Materials Sciences and Applications, 2010, 2, 13-18
doi:10.4236/msa.2010.11003 Published Online April 2010 (http://www.SciRP.org/journal/msa)
Copyright © 2010 SciRes. MSA
13
Medpor® Acts on Stem Cells Derived from
Peripheral Blood
Vincenzo Sollazzo1, Annalisa Palmieri2, Ambra Girardi3, Francesca Farinella2,
Giorgio Brunelli2, Giuseppe Spinelli4, Francesco Carinci3
1Orthopedic Clinic, University of Ferrara, Ferrara, Italy; 2Department of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy;
3Department of Histology, Embryology and Applied Biology, University of Bologna, Bologna, Italy; 4Department of Maxillofacial
Surgery, Careggi Hospital, Firenze, Italy.
Received February 9th, 2010; revised March 11th, 2010; accepted March 15th, 2010.
ABSTRACT
Porous polyethylene (PP or Medpor®) is an alloplastic material used worldwide for craniofacial reconstruction. Al-
though several clinical studies are available, how this material alters osteoblast activity to promote bone formation is
poorly understood. To study how PP can induce osteoblast differentiation in mesenchymal stem cells, the expression
levels of bone related genes and mesenchymal stem cells marker were analyzed, using real time Reverse Transcrip-
tion-Polymerase Chain Reaction. PP causes induction of osteoblast transcriptional factor RUNX2 and of the bone re-
lated genes osteocalcin (BGLAP) and alkaline phosphatase (ALPL). In contrast the expression of ENG was decreased
in stem cells treated with PP respect to untreated cells, indicating the differentiation effect of this biomaterial on stem
cells. The obtained results can be relevant to better understand the molecular mechanism of bone regeneration and as a
model for comparing other materials with similar clinical effects.
Keywords: Alloplastic Material, Porous Polyethylene, Gene Expression, Stem Cells
1. Introduction
Craniofacial “skeletal” defects should be ideally correc-
ted with autologous bone or cartilage. However, collect-
ing an adequate amount of bone from other donor sites of
the same patient is not always possible, it carries addi-
tional morbidity and it determines prolonged operation
time. On the contrary, homologue bank tissues and ani-
mal derived products are not completely safe because
unknown diseases can be potentially transferred. Conse-
quently, alloplastic materials are used for craniofacial
reconstruction. Among them, porous polyethylene (PP or
Medpor®) has been extensively used since the nineties.
Its properties make it an excellent choice for correcting
cranial and facial defects. The implant is easy to shape,
flexible, remarkably stable, and it exhibits rapid soft-
tissue growth.
PP has been used to repair cranial defects [1,2], to re-
store facial deformities [3], to reconstruct both ear [4]
and orbit [5], as spherical orbital prostheses [6], to cor-
rect lower eyelid retraction [7] and to restore nasal func-
tion and shape [8]. Reported complications are persistent
pain and anesthesia, implant exposure, infection and sub-
sequent graft removal.
Although several studies have analyzed applications
and risk factors associated with the use of this synthetic
graft, there is a lack as regards research into genetic ef-
fects.
In previous studies by using cDNA microarray contai-
ning 19,200 genes, we identified in osteoblast-like cell
lines (i.e. MG-63) cultured on PP, several genes where
expression were differentially regulated. The differentia-
lly expressed genes cover a broad range of functional
activities: 1) signal transduction, 2) transcription, 3)
translation, 4) cell cycle regulation, 5) vesicular transport,
and 6) production of cytoskeletal elements, cell-adhesion
molecules and extracellular matrix components [9]. We
therefore investigated, by using microRNA microarray
techniques, the translation regulation in osteoblasts expo-
sed to PP. We identified miRNA that regulates the tra-
nsduction of genes related to bone formation (OSTF1),
skeletal development (CHRD, EN1, ADAMTS4, GHR-
HR) and cartilage remodeling (MGP, NOG, LECT1,
PTH) [10].
Since PP is always fixed onto bone and the mechanism
by which PP acts on osteoblasts is incompletely known,
we therefore attempted to get more inside by using hu-
man stem cells isolated from peripheral blood.
