Somatic cell mutations in cerebral tissue of cattle affected by bovine spongiform encephalopathy

doi:10.4236/as.2010.11005

Paper Menu >>

Journal Menu >>

Vol.1, No.1, 39-43 (2010)s

doi:10.4236/as.2010.11005

Agricultural Science

Somatic cell mutations in cerebral tissue of cattle

affected by bovine spongiform encephalopathy

Matteo Busconi, Corrado Fogher*

Istituto di Agronomia, Genetica e Coltivazioni erbacee, Sezione di Botanica e Genetica vegetale, Università Cattolica S. Cuore,

Piacenza, Italy; *Corresponding Author: [email protected]

Received 16 April 2010; revised 28 April 2010; accepted 6 May 2010.

ABSTRACT

In animals the prion disease includes sheep and

goat scrapie and the bovine spongiform en-

cephalopathy (BSE). While several polymor-

phisms of the prion (PRNP) gene have been

identified in sheep and some of them have been

associated with susceptibility to scrapie, few

mutations are reported in cattle and no correla-

tion with BSE have been demonstrated. Genetic

screening for mutants in the PRNP gene of 21

BSE positive animals by direct sequencing of

the amplified gene, using DNA extracted from

brain as template, confirmed that only few

polymorphisms are present. However DNA

molecules cloned and sequenced from the

population of fragments considering a total of

90 clones from 9 BSE positive and 70 clones

from 7 BSE negative animals, gave a highly

significant differences in the frequency of mu-

tations (p = 0.01). The high frequency and type

of variants found cannot be explained only w ith

misincorporation error of the Ta q polymerase.

Interestingly one of the mutations found in the

BSE positive animals (F209S) corresponds to a

mutant that causes a familiar form of prion dis-

ease in humans (F198S). These data can be ex-

plained with the presence of somatic mutations

modifying the PRNP gene in single brain cells.

Keywords: BSE; Prion; Somatic Mutations

1. INTRODUCTION

The transmissible spongiform encephalopathies (TSE) in

humans and animals are caused by anomalous aggrega-

tion of a cell-surface protein known as prion protein

(PrP). This aggregation is a consequence of a tem-

plate-induced conformational change of the normally

expressed protein (PrPC) into the pathogenic missfolded

form (PrPSc) [1]. In humans the TSE known as Creutzfeldt-

Jakob disease (CJD) has been categorised into three

main forms: 1) sporadic cases with no known environ-

mental cause (85%) [2]; 2) familial cases with a domi-

nant inherited mutation of the PRNP gene (10-15%) [3];

3) cases transmitted from a known or presumed envi-

ronmental source (e.s. iatrogenic, rare) [4]. In animals

the prion disease includes sheep and goat scrapie and the

bovine spongiform encephalopathy (BSE). While several

polymorphisms of the PRNP gene have been identified

in sheep and some of them have been associated with

susceptibility to scrapie [5], few mutations have been

found in cattle and no correlations with BSE have been

postulates [6].

Molecular genetic studies of the inherited form of

CJD indicate that this disease is caused by mutations in

the prion protein gene (PRNP) and the most frequent

mutations described are P102L, D178N, F198S, E200K,

and V210I [7]. No mutations genetically linked to the

disease have been found in animals, but amino acid

changes at codons 136, 154 and 171 have been shown to

be associated with susceptibility to scrapie in sheep [8].

In contrast to the many PrP polymorphisms found in

sheep, only few PrP polymorphisms have been found in

cattle regarding the number of octapeptide repeat units

(five-seven), present in the first half of the gene [9], or

changes in the amino acids S46I and S146N found in

healthy animals [6,10]. Genetic studies have not shown

an association between numbers of repeats and BSE

susceptibility [9,11].

A new variant of CJD (nvCJD) has been demonstrated

to be caused by the same prion strain that causes BSE

rising concern for a possible human epidemic following

meat from affected animals entering the human food

chain, in late 1980s and early 1990s [12]. In terms of

control of BSE it is important to know whether this dis-

ease, apart from the origin from infected meat and bone

meals, is conditioned by genetic factors. The aim of this

work is to show that the brain tissue of BSE affected

cattle contains somatic mutations, one of which is ho-

mologous to a PRNP mutation responsible for a familial

form of prion disease in humans.

