A Single Mutation in the Hepta-Peptide Active Site of <i>Aspergillus niger</i> PhyA Phytase Leads to Myriad Biochemical Changes

doi:10.4236/aim.2012.23049

Paper Menu >>

Journal Menu >>

Advances in Microbiology, 2012, 2, 388-394

http://dx.doi.org/10.4236/aim.2012.23049 Published Online September 2012 (http://www.SciRP.org/journal/aim)

A Single Mutation in the Hepta-Peptide Active Site of

Aspergillus niger PhyA Phytase Leads to Myriad

Biochemical Changes

Abul H. J. Ullah*, Kandan Sethumadhavan, Stephanie Boone, Edward J. Mullaney

Southern Regional Research Center, Agricultural Research Service, United States Department of Agriculture, New Orleans, USA

Email: *[email protected]

Received July 6, 2012; revised August 5, 2012; accepted August 13, 2012

ABSTRACT

The active site motif of proteins belonging to “Histidine Acid Phosphatase” (HAP) contains a hepta-peptide region,

RHGXRXP. A close comparison among fungal and yeast HAPs revealed the fourth residue of the hepta-peptide to be E

instead of A, which is the case with A. niger PhyA phytase. However, another phytase, PhyB, from the same microor-

ganism has a higher turnover number and it shows E in this position. We mutated A69 residue to E in the fungal PhyA

phytase. The mutant phytase shows a myriad of new kinetic properties. The pH profile shifted 0.5 pH unit in both 5.0

and 2.5 bi-hump peaks. The optimum temperature shifted down from 58˚C to 55˚C. However, the greatest difference

was observed in the mutant protein’s reaction to GuCl at a concentration of 0.1 to 0.2 M. The activity of the mutant

phytase jumped 100% while the wild type protein showed no activity enhancement in the same concentration range of

GuCl. The kinetics performed at higher concentration of GuCl also contrasted the difference between the wild type and

mutant phytase. While Km was least affected, the Vmax increased for the mutant and decreased for the wild type. The

sensitivity towards myo-inositol hexasulfate, a potent inhibitor, was decreased by the mutation. All in all, A69E muta-

tion has affected a multitude of enzymatic properties of the protein even though the residue was thought to be

non-critical for phytase’s catalytic function notwithstanding its location in the conserved hepta-peptide region of the

biocatalyst.

Keywords: Phytase; Histidine Acid Phosphatase; Aspergillus niger; Site-Directed Mutagenesis

1. Introduction

Aspergillus niger produces one of the most active phytate

degrading phosphomonoesterase (E.C.3.1.3.8) that hy-

drolyzes myo-inositol hexa-phosphate (phytic acid) at

acidic pH [1,2]. The enzyme was overexpressed by

cloning the phyA gene in the original host in early 1990s,

which led to the commercialization of the enzyme [3].

The recombinant phytase was marketed under the brand

name Natuphos™ to be used as a feed supplement in

plant-derived poultry and swine feed to degrade phytate

that are present in the soybean meal. Phytate is a known

antinutrient that binds minerals; therefore, when present

in high amounts, it robs the animals of divalent cations

[4].

One way to circumvent this problem is to add very

active phytase that could hydrolyze myo-inositol hexa-

phosphates in a stepwise fashion from hexa to penta to

tetra phosphate and so on to yield myo-inositol mono-

phosphate [5].

Of all the phytases reported, two microbial phytases

that had drawn the attention are PhyA phytase from

Aspergillus niger and AppA2 phytase from Escherichia

coli for their high catalytic efficiency [6,7]. Both of these

phytases belong to the ‘Histidine Acid Phosphatase’

(HAP) family of the acid phosphatase, which contains a

conserved hepta-peptide region in the active site with the

sequence RHGXRXP [8,9]. The fourth amino acid in the

hepta-peptide, which is represented by the letter X, is

seen to be extremely variable [8]. Both charged amino

acid such as D and E and amino acids with aliphatic side

chain such as A, V, L, and S could occupy this position.

Of particular interest to us were E, which was the case

with Aspergillus niger PhyB phytase that showed higher

turnover number [10]. In Saccharomyces cerevisiae both

acid phosphatase 3 (ACP3) and acid phosphatase 5

(ACP5), the sequence alignment had revealed E in this

spot. Therefore, we opined that E might have a role in

determining the higher catalytic turnover number in

microbial phosphomonoesterase. With this view, we

decided to mutate a single amino acid, viz., A to E to test

*Corresponding author.

