pelleted at 8000 rpm for 5
minutes, then resuspended in 5 mL of fresh LB. The
bacteria were then repelleted and resuspended as above.
1.0mL aliquots of the donor strains were placed in 2.0mL
Eppendorf tubes and centrifuged for 5 minutes at 8000
rpm to pellet the bacteria after which the supernatants
were removed. Next, 1.0 mL of the recipient strains was
added to the suspended donor strains, which were then
centrifuged for 5 minutes at 8000 rpm to pellet the bacte-
ria and the supernatants again removed. Finally, 0.5 mL
of the helper strain was added to each tube, the bacterial
mixtures were then vortexed for 1 minute after which the
bacteria were pelleted and then resuspended. The slurry
was transferred to LB agar plates, which were incubated
for 48 hours at 28˚C for triparental matings to take place.
After incubation, a scrape from each triparental mating
was taken and added to a 2 mL Eppendorf tube contain-
ing 200 L of sterilized distilled water. The bacteria were
resuspended by vortexing and the suspension used to
make lawn culture on LB agar containing the appropriate
antibiotics to select the desired transconjugant. The
plates were incubated at 28˚C and after 2 - 4 days bacte-
rial colonies appeared. This process created the following
combinations of bacterial strains and binary vector: AG-
L1/pCGP904; AGL1/pBI121; GV3850/pCGP904; GV-
3850/pBI121; LB A4404/pC GP904 and LB A4404/ pBI12 1.
2.2. Parameter Optimization for Maximum
Transformation
The binary vectors produced earlier were subjected to
different pH levels and concentration of acetosyringone
(AS). The strain of bacterium that gave maximum trans-
formation of avocado tissues was recorded. The different
disarmed strains of A. tumefaciens created in previous
section were grown overnight in LB medium containing
the appropriate antibiotics. Ten-fold dilutions of the cul-
tures were made in sterile distilled water. Embryonic
shoot axes of cultivar (cv.) “Hass” were cut transversely
into sections of approximately 10 mm diameter, im-
mersed in the diluted bacterial cultures for one minute
and then blotted dry to remove excessive moisture. The
shoot axes were placed on co-cultivation medium (Mu-
rashige and Skooge (MS) [8] salts, 30 g·L–1 sucrose, 1.0
mg·L–1 6-benzyl amino purine (BAP), 0.1 mg·L–1 IBA,
500 mg·L–1 PVP, and 0.7% Bacto-agar) with the differ-
ent concentrations of AS and pH levels (Table 1).
Five embryonic shoot axes were placed in each Petri
dish. The plates were held at 24˚C ± 1˚C for 48 hours to
allow DNA transfer to occur. After two days, the embr-
yonic shoot tissues were transferred to regeneration me-
dium (4.4 g·L–1 modified MS salts supplemented with 30
g·L–1 sucrose, 1.0 mg·L–1 BAP, 0.1 mg·L–1 IBA, 10-4 M
putrescine, 500 mg·L–1 cefotaxime, 0.7% Bacto-agar at
pH 5.7). One week later, the explants were transferred
from regeneration medium to the selection medium (2.3
g·L–1 woody plant medium (WPM) salts, 30 g·L–1 su-
crose, 0.1 mg·L–1 BAP, 1.0 mg·L–1 IBA, 10–4 M putre-
scine, 500 mg·L–1 cefotaxime, 60 mg·L–1 kanamycin,
0.7% Bacto-agar at pH 5.7). The majority of explants
Table 1. Co-cultivation media with different concentrations
of pH and acetosyringone.
Treatment pH Acetosyringone
i 5.2 -
ii 5.2 200 M
iii 5.2 400 M
iv 5.7 -
v 5.7 200 M
vi 5.7 400 M
vii 6.2 -
viii 6.2 200 M
ix 6.2 400 M
Control 5.7 -
Copyright © 2012 SciRes. AJPS
Genetic Transformation Studies on Avocado Cultivar “Hass” (Persea americana)
Copyright © 2012 SciRes. AJPS
1227
were examined after one week (two weeks after co-culti-
vation) for activity of the GUS reporter gene [9]. In addi-
tion, a few shoot bases were examined 2 and 7 days after
co-cultivation. Transformation rates were estimated by
visual assessment using the scoring system in Table 2.