Medpor® Acts on Stem Cells Derived from Peripheral Blood
14
Because no reports analyze the genetic effects of PP
on stem cells, the expression of genes related to the os-
teoblast differentiation were analyzed using cultures of
human mesenchymal stem cells derived from peripheral
blood (PB-hMSCs) treated with PP.
To investigate the osteogenic differentiation of PB-
hMSCs, the quantitative expression of the mRNA of spe-
cific genes, like transcriptional factor (RUNX2), bone re-
lated genes (SPP1, COL1A1, COL3A1, BGLAP, ALPL,
and FOSL1) and mesenchymal stem cells marker (ENG)
were examined by means of real time Reverse Transcrip-
tion-Polymerase Chain Reaction (real time RT-PCR).
2. Materials and Methods
2.1 Stem Preparation
PB-hMSCs were obtained for gradient centrifugation fr-
om peripheral blood of healthy anonymous volunteers,
using the Acuspin System-Histopaque 1077 (Sigma Al-
drich, Inc., St Louis, Mo, USA). Firstly, 30 ml of heap-
rinizated peripheral blood were added to the Acuspin Sy-
stem-Histopaque 1077 tube and centrifugated at 1000 × g
for 10 minutes. After centrifugation the interface contain-
ing mononuclear cells was transferred in another tube,
washed with PBS and centrifugated at 250 × g per 10
minutes. The enriched mononuclear pellets was resus-
pended in 10 ml of Alphamem medium (Sigma Aldrich,
Inc., St Louis, Mo, USA) supplemented with antibiotics
(Penicillin 100 U/ml and Streptomycin 100 micro-
grams/ml - Sigma, Chemical Co., St Louis, Mo, USA)
and amminoacids (L-Glutamine - Sigma, Chemical Co.,
St Louis, Mo, USA). The cells were maintained in a 5%
CO2 humidified atmosphere at 37. Medium was
changed after 24 hours. PB-hMSC were selected for ade-
sivity and characterized for staminality by immunoflo-
rescence.
2.2 Immunofluorescence
Cells were washed with PBS for three times and fixed
with cold methanol for 5 min at room temperature. After
washing with PBS, cells were blocked with bovine albu-
min 3% (Sigma Aldrich, Inc., St Louis, Mo, USA) for 30
min at room temperature. The cells were incubated over-
night sequentially at 4 with primary antibodies raised
against CD105 1:200, mouse (BD Biosciences, San Jose,
CA, USA), CD73 1:200, mouse (Santa Cruz Biotecnol-
ogy, Inc., Santa Cruz, CA, USA), CD90 1:200, mouse
(Santa Cruz Biotecnology, Inc., Santa Cruz, CA, USA),
CD34 1:200, mouse (Santa Cruz Biotecnology, Inc.,
Santa Cruz, CA, USA). They were washed with PBS and
incubated for 1 h at room temperature with secondary
antibody conjugated-Rodamine goat anti-mouse 1:200
(Santa Cruz Biotecnology, Inc., Santa Cruz, CA, USA).
Subsequently, cells were mounted with the Vectashield
Mounting Medium with DAPI (Vector Laboratories, Inc.,
Burlingame, CA, USA) and observed under a fluores-
cence microscope (Eclipse TE 2000-E, Nikon Instru-
ments S.p.a., Florence, Italy).
2.3 Cell Culture
PB-hMSCs at fourth passage were cultured in Alphamem
medium (Sigma Aldrich, Inc., St Louis, Mo, USA) sup-
plemented with 10% fetal calf serum, antibiotics (Peni-
cillin 100 U/ml and Streptomycin 100 micrograms/ml -
Sigma Aldrich, Inc., St Louis, Mo, USA) and ammino-
acids (L-Glutamine - Sigma Aldrich, Inc., St Louis, Mo,
USA). The cells were maintained in a 5% CO2 humidi-
fied atmosphere at 37. For the assay, cells were coll-
ected and seeded at a density of 1 × 105 cells/ml into 9
cm2 (3 ml) wells by using 0.1% trypsin, 0.02% EDTA in
Ca++ – and Mg – free Eagle’s buffer for cell release.