A. H. J. ULLAH ET AL. 389

out our hypothesis that a charged amino acid in this spot

in place of an aliphatic amino acid, A, might induce

chemical change(s) to effect higher catalytic efficiency.

However, the myriad changes affected by this single

mutation in the active site of Aspergillus niger PhyA

phytase were not expected. In this communication, we

report the biochemical characterization engendered by

mutation A69E. Both the optimum pH and optimum

temperature for activity was altered by the single muta-

tion. Also, catalytic activity in the mutant was boosted

100% when GuCl concentration was raised to 0.1 M. We

propose that the mutation has made the active site more

flexible to allow the substrate to enter and the product to

exit facilely. The fact that Km did not change while Vmax

was increased in the mutant is indicative of a new

chemical environment engendered by the side chain of

negatively charged amino acid, glutamic acid, which

replaced alanine, an amino acid with aliphatic side chain.

2. Materials and Methods

2.1. Strains, Growth Media, and Conditions

E. coli DH5α cells were used for plasmid construction

and were cultured at 37˚C in Luria Broth (LB) media.

Pichia pastoris strain X33 was obtained from Invitrogen

(Carlsbad, CA) grown at 30˚C as previously described

[11]. The antibiotic zeocin (Invitrogen, Carlsbad, CA)

was added at 100 μg·ml–1 to yeast extract peptone-dex-

trose (YPD) media for yeast, and at 25 μg·mL–1 to LB for

E. coli. The wild type PhyA gene was cloned and ex-

pressed in Pichia pastoris strain X33 as described earlier

[7].

2.2. DNA Sequencing

To confirm the mutation DNA sequencing was per-

formed with the dye terminator cycle sequencing Quick

Start Kit (Beckman Coulter, Fullerton, CA) using a CEQ

8000 Genetic analysis System (Beckman Coulter).

2.3. Site-Directed Mutagenesis and Recombinant

Protein Expression

A PGAPZα vector containing the phyA gene [12] was

utilized to produce the mutant phytase. The Quick-

Change II Site-Directed Mutagenesis Kit (Stratagene, La

Jolla, CA) used two oligonucleotide primers with the

forward sequence 5’CTCTCCCGTCATGGAGAGCGG-

TATCCGACCGAC3’ and reverse sequence 5’GTC-

GGTCGGATACCGCTCTCCATGACGGGAGAG‘3 to

generate the desired mutation employing thermocycler

cycling parameters of 1 cycle 95˚C (30 sec.), 56˚C (1

min.), and 68˚C (6 min.). P. pastoris X33 was utilized to

express the mutant protein. The PGAPZα vector contain-

ing the phyA gene was linearized by the restriction

enzyme AVRII and transformed in Pichia cells by elec-

troporation using an ECM 630 Electro Cell Manipulator

(Centronics, Inc., BTX Instrument Division, San Diego,

CA). The transformed cells were plated on YPD plus

zeocin and sorbitol, then incubated at 30˚C for 3 days.

Single colony transformants were then transferred into

liquid YPD plates in presence of zeocin and incubated at

30˚C for 3 days and then assayed for phytase activity.

2.4. Purification of Wild Type and A69E Mutant

Phytase

The phytase gene (phyA) fro m Aspergillus niger was

cloned and overproduced in Pichia pastoris [7,13]. The

cultures were centrifuged in a Sorvall SLA-1500 rotor

for 30 min at 13,000 rpm and 4˚C to get the supernatant

for further purification. The recombinant PhyA enzyme

was purified using sequential ion-exchange column chro-

matographies first using MacroPrep™ S column, a cation

exchanger at pH 3.5 and then MacroPrep™ DEAE col-

umn, an anion exchanger, at pH 7.0. The specific activity

of the purified phytase was about 3000 nkat/mg when

assayed at 58˚C and pH 5.0 [14]. PhyA mutant, A69E

was also purified following the same purification

regimen. Briefly, the culture supernatant containing the

expressed enzyme was precipitated using 45% to 90%

ammonium sulfate. The enriched fraction was purified on

MacroPrep™ S (2.5 × 2 cm) at pH 3.5 and MacroPrep™ Q

(1.5 × 2.3 cm) column at pH 7.0. In a final step, 1 mL

UNOsphere™ S column at pH 3.5 was used to obtain the

purified enzyme. The specific activity was about 2400

nkat/mg when assayed at 55˚C and pH 5.5.