2.3. Transformation with Agrobacterium strain
GV3850/pBI121
GV3850/pBI121 was grown to an OD580 of 0.7 - 1.0 at
27˚C 1˚C in LB containing 50 mg·L–1 rifampicin and
25 mg·L–1 kanamycin. A ten-fold dilution of the over-
night culture of the strain was made in sterile distilled
water. 10 mm sections of embryonic shoot axes were im-
mersed in the diluted bacterial culture for minute and
blotted dry. The embryonic shoot axes were placed on
co-cultivation medium with five sections per Petri dish.
The plates were held at 24˚C ± 1˚C for 48 hours to allow
DNA transfer to occur. After two days, the embryonic
shoot tissues were transferred to regeneration medium
containing 60 mg·L–1 kanamycin. One week later, the
explants were further transferred to the selection medium
in which kanamycin was omitted for four weeks. All
putative transformed explants were again analysed for
GUS reporter gene expression. Six shoots were taken for
analysis by PCR to determine the present or absence of
the GUS and virD genes within their genomes.
2.4. Histochemical Assay of GUS Activity
5.22 mg of X-gluc was dissolved into 1 - 2 drops of N,
N-dimethylformamide and the solution made up to 10 mL
using 0.2 M phosphate buffer (pH 7.0). Putative trans-
formed explants were placed in Eppendorf tubes, covered
with X-gluc solu tion for 24 hours at 20 ˚C for the staining
reaction to occur.
2.5. DNA Extraction from Plant Tissue
80 - 100 mg tissue was taken from regenerating shoots
(resulting from section 1.3) 6 - 8 weeks after co-cultivation
and grounded using a pestle and mortar (previously kept
in hot water bath at 65˚C) with 750 L of Extraction
Buffer II (also preheated). Each individual sample was
poured into a 2 mL Eppendorf tube containing 300 L
chloroform and the mortars washed with 750 L of Ex-
traction Buffer II which was also placed in the Eppendorf
tubes. The Eppendorf tubes were inverted several times,
incubated at 65˚C for 30 minutes then microcentrifuged
at 13,000 rpm for 5 minutes. The supernatants were
transferred to 2 mL Eppendorf tubes containing 600 L
of cold isoprop anol, inverted slowly several times until a
precipitate formed, centrifuged at 13,000 rpm for 5 min-
utes and the supernatant removed. Each pellet was then
washed twice with 500 L of 70% ethanol and once with
500 L of 100% ethanol after which the tubes were in-
verted to drain off the alcohol. The DNA samples were
then vacuum dried for 15 minutes and stored at 4˚C.
2.6. DNA Extraction from Bacteria
Cultures of GV3850/pBI121 (5 mL) were grown over-
night. 1.5 mL of the culture was placed in a 2.0 mL Ep-
pendorf tubes and microcentifuged for 2 minutes. The
bacterial pellets were resuspended in 567 L TE buffer
by repeated pipetting following which 30 L of 10%
SDS and 3 L of 20 mg·mL–1 proteinase K were added,
mixed and the sample incubated for 1 h at 37˚C. After
incubation, 100 L of 5 M NaCl and 80 L CTAB/NaCl
solution were added, mixed and the tubes then incubated
for 10 minutes at 65˚C. To remove contaminating poly-
saccharides and other macromolecules, an equal volume
(870 L) of chloroform/isoamyl alcohol (24:1) was
added, the tubes shaken, then centrifuged for 5 minutes
and the aqueous phase transferred to a fresh tube. An
equal volume of phenol/chloroform/isoamyl alcohol
(25:24:1) was added to the aqueous phase and the con-
tents were thoroughly mixed. The tubes were then centri-
fuged and the aqueous phase transferred to a fresh 2 mL
Eppendorf tube. A 0.6 ml of isopropanol was then added,
mixed gently and the precipitated DNA collected by mi-
crocentrifugation at 13,000 rpm for 2 minutes. The su-
pernatant was then removed and the DNA pellets washed
twice with 500 L of 70% ethanol and once w ith 500 L
of 100% ethanol. The bacterial DNA samples were vac-
uum dried for 15 minutes and stored at 4˚C.
2.7. PCR Analysis
A multiplex PCR assay was conducted for detection of
the GUS and vir D1 genes using specific primers (Table
3). The reaction mixture for PCR consisted of the fol-
lowing reagents: 2.5 mM MgCl2, 1 X manufacturer’s Taq
buffer, 1U Taq polymerase, 200 M dNTPs, 1 M of
each primer, 50 ng target DNA, and dH2O to make a total
Table 2. Primers sequence for amplification of vir and gus genes.
