J. Biomedical Science and Engineering, 2009, 2, 57-62
Published Online February 2009 in SciRes. http://www.scirp.org/journal/jbise JBiSE
1
Down regulation of surviving gene and up
regulation of p53 gene expression by siRNA
induces apoptosis in human hepatocellular
carcinoma cell line HepG2
Yun-Hua Lu 1,2,3, Cong Tang 1,2 , Wei Wang 1,2, Tao Xi 1,2*
1Research Centre of Biotechnology, China Pharmaceutical University, NanJing, 210009, China. 2JiangSu Key Laboratory of Carcinogenesis and intervention,
China Pharmaceutical University. 3School of Chemistry & Biotechnology, YiChun University, YiChun, JiangXi, 33600, China. *Correspondence should be
addressed to Yun-Hua Lu ([email protected])
Received April 16th, 2008; revised October 31st, 2008; accepted October 31st, 2008
ABSTRACT
Survivin gene may be a good target for cancer
gene therapy because it is over expressed in a
variety of human tumors including human
hepatocellular carcinoma but not in differen-
tiated adult tissues. To explore the effects of the
siRNA of survivin gene inducing apoptosis in
human hepatocellular cancer cells, three
siRNAs cpusiRNA1, cpusiRNA2 and cpusiRNA3
were designed and transferred into human
hepatocellular carcinoma cell line HepG2 (HepG2)
by lipofection. MTT test showed that the growth
of HepG2 decreased when it was transfected
with 25nM, 50nM, 100nM, 150nM, 200nM, 400nM
siRNA respectively after 48 hours. And the
change of mRNA and protein of survivin gene
and p53 gene had been detected by RT-PCR and
Western blot. Cells presented an increase in
apoptosis index was assayed by flow cytometry.
Small interfering RNA can exert a knockdown of
survivin gene expression and up regulation of
p53 gene to induce apoptosis and to inhibit the
growth of HepG2.
Keywords: RNAi, Survivin gene, p53 gene, Apop-
tosis, HepG2
1. INTRODUCTION
Hepatocellular carcinoma (HCC) was the most perni-
cious cancer with a high mortality rate. Despite the im-
provement of surgical techniques and other conditions,
the prognosis of HCC remained poor. Therefore, there is
a need for development of new therapy way to improve
the survival rate for potential use in HCC. Many studies
have shown that the survivin gene was a new member of
inhibitors of the apoptosis protein (IAP) family, which
had been implicated in both control of cell division and
inhibition of apoptosis. It was selectively overexpressed
in the majority of human tumor types including liver,
lung, breast, colon, hepatocellular, oesophageal, pancreatic,
bladder, uterine and ovarian cancers, largecell non-
Hodgkin’s lymphomas, leukaemias, neuroblastoma,
brain tumors, pheochromocytoma, soft tissue sarcomas,
melanomas and other skin cancer, but not in adult dif-
ferentiated tissues with the exception of thymus and
genital gland, and was associated with the aggressive-
ness of diseases and unfavorable outcomes[1,2,3,4,5].
Ling X et al reported that induction of survivin by taxol
in MCF-7 cells was an early event and was independent
of taxol-mediated G2/M arrest, thus suggesting a role for
survivin in taxol resistance not only during mitosis but
outside of the mitotic checkpoint as well[6]. On the basis
of these findings survivin had been proposed as an at-
tractive target for new anticancer interventions. Several
preclinical studies had demonstrated that downregulation
of survivin expression, accomplished through the use of
small interfering RNA to increase the apoptotic rate and
to reduce tumor growth potential. It could specifically
and efficiently degrade mRNA, resulting in post uctran-
scriptional gene silencing (PTGS) [7,8,9,10,11,12,13,14,
15], which was a natural mechanism in organisms un-
derlying the resistance to virus invasion and inhibition of
transposon mobility. Its blocking action on gene expres-
sion had been successfully observed in rat and human
cells cultured in vitro, and the knockdown of genes in
cells had been achieved [11,15].A study[16] had shown
that 21-25 nt small interference RNA (siRNA) could
mediate specific gene silencing in mammal cells. Being
effective and highly specific, RNAi probably becomed a
new technique in knocking gene down and plays an im-
portant role in gene therapy of diseases. Three small
interfering RNAs were designed according to the se-
quence of survivin gene and they were transferred into
human hepatocellular carcinoma cell line HepG2 by
lipofection to observe survivin and p53 gene expression
changes and their effects on cell apoptosis and growth,
SciRes Copyright © 2009
58 Y. H. Lu et al. / J. Biomedical Science and Engineering 2 (2009) 57-62
SciRes Copyright © 2009 JBiSE
which laid a foundation for further studies on the functions
of survivin gene and genetic therapy involved in HCC.
