J. Biomedical Science and Engineering, 2010, 3, 221-225
doi:10.4236/jbise.2010.32030 Published Online February 2010 (http://www.SciRP.org/journal/jbise/
JBiSE
).
Published Online February 2010 in SciRes. http://www.scirp.org/journal/jbise
Restriction fragment length polymorphism in the exon 2 of the
BoLA-DRB3 gene in Chinese Holstein of the south China
Xiu-Xiang Wu, Zhang-Ping Yang*, Xiao-Long Wang, Yong-Jiang Mao, Shu-Chun Li, Xue-Kui Shi,
Ying Chen
Key Lab of Animal Genetics, Breeding Molecular Design, College of Animal Science and Technology Yang Zhou University,
Yang Zhou, Jangsu, China.
Received 30 September 2008; revised 28 November 2009; accepted 30 December 2009.
ABSTRACT
The genetic diversity of the exon2 of BoLA-DRB3
(BoLA-DRB3.2) in Chinese Holstein cattle of the
south China was investigated by hemi-nested poly-
merase chain reaction-restriction fragment length
polymorphism (PCR-RFLP) technique. Six, four and
eleven RFLP patterns were found after digestion with
the restriction enzymes Hae III, Bst YI and Rsa I,
respectively. The DNA sequence showed and twenty-
five DRB3.2 alleles. GLM model analysis indicated
that lactation and calving season have positive corre-
lation with SCC (Somatic Cell Count) (p<0.01),
BoLA-DRB3.2*3, *8, *18 and *26 were associated
with lower SCC (p<0.01). The present findings con-
cluded that mastitis is a severe hinder of milk pro-
duction and technology. Therefore, future re-searches
should focus on associations of mastitis with BoLA
haplotypes rather than single BoLA genes
Keywords: PCR-RFLP; BoLA-DRB3.2; Chinese Hol-
stein; Genetic Polymorphism; SCC
1. INTRODUCTION
Major Histocompatibility Complex (MHC), also called
Bovine Lymphocyte Antigen (BoLA) has received wide
attention because of their association with host immunity.
The BoLA gene is located on the short arm of bovine
chromosome 23 (BTA23) and consists of three class, I, II
and III [1].The class II gene are distributed in two re-
gions, II a and II b, with an approximate recombination
frequency of 17% [2]. The DRA, DRB, DQA, and DQB
genes are located in the II a region, while the DOB,
DYA, DYB and DIB genes in the IIb region. There are at
least three DRB-like genes (DRB1, DRB2 and DBR3) in
the BoLA region, among which only the DRB3 gene is
expressed considerably and is highly polymorphic [1].
A polymerase chain reaction-restriction fragment
length polymorphism (PCR-RFLP) technique developed
by Van Eijk et al. [3] determined alleles in the second
exon of BoLA-DRB3 gene (BoL-DRB3.2). This method
has advantage of using small amounts of genomic DNA
and being adaptable to crude DNA preparations. This
advantage will be magnified in case where the studied
population is relatively large and the process of extract-
ing DNA with conventional phenol-chloroform methods
becomes tedious and labor-intensive. Therefore, PCR-
RFLP is a rapid and useful method for DRB3.2 typing in
cattle families. But for the outbreed populations se-
quencing and hybridization techniques are required.
Recently, many researches on BoLA-DRB3 have been
reported [4,5,6,7].This study describes genetic variabil-
ity in the BoLA-DRB3 and its relationship with SCC
and production performance in Chinese Holstein cow.
This is the first study of the DNA polymorphism of the
BoLA-DRB3 gene in Chinese Holstein cows of the
south China.
2. MATERIALS AND METHODS
2.1. Animals and DNA Extraction
Chinese Holstein (n=629) from Shanghai Brightlight
Dairy Company were used in the current study. Ap-
proximately 5mL of blood was collected from each ani-
mal via the caudal rein. The blood was anticoagulated
with anticoagulant citrate dextrose (ACD) and stored at
-20C.Genomic DNA was extracted from whole blood by
the phenol-chloroform extraction method described by
Sambrook with some modifications. The quality of the
genomic DNA was checked by submarine Agarose gel
electrophoresis, purity and concentration were check by
spectrophotometer DNA samples with good quality, and
purity and concentration were used for further analysis.