Gene Primer Sequence Amplicon size (bp) Reference
Vir-D1-1 5’ ATGTCGCAAGGCAGTAAGCCCA 3’
Vir-D1-2 5’ GGAGTCTTTCAGCATGGAGCAA 3’ 437 [10]
GUS_GI 5’ GGTGGGAAAGCGCGTTACAAG 3’
GUS_GII 5’ GTTTACGCGTTGCTTCCGCCA 3’ 1199 [9]
Genetic Transformation Studies on Avocado Cultivar “Hass” (Persea americana)
1228
Table 3. Extent of transformation of avocado tissues (cv. “Hass”) two weeks after co-cultivation with six combinations of cell
line and binary vector after co-cultivation on media containing different concentrations of acetosyringone and at different pH
levels. (Scoring system: - = no blue cells present; + = a few blue cells present; ++ = small areas of blue tissue present; +++ =
large areas of blue tissue present).
Treatments AGL1
/pBI121 AGL1
/pCGP904 GV3850
/pBI121 GV3850
/pCGP904 LBA4404
/pBI121 LBA4404
/pCGP904
pH 5.2,
no acetosyringone - - + + + +
pH 5.2, 200 M
acetosyringone + + +++ ++ + ++
pH 5.2, 400 M
acetosyringone + + + + + +
pH 5.7,
no acetosyringone - - + - - -
pH 5.7 200 M
acetosyringone + + ++ + + +
pH 5.7, 400 M
acetosyringone + + + + + +
pH 6.2,
no acetosyringone - - + + - -
pH 6.2, 200 M
acetosyringone + + ++ + + +
pH 6.2, 400 M
acetosyringone + + + + + +
Control, non-tra ns formed
tissue - - - - - -
of 25.0 L.
To six tubes, DNA from different putative transformed
avocado plants was added. To another tube, DNA from a
non-transformed plant was added, to another 50 ng of
bacterial DNA and to the final tube, sterilized distilled
water was added. The samples were vortexed, the tubes
centrifuged for 10 seconds then the contents were over-
layered with 40 L of mineral oil. Cycling parameters for
amplification were an initial cycle of denaturation at
93˚C for 5 mins, followed by 40 cycles at 93˚C for 30 s,
annealing at 60˚C for 1 min, extension at 72˚C for 2 min.
PCR products of each reaction mixture were added to
gel loading buffer and loaded onto a 1% agarose gel. The
fragments were subjected to electrophoresis at 90 volts
per centimetre for 60 minutes in 1× TBE buffer. The gel
was stained with ethidium bromide and visualised using
a transilluminator with a wavelength of 320 nm.
3. Results and Discussion
In this study, six strains of Agrobacterium tumefaciens,
namely AGL1/pBI121; AGL1/pCGP904; GV3850/pBI1-
21; GV3850/pCGP904; LBA4404/pBI121 and LBA-
4404/pCGP904 were studied for genetic transformation
of avocado. Expressions of the GUS reporter gene in
embryonic shoot axes were assessed by staining with
X-gluc. The histochemical assay revealed GUS activity
in most of the explants treated with disarmed strains of A.
tumefaciens. Among the three different cell lines, trans-
formation with the disarmed binary vector GV3850 was
found most effective (Figure 1 and Table 3). Transfor-
mation rates usin g LBA4404 and AGL1 were lower than
GV3850 and there appears to be no differences between
LBA4404 and AGL1 in their ability to cause transfo rma-
tion. 200 M acetosyringone increased transformation
rates; however, transformation rates were reduced when
the level of acetosyringone was increased to 400 M.
Among the media with different pH levels, a pH of 5.2
allowed more transformation than pH 5.7 and 6.2. The
construct, pBI121 produced more blue cells than pCGP-
904. The control (non-infected tissue) did not show any
GUS activity. GUS activity was first observed aroun d the
cut edges of the tissues after two days after co-cultiv ation.
The amount of GUS positive cells and sectors decreased
with time.
The presence of the GUS gene in explants expressing
GUS activity was confirmed by PCR (Figure 2). Lane 9
shows the two PCR products, amplified from bacterial
DNA, that correspond to the GUS gene (fragment size
1199bp) and the virD1 gene (fragment size 437 bp).
Lanes 3 and 8 contained PCR products from putative
transformed avocado plants and in these lanes only the
fragment corresponding to the GUS gene is present. Ex-
tracts from the remainder of the putative transformants
(lanes 4 - 7) and the non-transformed control (lane 2)
failed to produce DNA amplification products.