2. MATERIALS AND METHODS
2.1. Main Reagents
Trizol reagent and M-MLV were purchased from Gibco
BRL (Carlsbad, CA). Taq DNA RNA-Mate kit was
bought from Genepharma (Shanghai, China). Polyclonal
rabbit anti-human polymerase, dNTPs and DNA Marker
were obtained from Takara (Dalian City, China). sur-
vivin, p53 and β-Actin antibody were purchased from
WuHan Boster Co. (WuHan City, China).
2.2. Small Interfering RNA Design
CpusiRNA1 sense: 5’-ACUGCAGAGAAAGAGCC
dTdT-3’, cpusiRNA1 anti-sense: 5’-GGCUCUUUCUCU
GUCCAGUTT-3’; cpusiRNA2 sense: 5’-GAAUUUGAG
GAAACUGCGAdTdT-3’, cpusiRNA2 anti-sense: 5’-UC
GCAGUUUCCUAACUUACTT-3’; cpusiRNA3 sense:
5’-AGCAUUCGUCCGGUUGCGCdTdT-3’, cpusiRNA3
anti-sense: 5’-GCGCAACCGGACGAAUGCUTT-3’; Nega-
tive control cpusiRNA4 sense: 5’-UUCUCCGAAC
GUGUCACGUdTdT-3’, Negative control cpusiRNA4
anti-sense: 5’-ACGUGACACGUUCGGAGAATT-3’.
Each sense chain of siRNA oligonucleotides was added
two thymidine residues (dTdT) at the 3’ ends. After these
siRNAs having been designed, they were compared with
sequence in the human EST (expressed sequence tag)
database to confirm that no other genes were targeted,
and then they were sent to Shanghai Genepharma Co.,
Ltd (Shanghai city in China) to be synthesized.
2.3. Primers of Survivin Gene Design
After primers of survivin gene (forward primer P1:
5'CGACGTTGCCCCCTGCCTG3', reverse primer P2:
5'AAGGAAAGCGCAACCGGACGA3'), p53 gene (forward
primer P3: 5'AGCGATGGTCTGGCCCCTCC3', reverse
primer P4: 5' GCGCCGGTCTCTCCAGGA3') and
GAPDH gene (forward primer P5: 5’-ATTCAACGG CA-
CAGTCAAGG-3’, forward primer P6: 5’-GCAGAA
GGGGCGGAGATGA-3’) having been designed, they
were sent to Shanghai Sangon Biological Co. (China) to
be synthesized.
2.4. Cell Culture
Human hepatocellular carcinoma cell line HepG2 was
maintained in our laboratory. And it was grown in
RPMI-1640 supplemented with 100 mL/L fetal bovine
serum (FBS) and incubated in a humidified incubator
containing 50mL/L CO2 at 37.
2.5. Transfection
Twenty-four hours before transfection, cells were
trpsinized, diluted in fresh media without antibiotics and
transferred to 96-well and 6-well plates, These cells
grown to a confluency of 50%-60% were transfected
with 0, 25 nmol/L, 50 nmol/L, 100 nmol/L, 200 nmol/L
and 400 nmol/L of siRNA cpusiRNA1, cpusiRNA2 and
cpusiRNA3 per well using RNAi-Mate media according
to manufacturer’s recommendations.
2.6. MTT Assay
HepG2 cell (5×103) was placed into every well of 96-
well plate with 180μL culture medium RPMI-1640 con-
taining 10% NBS. After the cell having been incubated
at 37for 24 hours, 20μL siRNA cpusiRNA1,
cpusiRNA2 and cpusiRNA3 with increasing concentrations
0, 25 nmol/L, 50 nmol/L, 100 nmol/L, 200 nmol/L and
400 nM was added to every well respectively. When the
cell had been incubated at 37 for 44h, cell prolifera-
tion was assessed by MTT, After the cell having been
incubated for 4 h, the reaction was stopped by the addi-
tion of 150 μL DMSO, After 30 min incubation and
shaking, the absorbency of the samples was determined
at 490 nm(A 490).