In one set of wells a sheet of Medpor® (Porex Corpo-
ration, Fairburn, Georgia, USA) was placed on the bot-
tom leaving cells growing on it for 7 days.
Another set of wells containing untreated cells was
used as control. The medium was changed every 3 days.
After seven days, when cultures were sub-confluent,
cells were processed for RNA extraction.
2.4 RNA Processing
Reverse transcription to cDNA was performed directly
from cultured cell lysate using the TaqMAn Gene Ex-
pression Cells-to-Ct Kit (Ambion Inc., Austin, TX, USA),
following manufacturer's instructions. Briefly, cultured
cells were lysed with lysis buffer and RNA released in this
solution. Cell lysate were reverse transcribed to cDNA
using the RT Enzyme Mix and appropriate RT buffer
(Ambion Inc., Austin, TX, USA).
Finally the cDNA was amplified by real-time PCR usi-
ng the included TaqMan Gene Expression Master Mix
and the specific assay designed for the investigated genes.
2.5 Real Time PCR
Expression was quantified using real time RT-PCR. The
gene expression levels were normalized to the expression
of the housekeeping gene RPL13A and were expressed as
fold changes relative to the expression of the untreated
PB-hMSCs. Quantification was done with the delta/ delta
calculation method [11].
Forward and reverse primers and probes for the selected
genes were designed using Primer Express Software (Ap-
plied Biosystems, Foster City, CA, USA) and are listed in
Table 1.
All PCR reactions were performed in a 20 µl volume
using the ABI PRISM 7500 (Applied Biosystems, Foster
City, CA, USA). Each reaction contained 10 µl 2X
TaqMan universal PCR master mix (Applied Biosystems,
Foster City, CA, USA), 400 nM concentration of each
primer and 200 nM of the probe, and cDNA. The ampli-
fication profile was initiated by 10-minute incubation at
Copyright © 2010 SciRes. MSA
Medpor® Acts on Stem Cells Derived from Peripheral Blood
Copyright © 2010 SciRes. MSA
15
95, followed by two-step amplification of 15 seconds
at 95 and 60 seconds at 60 for 40 cycles. All ex-
periments were performed including non-template con-
trols to exclude reagents contamination. PCRs were per-
formed with two biological replicates.
3. Results
PB-hMSCs were characterized by immunofluorescence.
The cell surfaces were positive for mesenchymal stem cell
marker, CD105, CD90 and CD73 and negative for mark-
ers of hematopoietic origin, CD34 (Figure 1).
Transcriptional expressions of several osteoblast-rela-
ted genes (RUNX2, SPP1, COLIA1, COL3A1, BGLAP,
ALPL and FOSL1) and mesenchymal stem cells marker
(ENG) were examined after 7 days of treatment with PP.
Quantitative real-time RT–PCR of RUNX2, ALPL and
BGLAP showed a significant induction after treatment
with PP.
Table 1. Primer and probes used in real time PCR
Gene symbol Gene name Primer sequence (5’ > 3’) Probe sequence (5’ > 3’)
SPP1 osteopontin F-GCCAGTTGCAGCCTTCTCA
R-AAAAGCAAATCACTGCAATTCTCA CCAAACGCCGACCAAGGAAAACTCAC
COL1A1 collagen type I alpha1 F-TAGGGTCTAGACATGTTC AGCTTTGT
R-GTGATTGGTGGGATGTCTTCGT CCTCTTAGCGGCCACCGCCCT
RUNX2 runt-related transcription
factor 2
F-TCTACCACCCCGCTGTCTTC
R-TGGCAGTGTCATCATCTGAAATG ACTGGGCTTCCTGCCATCACCGA
ALPL alkaline phospatasi F-CCGTGGCAACTCTATCTTTGG
R-CAGGCCCATTGCCATACAG CCATGCTGAGTGACACAGACAAGAAGCC
COL3A1 collagen, type III, alpha 1 F-CCCACTATTATTTTGGCACAACAG
R-AACGGATCCTGAGTCACAGACA ATGTTCCCATCTTGGTCAGTCCTATGCG
BGLAP osteocalcin F-CCCTCCTGCTTGGACACAAA
R-CACACTCCTCGCCCTATTGG CCTTTGCTGGACTCTGCACCGCTG
CD105 endoglin F-TCATCACCACAGCGGAAAAA
R-GGTAGAGGCCCAGCTGGAA TGCACTGCCTCAACATGGACAGCCT
FOSL1 FOS-like antigen 1 F-CGCGAGCGGAACAAGCT
R-GCAGCCCAGATTTCTCATCTTC ACTTCCTGCAGGCGGAGACTGACAAAC
RPL13A ribosomal protein L13 F-AAAGCGGATGGTGGTTCCT
R-GCCCCAGATAGGCAAACTTTC CTGCCCTCAAGGTCGTGCGTCTG