2.2. PCR Amplification of BoLA-DRB3.2
Exon 2 of BoLA-DRB3 gene (284bp) was amplified by
semi-nest PCR, described by Miretti et al. [9], to im-
X. X. Wu et al. / J. Biomedical Science and Engineering 3 (2010) 221-225
Copyright © 2010 SciRes.
222
JBiSE
prove the specificity of the PCR product. Primers
HL-030 (5'-ATCCTCTCTCTGCAGCACATTTCC-3'),
HL-031 (5'-TTTAAATTCGCGCTCACCTCGCCGCT-3')
and HL-032 (5'-TCGCCGCTGCACAGTGAAACTCTC
-3'), described by Van Eijk [3], were used in the PCR
reaction. Briefly, the first stage PCR was performed in a
final volume of 20μL containing 50ng of template DNA,
0.5 pm of primer HL-030 and HL-031, 2μL PCR buffer,
1.75mM MgCl2 , 0.25 mM dNTPs, 1.5U Taq DNA Po-
lymerase (Shanghai Sangon). This reaction system was
predenatured at 94C for 4min followed by 12 cycles of
denaturizing (94C for 1min), annealing (60C for 1min)
and elongation (72C for 1min) and a final extension at
72C for5 min. 2μL of the first stage PCR product was
used as template DNA.
For the second stage PCR in a final volume of 40μL
containing 0.5pM of primer HL-030 and HL-032, 4μL
PCR buffer 1.75mM MgCl2, 0.25mM dNTPs, and 2U
Taq DNA polymerase. The solution was predenatured at
94C for 4 min followed by 30 cycles of denaturizing
(94C for 60s), annealing (63C for 45s), and elongation
(72C for 45s) and a final extension (72C for 5min).5μL
of the second stage PCR product was electrophoresed on
1.2% agarose gels to check the quality and specificity of
DNA fragment amplification.
2.3. RFLP
To examine the nucleotide sequence variability at the
BoLA-DRB3.2 locus, three end nucleotide restriction
enzymes (Hae III, Bst YI and Rsa I) were chosen based
on their cut site and ability to cut DNA in this exon. The
second stage PCR products were digested with the re-
striction enzymes according to the manufacture’s in-
structions. A 15μL of the second stage PCR product
containing 8μL, 0.5U of restriction enzymes, and 6.8μL
of 1×Buffer were digested at 37C for 12h followed by
inacting at 80C (Hae III and Bst YI) or 65C (RsaI) for
20min. The resulting DNA fragment were separated on
14% PAGE gels with 1×TBE buffer (0.9M Tris-Base,
0.09M Boric Acid, 2.5mM EDTA) at 150V for 5h, using
Msp I digested pBR322/MspI as a molecular marker.
After ethidium bromide (EB) staining, the gels were
photographed under UV light and the relative migrations
of the DNA bonds were estimated. The restriction pat-
terns obtained were compared with previously described
restriction maps [10].
2.4. DNA Sequencing
BoLA-DRB3.2 DNA sequence was performed base on
the restriction enzyme sites. The sequence was com-
pared with the gene Bank sequences.
http://www.projects.roslin.ac.uk/bola/bolanom.html
2.5. SCC Analysis
SCC is leukocytes that inter the milk from the alveoli
and they are considered an important indicator of mas-
titis infection. The SCC of the experimental cows was
detected every month. In order to express the effect of
calving season on SCC, the data are divided into four
parts according to calving season.