2.7. RT-PCR
Total RNA was extracted from HepG2 cell using Trizol
reagent (Gibco BRL) according to the manufacturer’s
instructions. Complementary DNA (cDNA) was gener-
ated from total RNA using M-MLV. PCR of cDNA was
performed in a final volume of 50 μL containing 4μL of
4×dNTPs, 2 units of Taq DNA polymerase, and 20
mmol/L of each primer. The samples were amplified 35
cycles at 94 for 30 s, at 58 for 30 s, and at 72 for 50 s, and
finally at 72 for 10 min. Amplification of human GAPDH
served as a control for a sample loading and integrity. the
length of amplified fragments of survivin gene P53 and
GAPDH gene were 250 bp, 306 bp and 213 bp.
2.8. Western Blot
The cells were washed twice with cold PBS and were
lysed in radioimmunoprecitation assay buffer [50
mmol/L of Tris (pH 7.4), 150 mmol/L NaCl, 1% Triton
X-100, 1% deoxycholic phenylmethyl-sulfonyl fluoride,
1μg/ml of aprotinin, and 1 mmol/L of DTT] for 10min
and scraped. The extracts were centrifuged at 4000 g at
4 for 15min. Protein (100 μg) were resolved by so-
dium dodecyl sulfatepolyacry-lamide gel electrophoresis
(SDS-PAGE) and transferred to nitrocellulose mem-
branes (Sigma Co., Ltd in USA). After blocking with 5%
skim milk in Tris-HCl (pH 7.5) at room temperature for
2h, the nitrocellulose membranes were reacted for 2h
with specific antibodies in the same blocking solution.
After extensive washing with Tris-HCl containing 0.05%
Tween 20, the membrances were reacted with rabbit
anti-human polyclonal antibody for Survivin, p53 and
β-Actin protein detection.
2.9. Flow Cytometric Analysis
Cell cycle distributions were determined by measuring
the cellular DNA content using flow cytometry (BD
Biosciences Clontech, Palo Alto, CA). Cells were
washed with PBS twice, fixed with 700 mL/L ethanol
for 20 min and stored at 4 overnight, then washed
with PBS twice, and stained with 100 μL of 50 mg/L PI
Y. H. Lu et al. / J. Biomedical Science and Engineering 2 (2009) 57-62 59
SciRes Copyright © 2009 JBiSE
Figure 1. HepG2 cells transfected with siRNA. A-C HepG2 cells transfected with 50 nM nM of siRNA cpusiRNA1,
cpusiRNA2 and cpusiRNA3 after 48 hours. D-F HepG2 cells transfected with 100 nM of siRNA cpusiRNA1, cpusiRNA2
and cpusiRNA3 after 48 hours. G-I HepG2 cells transfected with 200 nM of siRNA cpusiRNA1, cpusiRNA2 and cpusiRNA3
after 48 hours. J-L HepG2 cells transfected with 400 nM of siRNA cpusiRNA1, cpusiRNA2 and cpusiRNA3 after 48 hours.
M HepG2 cells transfected with 200 nM of siRNA cpusiRNA4 after 48 hours. N Untransfected HepG2 cells.
at 4 for 30min. Apoptotic cells were assayed using
the Elite ESP flow cytometry at 488nm, and data were
analyzed with the WinMID2.9 software.
2.8. Statistical Analysis
Data were expressed as mean ± SD. Statistical significance
was determined by the Students’ t-test. P<0.05 was con-
sidered statistically significant.
3. RESULTS
3.1. Change of Cellular Morphology
After the cells were transfected with 0, 50nM, 100nM,
200nM and 400nM of siRNA cpusiRNA1, cpusiRNA2
and cpusiRNA3 respectively for 48 h, The cellular mor-
phology of HepG2 cells had changed greatly, such as the
volume of cell changing small, the cellular morphology
becoming irregularity, cell shrinking, and nucleus
pycnosis. But the cellular morphology of control cells
was normal (Figure 1).