M. Busconi et al. / Agricultural Sciences 1 (2010) 39-43

2. MATERIALS AND METHODS

2.1. DNA Extraction

Twenty-one BSE positive samples diagnosed with rapid

methods and confirmed with histopathology, immuno-

histochemistry and Western blot as described by Casa-

lone et al. [13] and seven BSE negative samples, were

used for PCR amplification of the entire PRNP gene

(Acc. n. X55882). DNA extraction from obex region of

the medulla oblongata in the brain stem has been done

with manual Qiagen kits.

2.2. PCR Amplification

All the PCR amplifications were performed with a Ge-

neAmp PCR system 9700 thermal cycler (Applied Bio-

systems). PCR reactions were carried out in a final vol-

ume of 20 l (1X PCR buffer; 2 mM Mg++, 150 M

dNTPs, 5 pmol of each primer (Forward IGP553

GCTAGCATGGTGAAAAGCCACATAGGCAG, and

Reverse IGP554 GTCGACCTATCCTACTATGA-

GAAAAATGAGG), 1.5 U AmpliTaq Gold (Applied

Biosystems) and 5 ng of genomic DNA). The following

cycle was applied: 10 min at 95°C, 35 cycles of 30 s

denaturation at 95°C, 1 min at 56°C, 1.5 min extension

at 72°C. The amplified products were resolved by elec-

trophoresis on agarose gel and visualised by ethidium

bromide staining. The expected size of PCR products

was 807 bp (795 bp from PRNP gene and 12 bp more

from primers). Fragments were recovered from the gel

and directly sequenced or ligated in a T-vector (pGEM-T

easy, Promega), then transformed by electroporation into

E. coli strain DH5α. Ten isolated clones were sequenced

for each PCR sample reactions of 9 positive and 7 nega-

tive animals after plasmid purification. Cycle-sequen-

cing was performed in a final volume of 20 μl using the

big dye v3 chemistry (Applied Biosystems) and, after

purifications, the sequences were loaded and ran on the

ABI Prism3100 Genetic Analyzer (Applied Biosystems)

following the manufacturer’s protocols.

3. INTERNAL PRIMER DESIGN AND

MUTATION SCREENING

Using the sequence data of the clone with the mutation

F209S, presenting a change from T to C in position 626,

a reverse internal primer (IGP717 5’-CATCTTGATGT-

CAGTTTCGGTGG-3’) was designed in order to per-

form a mutation screening.

All the original twenty one positive BSE samples,

plus three BSE negative samples, were screened for the

presence of the mutation F209S. Reactions were carried

out in a final volume of 20 l (1X PCR buffer; 2 mM

Mg++, 150 M dNTPs, 5 pmol of each primer (IGP553

and IGP717), 1.5 U AmpliTaq Gold. The product of the

first reaction (IGP553/554) from different independent

amplifications at different dilutions (ranging from 10-3 to

10-9) was used as template for PCR. The following PCR

touch down program was applied: 10 min at 95°C, 12

cycles of 30 s denaturation at 95°C, 30 s at 62°C (–0.5°C

for each cycle), 1 min 30 s extension at 72°C, followed

by 35 cycles of 30 s denaturation at 95°C, 30 s at 56°C,

1 min 30 s extension at 72°C. Amplified products were

resolved by electrophoresis on agarose gel.

4. RESULTS

Genetic screening for mutants in the PRNP gene of 21

positive BSE animals diagnosed in Italy in the past years,

by direct sequencing of the amplified gene fragment

using DNA extracted from brain as template, confirmed

the previous knowledge that only few polymorphisms

are present in cattle. However, some amplified PCR

products (9 out of 21) were not directly sequenced since

the signal was not clear due to the heterozygosity of the

number of octapeptide repeats. Therefore we decided to

clone the PCR product of those 9 samples and to con-

sider single clones for sequencing. The amplified frag-

ments obtained using the DNA recovered from the brain

tissue of 7 negative BSE animals of the same age as the

positive ones were cloned too and used as control. It is

noteworthy to stress that all the amplifications for both

positive and negative samples were carried out in the

same conditions: using the same reagents, the same am-

plification cycle and thermal cycler.