2.5. Phytase Assay

Phytase assays were carried out in 1.0 mL volume at

optimum temperatures (55˚C for A69E and 58˚C for

PhyA) in 25 mM Glycine or 25 mM sodium acetate

buffers [2]. The liberated inorganic ortho-phosphate was

quantitated spectrophotometrically by following the

method of Heinonen and Lahti [15] using a freshly

prepared acetone-molybdate-acid (AMA) reagent consi-

sting of 2 parts anhydrous acetone, 1 part 10 mM

ammonium molybdate, and 1 part 2.5 M sulfuric acid.

Adding 2.0 mL of AAM per assay tube terminated the

enzyme assay. After 30 sec, 100 L of citric acid (1.0 M)

was added to each tube to fix the color. Absorbance was

read at 355 nm after blanking the spectrophotometer with

the appropriate control. Phytase activity was expressed as

nkat/mL (nmoles ortho-phosphate released per sec). The

pH used for PhyA and A69E mutant were 5.0 and 5.5,

respectively, during kinetic experiments, unfolding ex-

periments, and myo-inositol hexasulfate inhibition ex-

periments.

A. H. J. ULLAH ET AL.

390

2.6. Phytase Activity at Various pH Range

An aliquot containing the phytases were incubated in a

water bath with the following buffers: 25 mM gly-

cine-HCl (pH 1.0 to 3.5), 50 mM acetate (pH 4.0 to 5.5),

and 50 mM imidazole (pH 6.0 to 8.0), and 50 mM

Tris-maleate (pH 9.0). Phytase activity was measured

after addition of 10 mM phytate as described before.

2.7. Temperature Optima

Similar to the previous experiment, the activity measure-

ments were conducted in a water bath from 22˚C to 70˚C.

2.8. Unfolding in Presence of GuCl

Experiments were conducted in presence of 0 to 1 M

GuCl and phytase activity was measured during unfold-

ing of the phytases. For Km measurements, an aliquot of

the PhyA wild type (WT) and the mutant phytase were

incubated with varying concentrations (0 to 750 µM) of

phytate in presence of 880 mM GuCl for PhyA and 250

mM GuCl for A69E.

2.9. Myo-Inositol Hexasulfate Inhibition

Similarly, phytases were incubated with 0 to 500 µM

myo-inositol hexasulfate, MIHS, and activity measure-

ments were made. For Km determination, PhyA phytase

was carried out in presence and absence of 30 µM MIHS

and 0 to 1000 µM phytate concentration. With A69E

mutant phytase, experiments were performed with 300

µM MIHS. The Ki for MIHS was calculated for both the

phytases.

2.10. Stability of Phytase at 4˚C

The pH of the culture supernatants after collection were

adjusted to 2.5, 3.5, 5.2, 7.2 and 8.5 with 2 N sodium

hydroxide or 4N hydrochloric acid in 10 mL glass tubes

with cap. The volume after adjusting the pH was held at

5.0 mL in all tubes. The tubes were kept at 4˚C for up to

20 days. Phytase activity was measured at 0, 2, 7, 12, and

20 days. The activity observed before adjusting pH of the

supernatant was taken as 100 per cent.

3. Results

3.1. Effect of A69E Mutation on pH Optima

The pH versus activity profile for both the WT and A69E

mutant phytase are shown in Figure 1.

The usual bi-hump curve for pH profile, which is so

characteristics for fungal PhyA phytase, was retained by

the mutant phytase. However, it is not identical to the

profile obtained for the WT phytase. First, the pH profile

has become narrower in the mutant phytase as evidenced

Figure 1. The pH versus activity profile of the WT and

A69E mutant phytase.

by the width of the peak. Second, the mutant protein

could still hydrolyze phytic acid at pH 7.0 whereas, the

WT phytase failed to catalyze the phosphomonoesterase

activity at the neutral pH. Third, the mutant phytase

could hydrolyze phytase at pH 2.0 as opposed to the WT

that ceases to catalyze hydrolysis of phytate at this pH.