Figure 1. PB-hMSCs by indirect immunofluorescence (Rodamine). Cultured cells were positive for the mesenchymal stem cell
marker CD73 (b), CD90 (c), CD105 (d) and negative for the hematopoietic markers CD34 (a). Nucleuses were stained with
DAPI. Original magnification × 40
Medpor® Acts on Stem Cells Derived from Peripheral Blood
16
However, PP treatment did not affect the mRNA ex-
pression of SPP1 and FOSL1 that were similarly in both
treated and untreated PB-hMSCs. COL1A1 and COL3A1
were decreased in the presence of PP at day 7 like the
stem cell marker ENG (Figure 2).
4. Discussion
Although autologous bone and cartilage grafts are the go-
ld standard for craniofacial reconstruction, they carry ad-
ditional morbidity related to the second operation field
and to prolonged operation time. Moreover, bone grafts
resorb in a way that is not predictable. Consequently, all-
oplastic materials have a specific role in craniofacial re-
construction especially because they are safer with respe-
ct to homologue bank tissues and animal derived produ-
cts which can potentially transfer diseases of unknown
etiology.
PP is a pure polyethylene with a unique manufacturing
process and pore size. Technically, it is easy to work
with; it can be carved, contoured, adapted, and fixed to
obtain a precise three-dimensional shape. Physically, it is
a pure, biocompatible, strong substance that does not
resorb or degenerate. It demonstrates long-term stability,
high tensile strength, and a virtual lack of surrounding
soft-tissue reaction.
Several papers have shown PP effectiveness in restor-
ing craniofacial defects [1-8]. Few complications have
been reported, such as: persistent pain, paresthesia, im-
plant exposure, infection and subsequent graft removal.
Although several studies have analyzed the applica-
tions and risk factors associated with the use of this syn-
thetic graft, there is a lack as regards its genetic effects.
In order to get more inside how PP acts on PB-hMSCs,
changes in expression of bone related marker genes
(RUNX2, SPP1, COLIA1, COL3A1, BGLAP, ALPL and
FOSL1) and mesenchymal stem cells marker (ENG)
were investigated by real-time RT–PCR.
Figure 2. Gene expression analysis of PB-hMSCs after 7
days of treatment with PP
Mesenchymal stem cells are defined as self-renewable,
multipotent progenitor’s cells with the ability to differen-
tiate, under adequate stimuli, into several mesenchymal
lineages, including osteoblasts [12].
In our study, mesenchymal stem cells from human pe-
ripheral blood were isolated and characterized by mor-
phology and immunophenotype. Isolated PB-hMSCs sho-
wed fibroblast-like morphology and were positive for
MSC surface molecules (CD90, CD105, CD73) and neg-
ative for markers of haematopoietic progenitors (CD34).
After 7 days of treatment with PP the expression levels
of osteodifferentiation genes were measured by relative
quantification methods using real-time RT–PCR.
ENG (CD105), a surface markers used to define a
bone marrow stromal cell population capable of multi-
lineage differentiation [13], was down-regulated in tre-
ated PB-hMSCs respect to control, indicating the differ-
entiation effect of this biomaterial on stem cells. There is
an inverse correlation between CD105 expression and the
differentiation status of MSC [14]. This gene is a receptor
for TGF-β1 and -β3 [15] and modulates TGF-β signaling
by interacting with related molecules, such as TGF-β1,
-β3, BMP-2, -7, and activin A. It is speculated that these
members of the TFG-β superfamily are mediators of cell
proliferation and differentiation and play regulatory roles
in cartilage and bone formation [16]. The disappearance
of the CD105 antigen during osteogenesis suggests that
this protein, like others in the TFG-β superfamily, is in-
volved in the regulation of osteogenesis [17].