By sequencing a total of 90 clones of BSE positive

animals and 70 clones of BSE negative animals, we

found a highly significant difference in the frequency of

mutations (p = 0.001, Tab le 1 ). 26 out of 90 clones ana-

lysed from the BSE positive samples showed nucleotide

changes while only 4 out of 70 clones analysed from the

BSE negative samples were characterised by sequence

variations. Moreover all the mutations from the positive

BSE animals, with no amino acid changes, were ran-

domly distributed all over the full sequence, while the

mutations with amino acid changes were concentrated

mainly in the carboxy-terminal domain of the protein

(Figure 1).

So we found that DNA molecules cloned and se-

quenced from the population of the fragments amplified

from a tissue sample of 25 mg (corresponding to about 4

× 106 cells if we consider the size of the bovine brain cells

similar to the human brain cells [14]) from the positive

BSE animals contain several single nucleotide polymor-

phisms (SNP) and interestingly one of these mutations

(F209S) corresponds to a mutant which causes a familiar

form of prion disease in humans (F198S, Figure 1).

The high frequency and type of variants cannot be due

only to misincorporation and frame shift errors of the

Taq polymerase since 1) for the BSE negative samples

we reported a significantly lower variation rate (2 =

17.92, p = 0.001); 2) the distribution of the mutations

M. Busconi et al. / Agricultural Sciences 1 (2010) 39-43

Figure 1. Variations and mutations of the prion protein gene in humans (CJD) and variations and polymorphisms found in

cattle positive and negative to BSE. The mutations causing prion disease are above the line of the human sequence. Below

the lines are the polymorphisms, some but not all of which are known to influence the phenotype of disease (adapted from

17). For the bovine sequence, the variations determining amino acids changes are above the line and the polymorphisms

are below the line. Those found in BSE positive animals by direct sequencing are in green. All the bovine variations and

polymorphisms, with the exception of those in position 46 and 146, are from this work. Parentheses in the bovine se-

quences indicate corresponding human codons.

Table 1. Frequency of mutations and polymorphisms found in amplified and cloned sequences of the PRNP gene from cerebral tissue

of positive and negative BSE cattle.

Samples N° of clones sequenced N° of variants

found

Percentage of variation

9 BSE positive 90 26 28.9

7 BSE negative 70 4 5.71

with amino acid changes shows hotspot areas, the major

of which corresponding to the human gene hotspot mu-

tation area (codon 174 to 264, Figure 1); 3) all the ob-

served variants are base substitutions, with no frameshift

errors [15]; 4) if misincorporation was the only mutants

cause, there would be an even distribution of changes

in the three codon positions (1:1:1) instead of the

1.6:1.2:0.2 found in the hotspot area with a 2 of 5.2 (p =

0.1); 5) the KA/KS ratio [16], where KA is the number of

non-synonymous substitutions per non-synonymous site

(20/508.5 = 0.0393) and KS is the number of synony-

mous substitutions per synonymous site (6/283.5 =

0.0211), is greater than 1.0 (1.86).

Furthermore based on the sequence of the mutant

F209S, we designed a reverse primer and we used it in a

mutation screening on all the 21 BSE positive plus 3

negative samples. Using the genomic DNA as template

for the reaction, we replicated the PCR three times in-

dependently and obtained always the amplification of

the expected 627 bp fragment only for the sample in

which the mutation was originally found (animal n. 7)

and never on the other positives and negatives (Figure

2). The mutation screening was performed also using the

product of the first reaction (IGP553/554) at different

M. Busconi et al. / Agricultural Sciences 1 (2010) 39-43

Figure 2. Results of the PCR mutation screening for the variant F209S using the primer IGP553-IGP717. Lines

