Paper Menu >>
Journal Menu >>
![]() Open Journal of Genetics, 2012, 2, 163-166 OJGen http://dx.doi.org/10.4236/ojgen.2012.23021 Published Online September 2012 (http://www.SciRP.org/journal/ojgen/) Universal RNA editing in a human liver at the fetal st age Dong Liu1, Cong Liu1, Xiyin Wang1, Sigurdur Ingvarsson2, Huiping Chen1 1Department of Medical Genetics, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China 2Institute for Experimental Pathology and Faculty of Medicine, University of Iceland, Keldur, Iceland Email: [email protected] Received 14 May 2012; revised 17 June 2012; accepted 10 July 2012 ABSTRACT It is known that RNA editing occurs in human cells, which can change the information transmission from DNA to RNA and proteins. Most previous studies have focused on editing of the mRNAs. Here we re- ported that several kinds of RNAs, including miRNA, rRNA, mRNA, miscRNA and unknown RNA, exhib- ited base editing in a human fetal liver. Several edit- ing types are displayed. Our data reveals that RNA editing may occur in different species of RNAs. Keywords: RNA Editing; miRNA; rRNA; mRNA; miscRNA; Fetal Liver 1. INTRODUCTION The central dogma of molecular biology is that “DNA makes RNA makes protein” or “RNA makes DNA makes RNA makes protein”. The transmission of information is from DNA to RNA to protein, or from RNA to DNA to RNA to protein. The genetic information comes from the DNA or RNA. However, the genetic information can be changed during the transmission. Previous studies showed that RNA can be modified or changed, known as RNA editing [1,2]. In addition to mRNA editing, mi- RNAs also exhibited editing [3-5]. The main editing type is adenosine (A) to inosine (I) modification [6]. Because inosine acts as guanosine during translation, A-to-I con- version in coding sequences leads to amino acid changes and often entails changes in protein function [3,6]. RNA can also be edited by deaminating cytidine (C) to uridine (U). Although the editing of mRNA includes well defined alteration of coding capacity, the editing of regulatory RNA molecules is less understood, but might interfere with their functionality. A recent understanding is that there is a broader role of RNA molecules than previously considered and that they are crucial contributors to cel- lular processes such as gene expression on transcriptional and post-transcriptional levels. Editing on those regula- tory RNA molecules could modulate how effective they are in cellular processes. 2. MATERIAL AND METHODS We speculate that RNA modification or editing takes place in all kinds of RNAs. To test this hypothesis, a liver tissue was obtained from a female fetus of 27 weeks delivered due to severe syndrome of high blood pressure of the mother in Tongji Hospital, Wuhan, Hubei, China. The fetus died shortly after delivery. The mother of the fetus had no other diseases than high blood pressure. Small RNA (≤200 nt) was isolated from about 50 mg of the liver tissue using a mirVanaTM miRNA isolation kit (Ambion, Austin, TX) following the manufacturer’s in- structions. About 1 μg of the isolated RNAs were polyadenylated using poly(A) polymerase (New England Biolabs). Then the Poly(A)-tailed small RNA was purified through phenol/chloroform extraction and ethanol precipitation. A 5’ linker (5’-GGA CAC UGA CAU GGA CUG AAG GAG UAG AAA-3’) was ligated to the poly(A)-tailed RNA using T4 RNA ligase (New England Biolabs) and the ligation products were recovered by phenol/ chloro- form extraction followed by ethanol precipitation. Re- verse transcription was conducted using the entire poly(A)-tailed RNA with primer (5’-CGC TAC GTA ACG GCA TGA CAG TG (T)24-3’) and SuperScript III reverse transcriptase (Invitrogen) according to the manu- facturer’s instructions. The cDNA was PCR amplified using primers 5’-GGA CAC TGA CAT GGA CTG AAG GAG TA-3’ and 5’-CGC TAC GTA ACG GCA TGA CAG TG-3’. After agarose gel electrophoresis and Gold View staining slices with PCR products were excised and purified, using EasyPure quick gel extraction kit (TransGen Biotech). The DNA fragments were directly cloned into pEASY-T1 vector (TransGen Biotech). Col- ony PCR was performed and the clones with PCR prod- ucts were sequenced bidirectionally to avoid sequen- cing errors. The small RNA sequences were analyzed using BLAST analysis against the human genome and transcripts databases and miRBase (Figure 1). OPEN ACCESS ![]() D. Liu et al. / Open Journal of Genetics 2 (2012) 163-166 164 Figure 1. Workflow of the experiments performed. 3. RESULTS AND DISCUSSION Several kinds of cellular RNA fragments were detected. The majority were miRNAs. Slightly more than 20% of the cloned RNAs were degraded products of abundant RNAs such as rRNA and mRNA, and few clones were unknown RNAs. RNA fragments with 1 to 2 mismatches to the sequences in the above databases were selected for SNP search. RNA editing was suggested if the possibility of being a SNP was excluded by the SNP databases search. We identified 10 changes where the RNA se- quence did not match those of the corresponding DNA sequences. These changes were found in 4 miRNAs. In addition to miRNAs, 28S rRNA, miscRNA (miscellane- ous RNA, non-coding RNA), mRNA of SCL6A20 (Sol- ute carrier family 6, member 20) gene, and unknown RNA were scored to have RNA editing. We then de- signed primers (Table 1) to amplify the DNA regions that are transcribed to the RNAs above. DNA was iso- lated from the liver tissue of the female fetus. Then PCR products were bidirectionally sequenced using the ABI sequencer (Figure 1). Differences between DNAs and RNAs were identified in Figure 2 and Table 2. The wild types of some RNAs (hsa-mir-122, hsa-mir-451 and 28S rRNA) were also identified, suggesting that a subset of RNAs, but not all, were edited. The hsa-mir-451 and an unknown RNA showed two types of editing respectively, indicating that there are different types of editing for one kind of RNAs. We observed six possible categories of base differences between RNA and its corresponding DNA. In addition to A to G changes, T to C, A to C, C to A, C to T, and G to T were also detected. There are 3 A-to-G transitions, which can be the result of deamina- tion by ADAR or similar enzymatic activity [7]. There are 1 C-to-T transitions, which could be mediated by APOBEC or another deaminase. The 6 transversions detected cannot result from deaminase-mediated editing and the mechanism by which these differences between RNA and DNA sequences could arise is unknown. miRNA editing may occur in the fetal stage of human liver, and additional species of RNAs could be edited. Moreover, there are several types of RNA editing em- erged. Our findings support previous results on DNA- RNA differences in the human genome, show that these differences include miRNAs and that they are beyond A-to-G transitions. Our findings also suggest the exis- tence of a new mechanism of RNA editing. Editing of regulatory RNA molecules might interfere with their mediated control of gene expression. Since one miRNA has the potential to regulate several genes, the editing of it might have significant contribution to the transcrip- tome and proteome composition. This means that the biological significance of RNA editing is broader that previously considered. The universal RNA editing may play an important role in growth and development of the fetal livers. 