2.6. Statistic Analyses
GLM (General Linear Model) of SCC and production
performance was performed by SAS6.12 (SAS Institute,
1996), the models are as follows:
YijkmµLiSjblBoLAijkleijkm
Yijkm: SCC, Milk Yield, Fat Percent Protein percent
µ: the average value, Li: lactation number, i=14, Sj:
calv-ing season=14, bl: regression coefficient of allele
to SCC, l= 122, BoLAijkl: the copy number of BoLA
al-lele l in individual ijk, the value is 0, 1 and 2, eijkm:
random error.
3. RESULTS
3.1. DRB 3.2 Amplification
DNA bands of the expected size containing 267 bp of
exon 2, 3 bp of the 3’ intron and 14bp of the 5’intron,
were received by semi-nested PCR amplification (Fig-
ure 1). The specificity of the PCR product was very high,
but some nonspecific bands were observed. Although
these bands could not be eliminated by modifying PCR
conditions, this did not affect the resolution of restriction
patterns.
Figure 1. Patterns of the semi-nested PCR.
Figure 2. Genotypes of BoLA-DRB3.2 locus digested
with Hae III.
X. X. Wu et al. / J. Biomedical Science and Engineering 3 (2010) 221-225
Copyright © 2010 SciRes.
223
The DNA sequence was 284 bp, containing 267 bp of
exon 2, 3 bp of the 3’ intron and 14bp of the 5’intron.
3.2. Identification of Restriction Patterns
The 284 bp fragment of the BoLA-DRB3.2 gene in this
study were digested with Rsa I, Hae III and Bst YI re-
spectively. Six restriction patterns were identified with
Hae III (See Table 1 and Figure 2). Bst YI resulted in
four RFLP patterns a,b,d and e (See Table 1 and Figure
3). RsaI restriction patterns were so complex that eleven
patterns were revealed in this study (See Table 2 and
Figure 2).
Figure 3. Genotypes of BoLA-DRB3.2 locus digested with
Bst YI.
3.3. DNA Sequencing and Standard Naming
Combining restriction patterns with Rsa I, Bst YI and
Hae III in the whole sample, 22 DRB3.2 alleles found in
the study were sequenced (See Table 2 and Table 3).
Many mutants were indicated in the cut sites of restric-
tion enzymes by DNA sequencing. The frequency of
BoLA-DRB3.2 ranged from 0.003 (2*34) to 0.220
(2*22).
Figure 4. Genotypes of BoLA-DRB3.2 locus digested with
Rsa I.
Table 1. Fragment Size and Frequencies of Restriction Patterns Digested with Enzymes.
Enzyme Restriction
Patterns
Fragment
Size(bp) Frequency Enzyme Restriction
Patterns
Fragment
Size(bp) Frequency
Hae III
a
b
d
e
f
h
167/65/52
219/65
190/65/29
167/117
167/65/48/4
167/65/46/6
0.598
0.238
0.049
0.037
0.061
0.017
Bst YI
a
b
d
e
199/85
284
197/87
112/87/85
0.095
0.823
0.012
0.070
Rsa I
b
d
f
g
h
i
j
l
m
n
o
111/54/50/39/30
143/111/30
141/54/50/39
141/104/39
111/69/54/50
180/54/50
93/78/63/50
234/50
111/104/69
180/104
284
0.061
0.024
0.085
0.082
0.082
0.006
0.052
0.113
0.241
0.195
0.058
Table 2. Allele Frequencies of BoLA-DRB3.2 identified by PCR-RFLP analysis.
DRB3.2 Patterns DRB3.2 Patterns
Allelle Rsa I Bst YI Hae III
Alleles Num Frequency
Allelle Rsa IBst YIHae III
Alleles Num Frequency
*3 b b b 41 0.0652 *18 l b f 26 0.0413
*6 d a a 17 0.0270 *21 l b e 23 0.0366
*8 f a a 5 0.0079 *22 m b a 148 0.2353
*9 f d a 8 0.0127 *23 n b a 64 0.1017
*10 f b a 35 0.0556 *24 n b b 58 0.0922
*11 g e a 55 0.0874 *26 o a b 5 0.0079
*12 h a a 13 0.0207 *28 o b b 29 0.0461
*13 h b a 28 0.0445 *32 m a a 13 0.0207
*14 h b b 14 0.0223 *33 n b f 19 0.0302
*15 i b a 5 0.0079 *36 l b a 9 0.0143
*16 j b d 3 0.0048 *42 f a h 11 0.0175
JBiSE
X. X. Wu et al. / J. Biomedical Science and Engineering 3 (2010) 221-225
Copyright © 2010 SciRes.