Fourth, the mutant phytase had an additional minor peak

at pH 3.5 and two troughs at pH 3.0 and 4.0. Conversely,

the WT phytase has one trough at pH 3.5 (Figure 1).

3.2. Effect of A69E Mutation on Temperature

Optima

Temperature versus activity profile of A. niger phytase

was affected by A69E mutation. Both the WT and the

mutant phytase were assayed at various temperatures

starting from 20˚C to 70˚C. The profiles are shown in

Figure 2. The optimum temperature for WT phytase was

found to be 58˚C; however, the mutant phytase peaked at

55˚C. At 58˚C, the mutant phytase lost about 30%

activity as compared to the WT phytase. At 65˚C, the

WT phytase was completely inactivated whereas the

mutant phytase lost about 62% of the phytase activity.

Therefore, it appears that the mutation had enabled the

biocatalyst to resist thermal denaturation as compared to

the WT phytase.

3.3. Effect of A69E Mutation on Thermostability

Table 1 describes the results of the thermal studies

performed with both the WT and A69E mutant phytase.

The fungal PhyA phytase performs optimally at about

55˚C when the protein is expressed in Pichia pastoris.

The WT phytase loses activity progressively when

subjected to 5 minutes at 60˚C, 65˚C, and 70˚C. At 70˚C,

it lost about 63% activity as compared to losing about

11% at 60˚C. Conversely, the mutant did not lose any

activity at 60˚C and at the severest case of 70˚C, it lost

about 57% activity. A remarkable difference in thermal

stability was however exhibited at 65˚C. The WT lost

A. H. J. ULLAH ET AL. 391

Figure 2. The temperature versus activity profile of the WT

phytase at 58˚C and pH 5.0 and A69E mutant phytase at

55˚C and pH 5.5.

Table 1. Thermal stability of the WT and A69E mutant

phytase.

Phytase activity in percent after

exposure for 5 minute at

Phytase

0˚C 60˚C 65˚C 70˚C

WT 100* 89 42 37

A69E mutant 100** 102 76 43

*542 nkat/mL; **437 nkat/mL.

about 58% activity as compared to the A69E mutant,

which lost only 24%.

3.4. Effect of A69E Mutation on Protein

Unfolding in Response to GuCl

A differential response to increasing concentration of

protein denaturant, GuCl, was observed when both the

WT and A69E mutant phytase was subjected to the un-

folding reagent at the concentration rage of 0 to 1.0 M.

The results are shown in Figure 3. The WT phytase be-

haved similarly to the results published earlier [14] when

challenged with GuCl at its optimum pH, viz., at pH 5.0.

The enzyme activity was boosted 35% going from 0 to

0.55 M GuCl in a linear fashion and then the activity fell

to 0% at 1.0 M denaturant concentration. However, when

A69E mutant phytase was subjected to its optimum tem-

perature, pH and then challenged with increasing con-

centration of GuCl, the activity had risen sharply in an

exponential fashion with a final boost of 100% activity

going from 0 to 0.16 M of GuCl concentration. The ac-

tivity then fell 12% at 0.5 M denaturant concentration.

The activity of A69E mutant phytase remained at the

same level even at 1.0 GuCl. This dramatic resistance of

the mutant phytase to tolerate the denaturant concentra-

tion at 1.0 M level is the salient difference between the

WT phytase and the single mutation A69E.

3.5. Effect of A69E Mutation on Inhibition of

Activity by Myo-Inositol Hexasulfate

Myo-inositol hexasulfate (MIHS), a structural analog of

phytate, is a known inhibitor of fungal phytase [16]. Both

the WT and A69E mutant phytase was subjected to

varying concentrations of MIHS to assess whether the

single mutation has changed MIHS induced inhibition of

activity vis-à-vis the WT. The results are shown in Fig-

ure 4. Even though both phytases lost total activity at

500 μM concentration of MIHS, the mutant phytase

showed a greater resistance to inhibition by the substrate

analog. For example, while a 50% inhibition in PhyA

WT phytase was achieved at 25 μM, for A69E mutant

the same inhibition level was achieved at 375 μM of the

inhibitor. This was reflected in the Ki of the phytases for

MIHS. The mutant phytase exhibited 10 times higher Ki

for the substrate analog than the value obtained for the

wild type phytase.