3.2. Cellular Proliferation
The number of the cells became small when the cells
were tranfected with 0, 25nM, 50nM, 100nM, 200nM
and 400nM of siRNA cpusiRNA1, cpusiRNA2 and
cpusiRNA3 respectively after 48 hours, and the inhibi-
tion effect to the HepG2 fade up in evidence. But the
negative control cpusiRNA4 have no evident effect on
the growth of HepG2 cells. The inhibition rate was
determined by MTT assay as Table 1. And tumor
curative Cisplatin was used as positive control to in-
hibit the growth of HepG2 cells 10μM, 20μM, 40μM,
80μM and 160μM. The inhibition rate was determined
by MTT assay as Table 1 and 2. The IC50 of the
cpusiRNA2 and cpusiRNA3 to the HepG2 cells is
88.1nM, 89.2nm, while the IC50 of Cisplatin is 32.1μM
which is about 365 times higher than that of
cpusiRNA2 and cpusiRNA3.
Table 1. Effects of siRNA and Cisplatin on the growth of HepG2
cells determined by MTT assay (n =6), (mean ± SD)
siRNA 025nM50nM 100nM200nM
cpusiRNA1(%) 0 17.2±2.6 36.6±4.2 50.2±3.7 66.3±3.8
cpusiRNA2(%) 0 16.8±2.5 33.9±4.2 54.5±3.7 75.3±5.2
cpusiRNA3(%) 0 10.5±3.4 20.3±3.9 41.7±3.6 61.5±4.2
Cisplatin 010μM20μM 40μM 80μM
Cisplatin(%)0 16.1±3.8 42.4±4.3 83.1±4.1 92.7±3.9
A
B
C F
D
E
G
H
I
JM
K
L
N
60 Y. H. Lu et al. / J. Biomedical Science and Engineering 2 (2009) 57-62
SciRes Copyright © 2009 JBiSE
Table 2. The curve of the effects of siRNA and Cisplatin on the growth of HepG2 cells
3.3. Change of the Survivin and p53 mRNA
Figure 2. RT-PCR show the change of survivin and p53
mRMA. 1 HepG2 cells transfected with 200 nM of siRNA
cpusiRNA4 after 48 hours; 2 Untransfected HepG2 cells;
3. 4. 5. HepG2 cells transfected with 100 nM of siRNA
cpusiRNA1, cpusiRNA2 and cpusiRNA3 after 48 hours
Four-eight hours after the transfection of survivin
siRNA, the semi-quantitative reverse transcription polymerase
chain reaction amplified 250 bp fragment of survivin
gene, 306 bp fragment of p53 gene and 213 bp fragment
of GAPDH gene as Figure 2. The result suggested not
only that the mRNA of survivin gene declined, but also
that the mRNA of p53 gene increased when the cells
were transfected with 100 nM of siRNA cpusiRNA1,
cpusiRNA2 and cpusiRNA3 at 48 h in HepG2 cells
(Figure 2).
3.4. Change of the Survivin and p53 Protein
After four-eight hours treatment of siRNA, the Western
blot showed that the amount of survivin protein reduced
with suppression of the survivin mRNA, and that the
expression of p53 gene up-regulated because of increas-
ing of p53 mRNA when HepG2 cells were transfected
with 100 nM of siRNA after 48 hours as Figure 3.
3.5. Flow Cytometry Analysis
After the HepG2 cells were transfected with 100nM of
siRNA cpusiRNA4, cpusiRNA1, cpusiRNA2 and
Figure 3. Western blot showed the change of survivin
and p53 protein. 1. HepG2 cells transfected with 100 nM
of siRNA cpusiRNA4 after 48 hours; 2. Untransfected
HepG2 cells; 3. 4. 5. HepG2 cells transfected with 100
nM of siRNA cpusiRNA1 cpusiRNA2 and cpusiRNA3 af-
ter 48 hours
cpusiRNA3 respectively, flow cytometry analysis of
their cell cycle displayed that the cells transfected with
100nM of siRNA cpusiRNA1, cpusiRNA2 and
cpusiRNA3 respectively with a marked reduction in
G2/M phase by 8.3%, 16.2% and 21.5%, the apoptosis
index was as high as 13.4%, 26.6% and 32.1%. And the
control groups transfected with 200nM of siRNA
cpusiRNA4 is almost the same as the untransfected
HepG2 (Figure 4).