224
JBiSE
Table 3. The sequences of BoLA-DRB3.2 alleles indicated in the paper.
1 95
*3
ATCCTCTCTCTGCAGCACATTTCCTGGAGTATTCTAAGAGCGAGTGTCATTTCTTCAACGGGACCGAGCGGGTGCGGTTCCTGGACAGATACTTC
*6 --------------------------C-----CA----G-----------------------------------G---------C-----
*8 --------------------------------A-C----AA-----CT----------------------------------------C-
*9 ---------------------------------G----------------------------------------------G----C----
*10 -------------------------------A-C----AA-------------------------------------------------
*11 -------------------------------------------------------------------------------G----C----
*12 --------------------------------GC-C-----------------------------------------C-----------
*13 -----------------------------------C-----------------------------------------------------
*14 -----------------------------------------------------------------------------------------
*15 --------------------------------G------A---------------------------------G---------------
*16 -----------------------------------C------------------------------------A----------------
*18 -------------------------------G---C-----------------------------------------C-----------
*21 -------------------------------G---C-----------------------------------------------------
*22 -------------------------C-----CA----G-----------------------------------G---------C-----
*23 --------------------------------A------A-----------------------------A--------------G--A-
*24 ---------------------------------------------------------------------------------------A-
*26 --------------------------------G------A---------------------------------G----------G----
*28 --------------------------------G------A--------------------------------------------G----
*32 --------------------------------G------A-------------------------------------------------
*33 --------------------------------A------A--------------------------------------------G----
*36 --------------------------------G------A---------------------------------G---------------
*42 -------------------------------A-C----AA-------------------------------------A-----------
96 190
*3
CATAATGGAGAAGAGTACGTGCGCTTCGACAGCGACTGGGGCGAGTACCGGGCGGTGACCGAGCTGGGGCAGCGGGTCGCCGAGTACTGCAACAG
*6 T-----------------------------------------------------------------G--C-TC-------C----G-----
*8 ----------------T------------T-------------------------------A----G--C--A----A-------G-----
*9 T---------------T--------------------------------------------A----G--C--A----A-------G-----
*10---------------T------------T--------------------------------A----G--C--A----A-------G-----
*11 --------------A---------------------------------------------A----G--C--A------------G-----
*12 ---------------------------------------------T-------------------------A------------G-----
*13 ---------------------------------------------T--A----------------G--C--A----A-------G-----
*14 ---------------------------------------------T-------------------G--A--A----A-------G-----
*15 --------------CG-----------------------------T-------------------G--C--A------------G-----
*16 --------------------------------------------------------A----G-------------C-G-TG---G-
*18 ---------------T---------------------T-----------------------G--C--C-------C-G--G-----
*21 --------------CT---------------------T-----------------------G--C-TC-----T-C---TG-----
*22 ------------------------------A------T-----------------------G--C-TC------------G-----
*23 C-------------AC---------------------T------------------A----G--C--A------------G-----
*24 C-------------AC---------------------T-----------------------G--A--A------------G-----
*26 ---------------T---------------------T-----------------------G-------------C---TG-----
*28 ---------------T---------------------T------------------A----G-------------C-G--G-----
*32 -------------------------------------T------------------A----G--C--A------------G-----
*33 ---------------T---------------------T------------------A----G--C--C------------G-----