Studies of co-cultivation conditions with disarmed
Copyright © 2012 SciRes. AJPS
Genetic Transformation Studies on Avocado Cultivar “Hass” (Persea americana) 1229
Figure 1. Histochemical analysis of GUS gene expression in
transgenic avocado tissues transformed using the disarmed
Agrobacterium tumefaciens strain, GV3850/pBI121.
1 2 3 4 5 6 7 8 9 10 11
1199 bp GUS
437 bp virD
Figure 2. Separation of PCR products following PCR am-
plification using primers designed from the virD and GUS
genes. Lanes 1 and 11 contain 100 base pair ladder; lane 10
contains the water control (no template DNA); lane 9 con-
tains PCR products from bacterial DNA; lanes 3 to 8 con-
tains PCR products from putative transformed avocado
plants and lane 2 contains the PCR produc ts from the nega-
tive control (template DNA from a non-transformed avo-
cado plant). The expected PCR products of the virD and
GUS genes are fragments with a length of 437 and 1199bp,
respectively.
strains of Agrobacterium have confirmed the results ob-
tained with wild-type strains in this study. Maximum
transformation rates were again obtained when the me-
dium contained 200 M acetosyringone and had a pH of
5.2. Surprisingly, increasing the concentration of aceto-
syringone to 400 M reduced transformation levels. The
reason for this is not clear but may be related to toxic
effects of acetosyringone on plant tissues. Acetosyrin-
gone at a concentration of 200 M prevented the germi-
nation of seeds of Antirrhinum majus (Holford, pers
comm.) and the 400 M level used in this study may be
affecting the growth or development of certain avocado
cells.
In this study, different host cell lines of Agrobacterium
were used; AGL1, GV3850, and LBA4404, and induced
different levels of transformation. Specifically, GV3850
was found to be the most effective in producing the
transgenic tissues. Other studies have found differences
in the virulence of different strains of Agrobacterium.
For example, Berres et al. [11] also found transfor mation
with LBA4404/pAL4404/pBI121.2 was inefficient on
grapevines. Lulsdorf et al. [12] used the binary vector,
pBI1042, for experiments on the transformation of pea.
This vector was placed in three different strains (EHA-
101, LBA4404 and WR3095). The use of EHA101 sig-
nificantly increased the number of transformation events
and these authors suggested that this must be due to fac-
tors associated with the bacterial chromosome.
Ranges of chromosomal genes are involved in the in-
teraction between Agrobacterium and its host. The att
locus contains the genes required for successful bacterial
attachment to plant cells [13] and has been extensively
studied [14]. Genes located on one part of the locus are
thought to be responsible for the synthesis of fundamen-
tal binding components. Other genes are involved in mo-
lecular signaling events and show homology to genes
involved in periplasmic binding protein dependent trans-
port systems [15,16]. The ABC transporter encoding
genes of the att region may be involved in the secretion
of substances or in the introduction into bacteria of some
plant-originated activators of the synthesis of compounds
specific for attachment [17]. Differences in the expres-
sion of these types of genes between different strains of
Agrobacterium are capable of explaining differences in
virulence seen in this study.
More blue cells were visible when the explants were
treated with pBI121 than the pCGP904. The latter plas-
mid contains the GUS cassette (mas35S: GUS: ocs3’)
from pKIWI101 inserted into pBIN19 [18]. The GUS
gene in pCGP904 contains a hybrid promoter incorpo-
rating elements from both CaMV 35S and Ti plasmid
mannopine synthetase (MAS) [19]. This promoter, called
Mac, expressed GUS at a level 3 to 5 times that ex-
pressed by a double 35S promoter in the leaves, and 10
to 15 times that in hypocotyls and roots. The Mac pro-
moter, however, showed only marginal wound inducibi-
lity. The difference between levels of GUS activity seen
between avocado tissues transformed pBI121 or pCGP-
904 may be due differences in the induction of the GUS
gene due to stresses induced by co-cultivation, the tissue
culture environment or the staining process.
Decreased of GUS positive sectors were observed in
transformed avocado tissues overtime. This phenomenon
has been observed in other studies. For example, Or-
likowska et al. [20] showed that the number of trans-
formed sectors, visible in safflower treated with either
pBI121 or EHA105 two weeks after co-cultivation, de-
creased between half to one third of the levels seen after
three days. These authors explained the decline as being
due to a reduction of transient expression over time.