Expression of transcription factor RUNX2 was up-
regulated in treated cells respect to control after 7 days of
treatment with PP. RUNX2 is the most specific osteob-
last transcription factor and is a prerequisite for osteo-
blast differentiation and consequently mineralization.
PB-hMSCs treated with PP showed a high expression
of ALPL compared to untreated cells. Thus we demonstr-
ated that PP increases the activity of ALPL gene, which
is a key point in osteodifferentiation.
BGLAP, a bone specific protein involved in minerali-
zation and bone resorption, that is generally express by
osteoblast in the early stage of their differentiation [18]
was significantly up-regulate in treated PB-hMSCs.
Another investigated gene was FOSL1 that encodes for
Fra-1, a component of the dimeric transcription factor
activator protein-1 (Ap-1), which is composed mainly of
Fos (c-Fos, FosB, Fra-1 and Fra-2) and Jun proteins
(c-Jun, JunB and JunD).
AP-1 sites are present in the promoters of many de-
velopmentally regulated osteoblast genes, including alka-
line phosphatase, collagen I, osteocalcin.
McCabe et al. [19] demonstrated that differential expr-
ession of Fos and Jun family members could play a role
in the developmental regulation of bone-specific gene
expression and, as a result, may be functionally signifi-
Copyright © 2010 SciRes. MSA
Medpor® Acts on Stem Cells Derived from Peripheral Blood17
cant for osteoblast differentiation.
In our study FOSL1 was down-regulated, probably
because cells were at early stage of differentiation. Kim
et al. [20] studying the effect of a new anabolic agents
that stimulate bone formation, find that this gene is acti-
vated in the late stage of differentiation, during the cal-
cium deposition.
SSP1 encodes osteopontin, which is a phosphoglyco-
protein of bone matrix and it is the most representative
non collagenic component of extracellular bone matrix
[21].
Osteopontin is actively involved in bone resorbitive
processes directly by ostoclasts [22]. Osteopontin pro-
duced by osteoblasts, show high affinity to the molecules
of hydroxylapatite in extracellular matrix and it is che-
mo-attractant to osteoclasts [23]. However, in our expe-
rimental model, SPP1 expression during osteogenic in-
duction was similar in both treated and control because
this gene regulates the later stages of osteoblast differen-
tiation and bone development [22]. This result is not in
contrast with those previously reported as we investi-
gated stem cells treated for 7 days.
PP also modulates the expression of genes encoding
for collagenic extracellular matrix proteins like collagen
type 1α1 (COL1A1). Collagen type1 is the most abun-
dant in the human organism [24].
COL1A1 and COL3A1 were significantly down ex-
pressed as compared to the control when exposed to PP
probably because these genes are activated in the late
stage of differentiation and are related to extracellular
matrix synthesis.
COL3A1 encodes the pro-alpha1 chains of type III col-
lagen, a fibrillar collagen that is found in extensible con-
nective tissues [25].
The present study shows the effect of PP on PB-hM-
SCs in the early differentiation stages: PP is an inducer of
osteogenesis on human stem cells, as demonstrated by
the expression of bone related genes like RUNX2, ALPL
and BGLAP. Moreover, we have chosen to perform the
experiment after 7 days in order to get information on the
early stages of stimulation. It is our understanding, there-
fore, that more investigations with different time points
are needed in order to get a global comprehension of the
molecular events related to PP action. The reported mo-
del is useful to investigate the effects of different sub-
stances on stem cells.
5. Acknowledgments
This work was supported by FAR from the University of
Ferrara (FC), Ferrara, Italy, and from Regione Emilia
Romagna, Programma di Ricerca Regione Università,
2007-2009, Area 1B: Patologia osteoarticolare: ricerca
pre-clinica e applicazioni cliniche della medicina rigen-
erativa, Unità Operativa n. 14.