*36 --------------CG---------------------T-----------------------G--C-TC-------C-G--G-----
*42 ---------------T----------------------------------------A----G--C--A------------G-----
191 284
*3
CCAGAAGGACTTCCTGGAGCGGGCGCGGGCCGCGGTGGACACGTACTGCAGACACAACTACGGGGTCGGTGAGAGTTTCACTGTGCAGCGGCGA
*6 ---------GA-----------AG--------A--------G-GTG ---------------------------------------
*8 ------------------GA-AA---------------------------------------------------------------
*9 -----------G-------A-AA-------AAT-----------------------------------------------------
*10 -------------------GA-AA--------------------------------------------------------------
*11 ---------GA--------GA-AG--------A--------G-GTG----------------------------------------
*12 ---------GA------------A-------TAT----------------------------------------------------
*13 ----------A------------A------------------------------------TG------------------------
*14 ----------A------------A--------A---------------------------TG------------------------
*15 --------------------A-AG--------------------------------------------------------------
*16 ----------AC-----------A-------TAT--------------------------TT------------------------
*18 ----------AC-----------A-------TAT--------------------------TG------------------------
*21 -------------------GAC-A------TT----------------------------TT------------------------
*22 ----------------------AG--------A----------GTG--------------TG------------------------
*23 -------------------GA-AG--------A--------G-GTG----------------------------------------
*24 -------------------GA-AA--------A--------G-GTG-------------TATG-----------------------
*26 ---------GA-----------AA--------A----------GTG-------------T--------------------------
*28 -------------------GA-AG--------A--------G-GTG--------------TG------------------------
*32 ---------GA--------GA-AG--------A--------G-GTG----------------------------------------
*33 -------------------GA-AG--------A--------G-GTG----------------------------------------
*36 ----------A---------A-AG--------A--------G--------------------------------------------
*42 ---------GA------------GC-----------------------------------TG------------------------
Table 4. The correlation between BoLA-DRB3.2 alleles, lactation, seasons of calving and SCC and performance traits in Chinese
Holstein.
Factor SCC Factor SCC
µ +580.61 µ +580.61
BoLA-DRB3.2*3 -336.95** BoLA-DRB3.2*21 -503.95*
BoLA-DRB3.2*6 NS BoLA-DRB3.2*22 -413.38*
BoLA-DRB3.2*8 -623.01** BoLA-DRB3.2*23 -345.89
BoLA-DRB3.2*9 NS BoLA-DRB3.2*24 NS
BoLA-DRB3.2*10 NS BoLA-DRB3.2*26 -878.14**
BoLA-DRB3.2*11 -341.62 BoLA-DRB3.2*28 -386.66
BoLA-DRB3.2*12 NS BoLA-DRB3.2*32 NS
BoLA-DRB3.2*13 NS BoLA-DRB3.2*33 NS
BoLA-DRB3.2*14 NS BoLA-DRB3.2*36 -395.54
BoLA-DRB3.2*15 NS BoLA-DRB3.2*42 NS
BoLA-DRB3.2*16 -353.07 Lactation +195.19**
BoLA-DRB3.2*18 -511.33** Calving Season +49.91**
Note:*means significant difference, P<0.05; **means significant difference, P<0.01; NS means no significant difference. The values means regression
coefficient, +means positive correlation, -means negative correlation.
3.4. Effect of BoLA-DRB3.2, Lactation and
Caving Season on SCC
The effect of BoLA-DRB3.2, lactation and caving sea-
son on SCC and production performance are displayed
in Table 4 Lactation and calving season have positive
correlation with SCC (p<0.01), most alleles of BoLA-
DRB3.2 have negative correlation with SCC, among
them, BoLA-DRB3.2*3, *8, *18 and *26 are the most
associated with SCC (p<0.01).
4. DISCUSSION
Taking an important role in the immune system of ani-
mals and having a close relationship with resistance to
diseases, MHC has become a candidate gene and a hot
point of recent researches. It is widely said that the high
polymorphism of MHC-DRB3 genes was decided by its
important function made by class II antigen of MHC in
the immune system. In order to adapt to various geo-
graphic and climatic conditions, the immune system is
highly polymorphic. So the polymorphism of BoLA-
DRB3 gene, encoding the main functional area of MHC
antigen, is very high.