4. DISCUSSION
Tumorigenesis is a multiple factor course. The high ex-
pressed inhibited-apoptosis genes in tumor cells can
suppress apoptosis and make tumor cells avoid to be
cleared and identified by the immunity system. More-
over, the inhibited apoptosis genes can also play a role
during the course of drug resistance of tumor cells. Sur-
vivin provides a new research direction to cancer therapy
for itscharacters of high conservation and only expres-
sion in tumor cells. Small interfering RNA technology
possesses a high ability to specifically silence particular
genes. Therefore, it can be used as a powerful tool in
researches on the functions of genes and genetic therapy
for carcinoma. Attention has been paid to RNAi in the
field of researches on gene functions.
In our study, the result of MTT assay demonstrated
that the chemically synthesized siRNA cpusiRNA1,
cpusiRNA1 cpusiRNA2 cpusiRNA3
90%
80%
70%
60%
50%
40%
30%
20%
10%
0%
100%
90%
80%
70%
60%
50%
40%
30%
20%
10%
0%
Cisplatin
25nM
0 50nM 100nM 200nM 400nM
0 0μm 20μm 40μm 80μm 160μm
1 2 3 4 5
GAPDH
p53
Survivin
123 4 5
β-actin
p53
Survivin
Y. H. Lu et al. / J. Biomedical Science and Engineering 2 (2009) 57-62 61
SciRes Copyright © 2009 JBiSE
Figuer 4. Result of cell cycle detected by flow cytometry. 1 HepG2 cells transfected with 200 nM of siRNA cpusiRNA4
after 48 hours; 2 Untransfected HepG2 cells; 3 HepG2 cells transfected with 200 nM of siRNA cpusiRNA1 after 48 hours;
4 HepG2 cells transfected with 200 nM of siRNA cpusiRNA2 after 48 hours; 5 HepG2 cells transfected with 200 nM of
siRNA cpusiRNA3 after 48 hours
cpusiRNA2 and cpusiRNA3 can effectively inhibit the-
growth of the HepG2 cells. Their IC50 to the HepG2 cells
is about 1/187, 1/232 and 1/127 less than that of Cis-
platin. The result of RT-PCR demonstrated not only that
survivin gene was exerted a knockdown, but also that the
mRNA of p53 gene increased at the level of transcription
when the cells were transfected with 100 nM of siRNA
cpusiRNA1, cpusiRNA2 and cpusiRNA3 at 48 h in
HepG2 cells. The result of Western blot demonstrated
that survivin gene was exerted a knockdown and p53
gene was up-regulation in HepG2 cells at the level of
protein. Flow cytometry analysis revealed that the
HepG2 cells transfected with the siRNA cpusiRNA1,
cpusiRNA2 and cpusiRNA3 presented an obvious AP
peak, a marked reduction in G2/M phase and an increase
in apoptosis index compared to the control groups. We
also observed that HepG2 cells transfected with the siRNA
cpusiRNA1, cpusiRNA2 and cpusiRNA3 grew slowly,
as compared with the control groups. The above men-
tioned findings confirm that chemically synthesized
siRNAs can specifically block survivin gene expression,
induce cell apoptosis, and inhibit the growth of carci-
noma cells.
The results of our study not only confirm that the in-
hibitory activity of survivin gene on the growth of hu-
man hepatocellular carcinoma cell line HepG2 could be
realized by inducing cell apoptosis, but also confirm that
the survivin gene interfering on the growth of human
hepatocellular carcinoma cell line HepG2 could up-
regulate p53 gene expression to inhibit the growth of
HepG2 cells. Besides, RNAi alone could block survivin
gene expression to induce a remarkable increase in cell
apoptosis. This unique effect of survivin provides new
evidence for its antiapoptotic effects on HepG2. In
summary, survivin gene can be regarded as a very good
target gene in genetic therapy for carcinomas. RNAi of
survivin gene is a promising approach in treating carci-
nomas.
REFERENCES
[1] H. Caldas, L. E. Honsey and R. A. Altura. (2005) Survivin a novel
Survivin splice variant expressed in malignancies. Mol Cancer,
4(1): 11-23.