REFERENCES
[1] T. Wellisz, W. Dougherty and J. Gross, “Craniofacial
Applications for the Medpor Porous Polyethylene Flex-
block Implant,” Journal of Craniofacial Surgery, Vol. 3,
1992, pp. 101-107.
[2] J. Park and M. Guthikonda, “The Medpor Sheet as a Sel-
lar Buttress after Endonasal Transsphenoidal Surgery:
Technical Note,” Surgical Neurology, Vol. 61, 2004, pp.
488-492; discussion 493.
[3] T. Wellisz, “Clinical Experience with the Medpor Porous
Polyethylene Implant,” Aesthetic Plastic Surgery, Vol. 17,
1993, pp. 339-344.
[4] T. Wellisz, “Reconstruction of the Burned External Ear
Using a Medpor Porous Polyethylene Pivoting Helix
Framework,” Plastic and Reconstructive Surgery, Vol. 91,
1993, pp. 811-818.
[5] J. J. Romano, N. T. Iliff and P. N. Manson, “Use of Med-
por Porous Polyethylene Implants in 140 patients with
Facial Fractures,” Journal of Craniofacial Surgery, Vol. 4,
1993, pp. 142-147.
[6] J. W. Karesh and S. C. Dresner, “High-Density Porous
Polyethylene (Medpor) as a Successful Anophthalmic
Socket Implant,” Ophthalmology, Vol. 101, 1994, pp.
1688-1695; discussion 1695-1686.
[7] J. F. Wong, C. N. Soparkar and J. R. Patrinely, “Correc-
tion of Lower Eyelid Retraction with High Density Po-
rous Polyethylene: The Medpor((R)) Lower Eyelid
Spacer,” Orbit, Amsterdam, Vol. 20, 2001, pp. 217-225.
[8] T. Romo, 3rd, A. P. Sclafani, P. Sabini, “Use of Porous
High-Density Polyethylene in Revision Rhinoplasty and
in the Platyrrhine Nose,” Aesthetic Plastic Surgery, Vol.
22, 1998, pp. 211-221.
[9] F. Carinci, A. Palmieri, V. Perrotti, A. Piattelli, R. Cenzi,
G. Brunell, M. Martinelli, M. Arlotti and F. Pezzetti, “Ge-
netic Effects of Medpor on Osteoblast-Like Cells,” Jour-
nal of Craniofacial Surgery, Vol. 17, 2006, pp. 1243-
1250.
[10] A. Palmieri, F. Pezzetti, G. Brunelli, M. Martinelli, L.
Scapoli, M. Arlotti, E. Masiero and F. Carinci, “Medpor
Regulates Osteoblast's MicroRNAs,” Bio-Medical Mate-
rials and Engineering, Vol. 18, 2008, pp. 91-97.
[11] K. J. Livak and T. D. Schmittgen, “Analysis of Relative
Gene Expression Data Using Real-Time Quantitative
PCR and the 2(-Delta Delta C(T)) Method,” Methods,
San Diego, Vol. 25, 2001, pp. 402-408.
[12] A. Alhadlaq and J. J. Mao, “Mesenchymal Stem Cells:
Isolation and Therapeutics,” Stem Cells and Development,
Vol. 13, 2004, pp. 436-448.
[13] M. F. Pittenger, A. M. Mackay, S. C. Beck, R. K. Jaiswal,
R. Douglas, J. D. Mosca, M. A. Moorman, D. W. Simon-
etti, S. Craig and D. R. Marshak, “Multilineage Potential
of Adult Human Mesenchymal Stem Cells,” Science,
New York, Vol. 284, 1999, pp. 143-147.
[14] H. J. Jin, S. K. Park, W. Oh, Y. S. Yang, S. W. Kim and S.
J. Choi, “Down-Regulation of CD105 is Associated with
Multi-Lineage Differentiation in Human Umbilical Cord
Copyright © 2010 SciRes. MSA
Medpor® Acts on Stem Cells Derived from Peripheral Blood
Copyright © 2010 SciRes. MSA
18
Blood-Derived Mesenchymal Stem Cells,” Biochemical
and Biophysical Research Communications, Vol. 381,
2009, pp. 676-681.