4. ETHICS STATEMENT This research has been approved by the review board of Huazhong University of Science and Technology. We obtained tissue samples with written informed consent from the participants and parents/guardians of partici- pants involved in the study. The ethics committee of Huazhong University of Science and Technology spe- ifically approved the procedures. c Table 1. Primers for DNA amplification and sequencing. Name Primer Forward Primer Reverse Annealing Temperature (˚C) hsa-mir-23a CCTGCTCACAAGCAGCTAAG CTCTCTCTTTCTCCCCTCCAG 56 hsa-mir-99a TATTAATAGGGGGCCCATGC ATTGTTGAACGGCACTGTGT 54 hsa-mir-122 CCCGTGATGCTTCTTTTCTC AAAGCAAACGATGCCAAGAC 55 hsa-mir-451 GCCTTGTTTGAGCTGGAGTC GAGCCTGACAAGGAGGACAG 55 28s rRNA GGCGCTAAACCATTCGTAGA AGGAAGACGAACGGAAGGAC 55 miscRNA CACTGAACATGGCTTTGGTG GGTTGAGGCGTCTGTCCTAA 57 SCL6A20 mRNA ATAGGAGAAAACCGCCCTGT CTGTCTTAGCGAGGGGAGTG 55 unknown RNA GGCAGCAGGTGAGAGAGAGT GCTCTGTCTCCACCCAAATC 61 Copyright © 2012 SciRes. OPEN ACCESS ![]() D. Liu et al. / Open Journal of Genetics 2 (2012) 163-166 165 Figure 2. Comparison of sequences of DNAs and RNAs. Arrows point to base changes between DNAs and RNAs. RE, RNA ed- iting; WT, wild type. Table 2. RNA editing in different species of RNAs. RNA Sequence Type hsa-mir-23a gene ATCACATTGCCAGGGATTTCC hsa-mir-23a(RE) ATCACATTGCCAGGGATTCCC T to C hsa-mir-99a gene AACCCGTAGATCCGATCTTGTG hsa-mir-99a(RE) GACCCGTAGATCCGATCTTGTG A to G hsa-mir-122 gene TGGAGTGTGACAATGGTGTTTG hsa-mir-122(WT) TGGAGTGTGACAATGGTGTTTG hsa-mir-122(RE) TGGAGTGTGACAATGGTGTTCG T to C hsa-mir-451 gene AAACCGTTACCATTACTGAGTT hsa-mir-451(WT) AAACCGTTACCATTACTGAGTT hsa-mir-451(RE)1 GAACCGTTACCATTACTGAGTT hsa-mir-451(RE)2 ACACCGTTACCATTACTGAGTT A to G A to C 28s rRNA gene GCTGCGATCTATTGAAAGTCAGCCCTCGACACAAGGGTTTGT 28S rRNA (WT) GCTGCGATCTATTGAAAGTCAGCCCTCGACACAAGGGTTTGT 28S rRNA (RE) GCTGCGATCTATTGAGAGTCAGCCCTCGACACAAGGGTTTGT A to G miscRNA gene TCCCTGGTGGTCTAGTGGCTAGGATTCGGCGCT miscRNA (RE) TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCT C to T SCL6A20 gene TATTGCTGCCAGCATATC SCL6A20 mRNA (RE) CATTGCTGCCAGCATATC T to C unknown RNA gene GCATGGGTGGTTCAGTGGCAGAATTCTC unknown RNA (RE)1 GCATGGGTGGTTTAGTGGCAGAATTCTC unknown RNA (RE)2 GCATTGGTGGTTTAGTGGCAGAATTCTC G to T C to T Copyright © 2012 SciRes. OPEN ACCESS ![]() D. Liu et al. / Open Journal of Genetics 2 (2012) 163-166 Copyright © 2012 SciRes. 166 5. ACKNOWLEDGEMENTS OPEN ACCESS This study was supported by the Huazhong University of Science and Technology (2010MS034). REFERENCES [1] Bass, B.L. (2002) RNA editing by adenosine deaminases that act on RNA. Annual Review of Biochemistry, 71, 817-846. doi:10.1146/annurev.biochem.71.110601.135501 [2] Maas, S., Rich, A. and Nishikura, K. (2003) A-to-I RNA editing: Recent news and residual mysteries. Journal of Biological Chemistry, 278, 1391-1394. doi:10.1074/jbc.R200025200 [3] Daniel, J.L., Henry, M., Nicholas J.V. and Stefan, M. (2004). RNA editing of a miRNA precursor. RNA, 10, 1174-1177. doi:10.1261/rna.7350304 [4] Morse, D.P., Aruscavage, P.J. and Bass, B.L. (2002) RNA hairpins in noncoding regions of human brain and Caenorhabditis elegans mRNA are edited by adenosine deaminases that act on RNA. Proceedings of the National Academy of Sciences, 99, 7906-7911. [5] Rueter, S.M., Dawson, T.R. and Emeson, R.B. (1999) Regulation of alternative splicing by RNA editing. Na- ture, 399, 75-80. doi:10.1038/19992 [6] Li, M.L., Isabel, X.W., Yun, L., et al. (2011) Wide spread RNA and DNA sequence differences in the human tran- scriptome. Science, 333, 53-58. doi:10.1126/science.1207018 [7] Heale, B.S., Keegan, L.P., McGurk, L., et al. (2009) Ed- iting independent effects of ADARs on the miRNA/ siRNA pathways. EMBO Journal, 28, 3145-3146. doi:10.1038/emboj.2009.244 |