In this study, DNA from two out of the six avocado
explants acted as a template for the amplification of a
band with the expected size of the GUS gene. The use of
PCR to detect sequences in transformed plants has been
Copyright © 2012 SciRes. AJPS
Genetic Transformation Studies on Avocado Cultivar “Hass” (Persea americana)
1230
questioned because of the possibility that cells or DNA
from Agrobacterium may remain on the surface of plant
tissues long after co-cultivation has occurred. To ensure
that only DNA incorporated into the plants’ genomes
was the template for amplification, PCR was also at-
tempted using primers designed from the virD1 gene. As
the virD1 gene is in the virulence region of the Ti plas-
mid and is outside of the T-DNA borders it cannot be
transferred to the plant. The presence of a virD1 and
GUS bands in PCR amplifications using extracts from
plant tissues would indicate the presence of contamina-
tion by Agrobacterium or its DNA: the presence of only
the GUS band indicates stable transformation. This sys-
tem has been used to demonstrate transformation of An-
tirrhinum majus [21]. None of the amplifications using
extracts from putative transgenic plants produced DNA
fragments of the expected size of the virD1 sequence.
Therefore, the amplification of the GUS gene must have
been its stable incorporation in the plan ts. Both the virD1
and GUS genes were readily amplified from bacterial
extracts. Moreover , this study has shown that Agrobacte-
rium strain, GV3850, is the most suitable and an efficient
vector for the transformation study of avocado. Further
research is required using the latter strain to assess its
efficiency and reliability of gene transfer for biotic and
abiotic stresses.
REFERENCES
[1] R. B. Horsch, J. Fry, N. Hoffmann, J. Neidermeyer, S. G.
Rogers and R. T. Fraley, “Leaf Disc Transformation,” In:
S. B. Gelvin, R. A. Schilperoort and D. P. Verma, Eds.,
Plant Molecular Biology Manual, Kluwer Academic Pub-
lisher, Belgium, 1988, pp. 1-9.
[2] H. Klee and S. Rogers, “Plant Gene Vectors and Genetic
Transformation: Plant Transformation System Based on
the Use of Agrobacterium tumefaciens,” In: J. Schell and
I. K. Vasil, Eds., Cell Culture and Somatic Cell Genetics
of Plants, Vol. 6: Molecular Biology of Plant Nuclear
Genes, Academic Press, London, 1989, pp. 1-23.
[3] G. An, P. R. Ebert, A. Mitra and S. Ha, “Binary Vectors,”
In: S. B. Gelvin, R. A. Schilperoort and D. P. Verma,
Eds., Plant Molecular Biology Manual, Kluwer Aca-
demic Publisher, Belgium, 1988, pp. 1-19.
[4] P. Zambry ski, H. Joos, C. Genetello, J. Leemans, M. Van
Montagu and J. Schell, “Ti-Plasmid Vector for the Intro-
duction of DNA into Plant Cells without Alteration of
Their Normal Regeneration Capacity,” EMBO Journal,
Vol. 12, No. 2, 1983, pp. 2143-2150.
[5] A. Hoekema, P. R. Hirsch, P. J. J. Hookaas, and R. A.
Schilperoot, “A Binary Plant Vector Strategy Based on
Separation of vir- and T-Region of the Agrobacterium tu-
mefaciens Ti Plasmid,” Nature, Vol. 303, 1983, pp. 179-
180. doi:10.1038/303179a0
[6] G. Ooms, P. Hooykaas, G. Moolenaar, and R. Schilpero-
ort, “Crown Gall Tumors of Abnormal Morphology In-
duced by Agrobacterium tumefaciens Carrying Mutated
Octopine Ti Plasmids; Analysis of T-DNA Functions,”
Gene, Vol. 14, No. 1-2, 1981, pp. 33-50.
doi:10.1016/0378-1119(81)90146-3
[7] A. Cruz-Hernández, Witjaksono, R. E. Litz and M. Go-
mez Lim, “Agrobacterium tumefaciens—Mediated Trans-
formation of Embryogenic Avocado Cultures and Regen-
eration of Somatic Embryos,” Plant Cell Reports, Vol. 17,
No. 6-7, 1998, pp. 497-503.
doi:10.1007/s002990050431
[8] T. Murashige and F. Skoog, “A Revised Medium for
Rapid Growth and Bio Assays with Tobacco Tissue Cul-
tures,” Physiologia Plantarum, Vol. 15, No. 3, 1962, pp.