3.6. Effect of A69E Mutation on Long Term

Stability at Different pH

Both the wild type and A69E mutant phytase was

unstable at pH 8.5 immediately after subjecting to the

buffer at the start time; however, the proteins were

Figure 3. The effect of GuCl on the WT phytase and A69E

mutant phytase.

Figure 4. Inhibitory effect of myo-inositol hexasulfate (MIH S)

on the activity of the WT phytase and A69E mutant phy-

tase.

A. H. J. ULLAH ET AL.

392

remarkably stable at pH 7.2 and below down to pH 2.5

(Figure 5 panel A and panel B). For WT phytase the

activity stayed the same up to 7 days and then lost 60%

activity on day 12. The activity declined further until day

20 when the experiment was terminated. The mutant

phytase retained activity slightly better going from day

12 to day 20. In summary, both WT and A69E mutant

phytase showed loss of activity in the pH range 2.5 to

7.2.

4. Discussion

From structural standpoint phytases belonging to HAP

class of acid phosphomonoesterase have been studied

exhaustively. The first reporting of any three-dimen-

sional structure in phytase took place over a decade ago

when PhyA phytase’s structure was elucidated [17]. This

was followed by several reporting of X-ray deduced

tertiary structure elucidation in other HAP phytases [18-

20]. These revelations of structures set the stage for

knowledge-based protein engineering via point mutations

in the active center of phytases [21-23].

In this communication, we presented evidences in

support of the conclusion that a single mutation in the

active site of PhyA phytase had affected a host of bio-

chemical properties such as pH optima, temperature

optima, kinetic parameters, reaction to GuCl and MIHS

(Table 2). This is very similar to the concept of “pleio-

tropic effect” in single gene mutation where the mutation

of a gene leads to a host of phenotypic changes. In the

case of A69E mutation in the fungal PhyA phytase, a

single substitution of amino acid the substitution has

caused a myriad of changes in both physicochemical and

catalytic properties in A. niger phytase.

The original amino acid in the hepta-peptide amino

acid region, where the active site resides, an A (alanine)

residue is located (10). We mutated A to E (glutamic acid)

to incorporate an extra negative charge in the active site

of the protein which is based on the observation that

PhyB phytase, which has higher turnover number than

the phyA phytase, had E residue in the identical position

[10]. The newly incorporated negative charge in the

active site of phytase will have an unintended conse-

quence vis-à-vis the accommodation of the substrate,

phytate, which has six negatively charged phosphate

group. The newly acquired negative charge in the active

site should repel phytate as compared to the WT phytase;

therefore, the Km is expected to rise in the mutant phytase.

That is what is being observed in Table 1. By the same

token, the Vmax should improve somewhat because the

negative charge brought on by E into the active site

should facilitate the release of negatively charged phos-

phate group. The turnover number increased 6.6% in the

mutant phytase over the wild type phytase (Table 1). The

substrate analog, MIHS, has six negatively charged

sulfate groups, which should not bind as efficiently in the

mutant phytases’ active site as compared to the wild

Figure 5. The long-term stability of the WT phytase (panel A) and A69E mutant phytase (panel B).

Table 2. Kinetic properties of A. niger WT and A69E phytase.

Properties WT phytase A69E phytase

Km (μM) 50 170

Specific activity at Vma x (ηkat/mg) 1950 2116

Turnover number (sec–1) 120 128

Kinetic efficiency (mol–1·sec–1) 2.3 × 106 0.74 × 106

Ki for MIHS (μM) 8 83

A. H. J. ULLAH ET AL. 393

type phytase’s active site. This has been confirmed by

the Ki values for MIHS in the mutant phytase. It took

over 10 times concentration of MIHS in the mutant

phytase to effect the same inhibition done by the wild

type phytase. Therefore, incorporation of a negatively

charged amino acid into the hepta-peptide active site

region of the phytase has decreased the affinity for not

only the substrate but also the inhibitor. In X-ray

crystallographic studies with HAP type phytases re-

searches have shown that sulphate groups of MIHS bind

to the substrate-binding domain that is in the active

center of protein [20,24].