[2] W. Salz, D. Eisenberg and J. Plescia. (2005) A survivin gene
signature predicts aggressive tumor behavior. Cancer Res, 65:
3531-3534.
[3] T. Liu and D. Grossman. (2004) Rapid induction of mitochondria
events and caspase-independent apoptosis in Survivin-targeted
melanoma cells. Oncogene, 23 (1): 39-48.
[4] M. Stevenson. (2004) Therapeutic potential of RNA interference.
N Engl J Med, 351 (17): 1772-1777.
[5] D. C. Altieri; (2003) Survivin versatile modulation of cell division
and apoptosis in cancer. Oncogene, 22: 8581–8589.
[6] X. Ling, R. J. Bernacki, M. G. Brattain and F. Li. (2004) Induction
of survivin expression by taxol (paclitaxel) is an early event,
which is independent of taxol-mediated G2/M arrest. J Biol Chem;
256
Events
0
1 23
4 5
FL2-A FL2-A FL2-A
FL2-A
256
Events
0
256
Events
0
128
Events
0
128
Events
0
0 1023 0 10230 1023
0 1023 0 1023
FL2-A
62 Y. H. Lu et al. / J. Biomedical Science and Engineering 2 (2009) 57-62
SciRes Copyright © 2009 JBiSE
279: (5)196-203.
[7] C. D. Novina and P. A. Sharp. (2004) The RNAi revolution. Na-
ture, 430(6996): 161-164.
[8] P. D. Zamore. (2002) Ancient pathways p rogrammed by small
RNAs. Science, 296 (5571): 1265-1269.
[9] G. J. Hannon. (2002) RNA interference. Nature, 418: 2442-2511.
[10] M. Pennati, M. Binda, M. De Cesare, G. Pratesi, M. Folini, L.
Citti, M. G. Daidone, F. Zunino and N. Zaffaroni. (2004) Ri-
bozyme-mediated down-regulation of survivin expression sensi-
tizes human melanoma cells to topotecan in vitro and in vivo.
Carcinogenesis; 25: 1129-1136.
[11] M. Izquierdo. (2005) Short interfering RNAs as a tool for cancer
gene therapy. Cancer Gene Ther, 12: 217-227.
[12] M. Kappler, M. Bache, F. Bartel, M. Kotzsch, M. Panian, P. Wurl,
K. Blumke, H. Schmidt, A. Meye and H. Taubert. (2004) Knock-
down of survivin expression by small interfering RNA reduces
the clonogenic survival of human sarcoma cell lines independ-
ently of p53. Cancer Gene Ther, 11: 186-193.
[13] M .Kappler, H. Taubert, F. Bartel, K. Blumke, M. Panian, H.
Schmidt, J. Dunst and M. Bache. (2005) Radiosensitization, after
a combinedtreatment of survivin siRNA and irradiation, is cor-
related with the activation of caspases 3 and 7 in a wtp53 sar-
coma cell line, but not in a mt-p53 sarcoma cell line. Oncol Rep,
13: 167-172.
[14] M. Chawla-Sarkar, S. I. Bae, F. J. Reu, B. S. Jacobs, D. J. Lindner
and E. C. Borden. (2004) Downregulation of Bcl-2, FLIP or IAPs
(XIAP and survivin) by siRNAs sensitizes resistant melanoma
cells to Apo2L/TRAIL-induced apoptosis. Cell Death Differ, 11:
915-923.
[15] S. Coma, V. Noe, C. Lavarino, J. Adan, M. Rivas, M. Lo-
pez-Matas, R. Pagan, F. Mitjans, S. Vilaro, J. Piulats and C. J.
Ciudad; (2004) Use of siRNAs and antisense oligonucleo -tides
against survivin RNA to inhibit steps leading to tumor angiogene-
sis. Oligonucleotides, 14: 100-113.
[16] S. M. Elbashir, W. Lendeckel and T. Tuschl. (2002) RNA inter-
ference is mediated by 21-and 22-nucleotide RNAs. Genes Dev,
15: 188-200.
[17] Corresponding author; Prof. Xi Tao, Research Centre of Biotech-
nology, China Pharmaceutical University, NanJing, 210009,
China.