473-497. doi:10.1111/j.1399-3054.1962.tb08052.x
[9] R. A. Jefferson, T. A. Kavanagh, and M. W. Bevan,
“GUS Fusions: β-Glucuronidase as a Sensitive and Ver-
satile Gene Fusion Marker in Higher Plants,” EMBO
Journal, Vol. 6, No. 13, 1987, pp. 3901-3907.
[10] K. H. Lipp Joao and T. A. Brown, “Enhanced Transfor-
mation of Tomato Co-Cultivated with Agrobacterium tu-
mefaciens C58CIRif::pGSFR1161 in the Presence of
Acetosyringone,” Plant Cell Reports, Vol. 12, No. 7-8,
1993, pp. 422-425. doi:10.1007/BF00234705
[11] R. Berres, L. Otten, B. Tinland, E. Clog and B. Walter,
“Transformation of Vitis Tissue by Different Strains of
Agrobacterium tumefaciens Containing the T-6b Gene,”
Plant Cell Reports, Vol. 11, No. 4, 1992, pp. 192-195.
doi:10.1007/BF00232531
[12] M. M. Lulsdorf, H. Rempel, J. A. Jackson, D. S. Baliski
and S. L. A. Hobbs, “Optimizing the Production of Trans-
formed Pea (Pisum sativum L.) Callus Using Disarmed
Agrobacterium tumefaciens Strains,” Plant Cell Reports,
Vol. 9, No. 9, 1991, pp. 479-483.
doi:10.1007/BF00232100
[13] G. A. De la Riva, G. C. Joel, R. Vázquez-Padrón and C.
Ayra-Pardo, “Agrobacterium tumefaciens: A Natural Tool
for Plant Transformation,” Electronic Journal of Bio-
technology, Vol. 1 No. 3, 1998.
doi:10.2225/vol1-issue3-fulltext-1
[14] L. R. Bradley, J. S. Kim and A. G. Matthysse, “Attach-
ment of Agrobacterium tumefaciens to Carrot Cells and
Arabidopsis Wound Sites Is Correlated with the Presence
of a Cell-Associated, Acidic Polysaccharide,” Journal of
Bacteriology, Vol. 179, No. 17, 1997, pp. 5372-5379.
[15] G. F. L. Ames, C. S. Mimura and V. Shyamala, “Bacte-
rial Periplasmic Permeases Belong to a Family of Trans-
port Proteins Operating from Escherichia coli to Human:
Traffic ATPases,” FEMs Microbiological Review, Vol.
75, No. 4, 1990, pp. 429-446.
doi:10.1016/0378-1097(90)90691-I
[16] C. F. Higgings, S. C. Hyde, M. M. Mimmack, U. Gileadi,
D. R. Gill and M. P. Gallagher, “Binding Protein-De-
pendent Transport Systems,” Journal of Bioenergy and
Biomembranes, Vol. 22, 1990, pp. 571-592.
doi:10.1007/BF00762962
[17] A. G. Matthysse, H. A. Yarnall and N. Young, “Re-
quirement for Genes with Homology to ABC Transport
System for Attachment and Virulence of Agrobacterium
tumefaciens,” Journal of Bacteriology, Vol. 178, 1996, pp.
5302-5308.
Copyright © 2012 SciRes. AJPS
Genetic Transformation Studies on Avocado Cultivar “Hass” (Persea americana)
Copyright © 2012 SciRes. AJPS
1231
[18] M. Bevan, “Binary Agrobacterium Vectors for Plant
Transformation,” Nucleic Acids Research, Vol. 12, No.
22, 1984, pp. 8711-8721. doi:10.1093/nar/12.22.8711
[19] L. Comai, P. Moran and D. Maslyar, “Novel and Useful
Properties of a Chimeric Plant Promoter Combining
CaMV 35S and MAS Elements,” Plant Molecular Biol-
ogy, Vol. 15, No. 3, 1990, pp. 373-381.
doi:10.1007/BF00019155
[20] T. K. Orlikowska, H. J. Cranston and W. E. Dyer, “Fac-
tors Influencing Agrobacterium tumefaciens—Mediated
Transformation and Regeneration of the Safflower Culti-
var ‘Centennial’,” Plant Cell, Tissue and Organ Culture,
Vol. 40, 1995, pp. 85-91. doi:10.1007/BF00041122
[21] I. Senior, P. Holford, R. N. Cooley and H. J. Newbury,
“Transformation of Antirrhinum majus Using Agrobacte-
rium rhizogenese,” Journal of Experimental Botany, Vol.
46, No. 9, 1995, pp. 1233-1239.
doi:10.1093/jxb/46.9.1233