Both the pH optima and temperature versus activity

profile had changed in the mutant phytase. The me-

chanism for such changes is difficult to explain due to

the lack of X-ray crystallographic data; nonetheless, the

charged amino acid, E, replacing the aliphatic amino acid

A may allow new hydrogen bonding sites in the active

site area. Also, the domain flexibility in the active center

of the protein possibly brought on by the charged amino

acid may explain these far-reaching effects on pH optima

and temperature optima profiles.

The native phytases belonging to HAP family of pho-

sphatases have already been unfolded using GuCl and

then refolded by the removal of denaturant by dialysis

[14,25]. However, a differential response has been ob-

served when the WT and A69E mutant phytases were

treated with varying concentrations of GuCl. Initially, the

activity was boosted 35% when GuCl concentration was

raised to 0.55 M. We explained this phenomenon of rise

in the Vmax in the light of domain flexibility brought on

by GuCl. However, in case of the mutant phytase, the

activity had risen in exponential manner in response to

GuCl at the concentration of 0.16 M. This is in sharp

contrast to the WT phytase’s reaction to increasing

concentration of GuCl. At higher concentration of the

denaturant, when WT phytase had lost over 75% of the

activity, the mutant phytase was holding onto the 100%

activity gain it achieved earlier due to addition of small

amounts of GuCl. One possible reason for such discre-

pancy on the part of the mutant phytase could be that the

altered structure containing the flexible domain was

resistant to chemical denaturation.

The long-term stability of both the WT and A69E

phytases in various buffers were observed; there were no

discernible difference between the two phytases under

the conditions. The fungal phytase was very susceptible

to catalytic demise when subjected to pH 8.5 in contrast

to acidic pH where the proteins remain stable for days.

The biochemical basis of the vulnerability of fungal

phytase in alkaline pH is not understood at this time.

In summary, a single mutation in the hepta-peptide

region that constitutes the active site resulted a myriad

of both chemical and catalytic changes, which could not

have been predicted. The results presented in these stud-

ies have indicated that in this class of proteins a know-

ledge-based approach to structural change may offer a

better choice than random mutagenesis through error

prone PCR technique [26,27].

5. Conclusion

The results of the present communication had clearly

demonstrated the power of chemical probing of the ac-

tive site by site-directed mutagenesis. By mutating the

fourth residue A to E in the hepta-peptide active site of A.

niger PhyA the mutant protein exhibited a myriad of new

physico-chemical properties. Not only the pH optimum

shifted 0.5 pH unit, the temperature optimum also shifted

from 58˚C to 55˚C. Furthermore, the catalytic activity of

the mutant phytase doubled as compared to the wild type

phytase when subjected to 0.1 to 0.2 M GuCl. A single

mutation in the active site affecting so many parameters

of a biocatalyst gives insight into the complexity of pro-

tein’s three-dimensional structure.

REFERENCES

[1] T. R. Shieh and J. H. Ware, “Survey of Microorganisms

for the Production of Extracellular Phytase,” Applied Mi-

crobiology, Vol. 16, No. 9, 1968, pp. 1348-1351.

http://aem.asm.org/content/16/9/1348.full.pdf

[2] A. H. J. Ullah and D. M. Gibson, “Extracellular Phytase

(E.C. 3.1.3.8) from Aspergillus ficuum NRRL 3135: Puri-

fication and Characterization,” Preparative Biochemistry,

Vol. 17, No. 1, 1987, pp. 63-91.

doi:10.1080/00327488708062477

[3] S. Haefner, A. Knietsch, E. Scholten, J. Braun, M. Lohs-

cheidt and O. Zelder, “Biotechnological Production and

Applications of Phytases,” Applied Microbiology and Bio-

technology, Vol. 68, No. 5, 2005, pp. 588-997.

doi:10.1007/s00253-005-0005-y

[4] R. J. Wodzinski and A. H. J. Ullah, “Phytase,” Advances

in Applied Microbiology, Vol. 42, 1996, pp. 263-302.

doi:10.1016/S0065-2164(08)70375-7

[5] A. H. J. Ullah and B. Q. Phillippy, “Immobilization of

Aspergillus ficuum Phytase: Product Characterization of the

Bioreactor,” Preparative Biochemistry, Vol. 18, No. 4,

1988, pp. 483-489. doi:10.1080/00327488808062546

[6] A. H. J. Ullah, K. Sethumadhavan and E. J. Mullaney,

“Salt Effect on the pH Profile and Kinetic Parameters of

Microbial Phytases,” Journal of Agricultural and Food

Chemistry, Vol. 56, No. 9, 2008, pp. 3398-3402.

doi:10.1021/jf073137i

[7] J. D. Weaver, A. H. J. Ullah, K. Sethumadhavan, E. J.