1-4: negative control with the PCR product of a BSE negative animal at serial dilutions (1: 10-6; 2: 10-7; 3: 10-8; 4:

10-9). Lines 5-8: BSE positive animal n. 15 at serial dilutions (5: 10-6; 6: 10-7; 7: 10-8; 8: 10-9). Lines 9-12: BSE

positive animal n. 7 at serial dilutions (9: 10-6; 10: 10-7; 11: 10-8; 12: 10-9). Line M: 100 bp ladder.

dilutions (ranging from 10-3 to 10-9) as template for PCR,

again we obtained the amplification only for the ex-

pected sample and never in the remaining with the ex-

ception of positive n. 15 were at some sample dilutions

the band appears (Figure 2).

Considering that different amino acid variations could

alter more or less heavily both the structure and the

functionality of the protein, we analysed the mutated

sequences with the software CODDLE (Codon Opti-

mized to Discover Deleterious Lesions, www.proweb.

org/coddle) in order to have some information about the

most putative dangerous mutations. Analysing the se-

quence of the bovine prion gene against the prion block

(IPB000817, from BLOCKS Database Version 14.3) the

software identifies the presence of five highly conserved

amino acid blocks and shows all the possible deleterious

changes according to the mutation method selected. The

analysis was repeated considering several mutation

methods and, finally, 9 out of 20 amino acid changes we

have found were considered important for the function

of the protein: N50S, M145V, Y174C, V200A, F209S,

T212A, M216T, I252F, L253P.

5. DISCUSSION

A possible explanation of the sequence variations found

in the analysed clones could be a polymerase error dur-

ing amplification or the presence of somatic cell muta-

tions in the cerebral tissue.

The first hypothesis do not explains 1) the great dif-

ference in the variation rate between positive and nega-

tive samples amplified in the same conditions and con-

sidering a similar number of clones analysed, 2) the dis-

tribution of the putative amino acid variation is very

correspondent to the distribution of human pathogenic

mutations (Figure 1) defining a main hotspot area in the

carboxy-terminal region of the protein, and 3) the use of

a selective primer designed on a mutation which corre-

spond to a pathogenic human mutation gives amplifica-

tion always in the expected sample and never in the oth-

ers (Figure 2).

Furthermore 8 out of 9 of the most dangerous putative

mutations predicted by using the software CODDLE

were grouped in the second part of the gene and this

agree with the situation found in human prion gene

where all the pathogenic mutations up to now are in the

second part of the gene (Figure 1).

To our opinion the reported data on sequence variants

can be explained with the presence of somatic mutations

modifying the PRNP gene in single cells. These somatic

mutations will usually be unnoticed because they are

surrounded by millions of normal cells, producing the

PrPSc isoform that causes disease by amplification of the

somatic genetic effect with seeding of the PrPC protein in

the surrounding cells. Somatic mutations have been as-

sumed also due to the origin of CJD [17]. Somatically

generated variations, determining a seeding point from

which the pathological form of the protein spreads

around, can produce enough protease-resistant PrPSc to

allow diagnosis of the pathology with hysto- and im-

muno-techniques. In order to investigate the role of these

somatic mutations, a higher number of animals, includ-

ing BSE negative animals both exposed and unexposed

to the risk factor will be analysed. Depending on being

an early or late event in the cerebral development, the

somatic area of the mutated cells can be limited or ex-

panse. This will be further studied coupling sequencing

and Western analysis of fine topographical sections of

BSE positive brains.

6. ACKNOWLEDGEMENTS

We wish to thank P.L. Acutis and M. Caramelli of CEA, Centro di

Referenza Encefalopatie Animali, for providing the positive samples.

This work was supported by a MIUR grant to Chelab Srl.

REFERENCES

[1] Prusiner, S.B. (1982) Novel proteinaceous infectious

M. Busconi et al. / Agricultural Sciences 1 (2010) 39-43

particles cause scrapie. Science, 216(4542), 136-144.