[15] F. P. Barry, R. E. Boynton, S. Haynesworth, J. M. Mur-
phy and J. Zaia, “The Monoclonal Antibody SH-2, Raised
against Human Mesenchymal Stem Cells, Recognizes an
Epitope on Endoglin (CD105),” Biochemical and Bio-
Physical Research Communications, Vol. 265, 1999, pp.
134-139.
[16] M. Jakob, O. Demarteau, D. Schafer, B. Hintermann, W.
Dick, M. Heberer and I. Martin, “Specific Growth Factors
during the Expansion and Redifferentiation of Adult Hu-
man Articular Chondrocytes Enhance Chondrogenesis
and Cartilaginous Tissue Formation in Vitro,” Journal of
Cellular Biochemistry, Vol. 81, 2001, pp. 368-377.
[17] S. E. Haynesworth, M. A. Baber and A. I. Caplan, “Cell
Surface Antigens on Human Marrow-Derived Mesen-
chymal Cells are Detected by Monoclonal Antibodies,”
Bone, Vol. 13, 1992, pp. 69-80.
[18] E. Aubin, J. B. Lian and G. S. Stein, “Bone Formation:
Maturation and Functional Activities of Osteoblast Line-
age cells,” In: M. J. Favus, Ed., Primer on the Metabolic
Bone Diseases and Disorders on Mineral Metabolism,
The American Society for Bone and Mineral Research,
Washington, D. C., 2003, pp. 13-28.
[19] L. R. McCabe, C. Banerjee, R. Kundu, R. J. Harrison, P.
R. Dobner, J. L. Stein, J. B. Lian and G. S. Stein, “De-
velopmental Expression and Activities of Specific Fos
and Jun Proteins are Functionally Related to Osteoblast
Maturation: Role of Fra-2 and Jun D during differentia-
tion,” Endocrinology, Vol. 137, 1996, pp. 4398-4408.
[20] J. M. Kim, S. U. Lee, Y. S. Kim, Y. K. Min and S. H.
Kim, “Baicalein Stimulates Osteoblast Differentiation via
Coordinating Activation of MAP Kinases and Transcrip-
tion Factors,” Journal of Cellular Biochemistry, Vol. 104,
2008, pp. 1906-1917.
[21] M. D. McKee, M. C. Farach-Carson, W. T. Butler, P. V.
Hauschka and A. Nanci, “Ultrastructural Immunolocali-
zation of Noncollagenous (Osteopontin and Osteocalcin)
and Plasma (Albumin and Alpha 2HS-Glycoprotein) Pro-
teins in Rat Bone,” Journal of Bone and Mineral Re-
search, Vol. 8, 1993, pp. 485-496.
[22] R. A. Dodds, J. R. Connor, I. E. James, E. L. Rykac-
zewski, E. Appelbaum, E. Dul and M. Gowen, “Human
Osteoclasts, not Osteoblasts, Deposit Osteopontin onto
Resorption Surfaces: An in Vitro and ex Vivo Study of
Remodeling Bone,” Journal of Bone and Mineral Re-
search, Vol. 10, 1995, pp. 1666-1680.
[23] C. Ohtsuki, M. Kamitakahara and T. Miyazaki, “Bioac-
tive Ceramic-Based Materials with Designed Reactivity
for Bone Tissue Regeneration,” Journal of the Royal So-
ciety, Interface / the Royal Society, Vol. 6, Supplement 3,
2009, pp. S349-360.
[24] M. Suuriniemi, V. Kovanen, A. Mahonen, M. Alen, Q.
Wang, A. Lyytikainen and S. Cheng, “COL1A1 Sp1
Polymorphism Associates with Bone Density in Early
Puberty,” Bone, Vol. 39, 2006, pp. 591-597.
[25] T. F. Chan, A. Poon, A. Basu, N. R. Addleman, J. Chen,
A. Phong, P. H. Byers, T. E. Klein and P. Y. Kwok,
“Natural Variation in Four Human Collagen Genes across
an Ethnically Diverse Population,” Genomics, Vol. 91,
2008, pp. 307-314.