Mullaney and X. G. Lei, “Impact of Assay Conditions on

Activity Estimate and Kinetics Comparison of Aspergil-

lus niger PhyA and Escherichia coli AppA2 Phytases,”

Journal of Agricultural and Food Chemistry, Vol. 57, No.

12, 2009, pp. 5315-5320. doi:10.1021/jf900261n

[8] A. H. J. Ullah, B. J. Cummins and H. C. Dischinger, Jr.,

A. H. J. ULLAH ET AL.

394

“Cyclohexanedione Modification of Arginine at the Active

Site of Aspergillus ficuum Phytase,” Biochemical and Bio-

physical Research Communications, Vol. 178, No. 1, 1991,

pp. 45-53. doi:10.1016/0006-291X(91)91777-A

[9] R. L. Van Etten, R. Davidson, P. E. Stevis, H. MacArthur

and D. L. Moore, “Covalent Structure, Disulfide Bonding,

and Identification of Reactive Surface and Active Site

Residues of Human Prostatic Acid Phosphatase,” Journal

of Biological Chemistry, Vol. 266, No. 4, 1991, pp. 2313-

2319.

http://www.jbc.org/content/266/4/2313.full.pdf+html

[10] A. H. J. Ullah and H. C. Dischinger, Jr., “Identification of

Active Site Residues in Aspergillus ficuum Extracellular

pH 2.5 Optimum Acid Phosphatase,” Biochemical and Bio-

physical Research Communications, Vol. 192, No. 2, 1993,

pp. 754-759. doi:10.1006/bbrc.1993.1478

[11] W. Zhang, E. J. Mullaney and X. G. Lei, “Adopting Se-

lected Hydrogen Bonding and Ionic Interacttions from

Aspergillum fumigatus Phytase Structure Improves the

Thermostability of Aspergillus niger PhyA Phytase,” Ap-

plied and Environmental Microbiology, Vol. 73, No. 9,

2007, pp. 3069-3076. doi:10.1128/AEM.02970-06

[12] T. Kim, E. J. Mullaney, J. M. Porres, R. Roneker, S.

Crowe, S. Rice, T. Ko, A. H. J. Ullah, C. B. Daly, R.

Welch and X. G. Lei, “Shifting the pH Profile of Asper-

gillus niger PhyA Phytase to Match the Stomach pH En-

hances Its Effectiveness as an Animal Feed Additive,”

Applied and Environmental Microbiology, Vol. 72, No. 6,

2006, pp. 4397-4403. doi:10.1128/AEM.02612-05

[13] E. J. Mullaney, H. Locovare, K. Sethumadhavan, S.

Boone, X. G. Lei and A. H. J. Ullah, “Site-Directed

Mutagenesis of Disulfide Bridges in Aspergillus niger

NRRL 3135 Phytase (PhyA), Their Expression in Pichia

pastoris and Catalytic Characterization,” Applied Micro-

biology and Biotechnology, Vol. 87, No. 4, 2010, pp.

1367-1372. doi:10.1007/s00253-010-2542-2

[14] A. H. J. Ullah, K. Sethumadhavan and E. J. Mullaney,

“Monitoring of Unfolding and Refolding in Fungal Phy-

tase (PhyA) by Dynamic Light Scattering,” Biochemical

and Biophysical Research Communications, Vol. 327, No.