[2] Will, R.G. (1998) Oral infection by the bovine spongiform

encephalopathy prion. In: Brown, F., Griffiths, E., Horaud,

F. and Petricciani, J.C., Ed., Safety of Biological Products

Prepared from Mammalian Cell Culture, Karger Pub-

lishers, Basel, 79-84.

[3] Will, R.G., Alperovitch, A., Poser, S., Pocchiari, M.,

Hofman, A., Mitrova, E., de Silva, R., D’Alessandro, M.,

Delasnerie-Laupretre, N., Zerr, I. and van Duijn, C. (1998)

Descriptive epidemiology of Creutzfeldt-Jakob disease in

six European countries, 1993-1995. Annals of Neurology,

43(6), 763-767.

[4] Brown, P., Preece, M.A. and Will, R.G. (1992) “Friendly

fire” in medicine: Hormones, homografts, and Creutzfeldt-

Jakob disease. Lancet, 340(8810), 24-27.

[5] Hunter, N. (1997) PrP genetics in sheep and the impli-

cations for scrapie and BSE. Trends in Microbiology,

5(8), 331-334.

[6] Heaton, M.P., Leymaster, K.A., Freking, B.A., Hawk,

D.A., Smith, T.P.L., Keele, J.W., Snelling, W.M., Fox,

J.M., Chitko-McKown, C.G. and Laegreid, W.W. (2003)

Prion gene sequence variation within diverse groups of

US sheep, beef cattle, and deer. Mammalian Genome,

14(11), 765-777.

[7] Mastrangelo, P. and Westaway, D. (2001) The prion gene

complex encoding PrP(C) and Doppel: Insights from

mutational analysis. Gene, 275(1), 1-18.

[8] Belt, P.B., Muileman, I.H., Schreuder, B.E., Bos-de

Ruijter, J., Gielkens, A.L. and Smits, M.A. (1995) Identi-

fication of five allelic variants of the sheep PrP gene and

their association with natural scrapie. Journal of General

Virology, 76, 509-517.

[9] Neibergs, H.L., Ryan, A.M., Womack, J.E., Spooner, R.L.

and Williams, J.L. (1994) Polymorphism analysis of the

prion gene in BSE-affected and unaffected cattle. Animal

Genetics, 25(5), 313-317.

[10] Hills, D., Schlaepfer, J., Comincini, S., MacLean, I., Dolf,

G., Ferretti, L., Olsaker, I. and Williams, J.L. (2003)

Sequence variation in the bovine and ovine PRNP genes.

Animal Genetics, 34(3), 183-190.

[11] Hunter, N., Goldmann, W., Smith, G. and Hope, J. (1994)

Frequencies of PrP gene variants in healthy cattle and

cattle affected by BSE in Scotland. The Veterinary Record,

135, 400-403.

[12] Collinge, J., Sidle, K.C.L., Meads, J., Ironside, J. and

Hill, A. F. (1996) Molecular analysis of prion strain

variation and the aetiology of “new variant” CJD. Nature,

383(6602), 685-690.

[13] Casalone, C., Zanusso, G., Acutis, P.L., Ferrari, S.,

Capucci, L., Tagliavini, F., Monaco, S. and Caramelli, M.

(2004) Identification of a second bovine amyloidotic

spongiform encephalopathy: Molecular similarities with

sporadic Creutzfeldt-Jakob disease. Proceedings of the

National Academy of Sciences of the United States of

America, 101(9), 3065-3070.

[14] Kalumuck, K.E., Fallon, L.F., Jr., Piotrowski, N.A., Rizzo,

C.M.D., Carson, C.C. and Irons-Georges, T. (1998) Magill’s

medical guide. Revised Edition, Salem Press, Hacken-

sack, 221.

[15] Tindall, K.R. and Kunkel, T.A. (1988) Fidelity of DNA

synthesis by the Thermus aquaticus DNA polymerase.

Biochemistry, 27, 6008-6013.

[16] Messier, W. and Stewart, C.-B. (1997) Episodic adaptive

evolution of primate lysozymes. Nature, 385(6612), 151-

154.

[17] Prusiner, S.B. (1997) Prion diseases and the BSE crisis.

Science, 278(5336), 245-251.