4, 2005, pp. 993-998. doi:10.1016/j.bbrc.2004.12.111

[15] J. K. Heinonen and R. J. Lahti, “A New and Convenient

Calorimetric Determination of Inorganic Orthophosphate

and Its Application to the Assay of Inorganic Pyrophos-

phatase,” Analytical Biochemistry, Vol. 113, No. 2, 1981,

pp. 313-317. doi:10.1016/0003-2697(81)90082-8

[16] A. H. J. Ullah and K. Sethumadhavan, “Myo-Inositol Hex-

asulfate Is a Potent Inhibitor of Aspergillus ficuum Phy-

tase,” Biochemical and Biophysical Research Communi-

cations, Vol. 251, No. 1, 1998, pp. 260-263.

doi:10.1006/bbrc.1998.9456

[17] D. Kostrewa, F. Grueninger-Leitch, A. D’Arcy, C. Broger,

D. Mitchell and A. P. G. M. Van Loon, “Crystal Structure

of Phytase from Aspergillus ficuum at 2.5 Å Resolution,”

Nature Structural Biology, Vol. 4, No. 3, 1997, pp. 185-

190. doi:10.1038/nsb0397-185

[18] D. Kostrewa, M. Wyss, A. D’Arcy and A. P. G. M. Van

Loon, “Crystal Structure of Aspergillus niger pH 2.5 Acid

Phosphatase at 2.4 Å Resolution,” Journal of Molecular

Biology, Vol. 288, No. 5, 1999, pp. 965-974.

doi:10.1006/jmbi.1999.2736

[19] D. Lim, S. Golova, C. W. Forsberg and Z. Jia,” Crystal

Structures of Escherichia coli Phytase and Its Complex

with Phytate,” Nature Structural Biology, Vol. 7, No. 2,

2000, pp. 108-113. doi:10.1038/72371

[20] K. Böhm, T. Herter, J. Müller, R. Borriss and U. Heine-

mann, “Crystal Structure of Klebsiella sp. ASR1 Phytase

Suggests Substrate Binding to a Preformed Active Site

that Meets the Requirements of a Plant Rhizosphere En-

zyme,” Federation of European Biochemical Societies Jour-

nal, Vol. 277, No. 5, 2000, pp. 1284-1296.

doi:10.1111/j.1742-4658.2010.07559.x

[21] E. J. Mullaney, C. B. Daly, T. Kim, J. M. Porres, X. G.

Lei, K. Sethumadhavan and A. H. J. Ullah, “Site-Directed

Mutagenesis of Aspergillus niger NRRL 3135 Phytase at

Residue 300 to Enhance Catalysis at pH 4.0,” Biochemi-

cal Biophysical Research Communications, Vol. 297, No.

4, 2002, pp. 1016-1020.

doi:10.1016/S0006-291X(02)02325-2

[22] Y. S. Tian, R. H. Peng, J. Xu, W. Zhao, F. Gao, X. Fu, A.

S. Xiong and Q. H. Yao, “Semi-Rational Site-Directed

Mutagenesis of phyi1s from Aspergillus niger 113 at Two

Residue to Improve Its Phytase Activity,” Molecular Bi-

ology Reports, Vol. 38, No. 2, 2011, pp. 977-982.

doi:10.1007/s11033-010-0192-1

[23] A. J. Oakley, “The Structure of Aspergillus niger Phytase

PhyA in Complex with a Phytate Mimetic,” Biochemical

and Biophysical Research Communications, Vol. 397, No.

4, 2010, pp. 745-749. doi:10.1016/j.bbrc.2010.06.024

[24] D. C.-C. Lim, “Bound for Catalysis. Crystal Structures of

Escherichia coli Phytase and Its Complex with Phytic

Acid,” M.S. Thesis, Queen’s University, Kingston, 1999.

[25] A. H. J. Ullah, K. Sethumadhavan and E. J. Mullaney,

“Unfolding and Refolding of Aspergillus niger PhyB

Phytase: Role of Disulfide Bridges,” Journal of Agricul-

tural and Food Chemistry, Vol. 56, No. 17, 2008, pp.

8179-8183. doi:10.1021/jf8013712

[26] M. S. Kim and X. G. Lei, “Enhancing Thermostability of

Escherichia coli Phytase AppA2 by Error-Prone PCR,”

Applied Microbiology and Biotechnology, Vol. 79, No. 1,

2008, pp. 69-75. doi:10.1007/s00253-008-1412-7

[27] W. Zhu, D. Qiao, M. Huang, G. Yang, H. Xu and Y. Cao,

“Modifying Thermostability of AppA from Escherichia

coli,” Current Microbiology, Vol. 61, No. 4, 2010, pp. 267-

273. doi:10.1007/s00284-010-9606-5