Miretti et al. [9] identified the polymorphism of
BoLA-DRB3 gene in Argentinean Holstain using PCR-
RFLP. Four patterns a, b, d and e were found with Hae
III, three (a, b and d) and eleven patterns (b, c, d, f, g, h,
I, j, l, m, n and o) were found with Bst YI and RsaI, re-
spectively. In this research, Hae III f, h and BstYI d were
detected.
X. X. Wu et al. / J. Biomedical Science and Engineering 3 (2010) 221-225
Copyright © 2010 SciRes.
225
JBiSE
The most frequent (frequency0.05) BoLA-DRB3.2
alleles of 835 Holstein dairy cattle re-ported by Sharif et
al. [11] were BoLA-DRB3.2*3(0.0652), *8(0.0079),
*11(0.0874), *16(0.0048), *22(0.2353), *23(0.1017),
*24(0.0922). In the present study, the most frequent al-
leles were BoLA-DRB3.2*3(0.0652), **11(0.0874),
*16(0.0048), *22(0.2353), *23(0.1017), *24(0.0922).
Sharif et al reported that BoLA-DRB3.2 *8 was the most
common allele type in Holstein, However, in this study,
the BoLA-DRB3.2 *16 was at low frequency (0.0048),
while the BoLA-DRB3 *22 was the most common al-
lele (0.2353). Therefore, BoLA polymorphism infor-
mation from the research herd seemed representative of
the regional Holstein population. These differences may
be largely due to the long-term adaptation to different
geographical and climatic conditions. Therefore, BoLA
polymorphism information from the research herd
seemed representative of the regional Holstein popula-
tion. These differences may be largely due to the long-
term conditions.
Many mutants, changing the restriction site and the
restriction maps, were identified in the cut sites by DNA
sequencing. RFLP, as a method to identify the polymor-
phism of BoLA-DRB3, can only define the position of
mutants. Other methods must be used to find the detail
mutants. Result of our study demonstrated that the
BoLA-DRB3.2 locus is highly polymorphic in Chinese
Holstein. PCR-RFLP may therefore be a rapid and useful
method for DRB3 typing and studying the evolutionary
changes in dairy cattle.
Sharif reported calving season had no significant ef-
fect on SCC, but this research indicated that calving
season significantly affect SCC; there was a trend that
cows calving in spring and summer have high SCC. Re-
lated to BoLA-DRB3.2 and SCC, the result in this re-
search is different from Sharif et al. [11], among the
most frequently detected alleles, BoLA-DRB3.2*3 has
significant correlation to low SCC, BoLA-DRB3.2*8, 18
and 26 maybe have same function, but their frequencies
are very low.
Contradictory results from different studies invest-
tigating associations between BoLA-DRB3.2 alleles and
mastitis indicate that future studies should focus on as-
sociations of mastitis with BoLA heliotypes rather than
with single BoLA genes.
5. ACKNOWLEDGEMENTS
This The authors appreciate the assistance of the Shanghai Brightlight
Dairy Company. This work was supported by 863 high-tech projects
“The Breeding technology of Multi-locus Combination of Chinese
Holstein” (2008AA10Z144), Natural Science Foundation of Jiangsu
Province, College of major projects (09KJA230002), land 863 Na
tional key project (2008AA101010).
REFERENCES
[1] Andersson, L. and Davies, C.J. (1994) The major histo-
compatibility complex. Cell-Mediated Immunity in
Ruminants, CRC, 37-57.
[2] Davies, C.J., Joosten, I., Andersson, L., Arriens, M.A.,
Bernoco, D., Bissumbhar, B., Byrns, G., van Eijk, M.J.,
Kristensen, B. and Lewin, H.A. (1994) Polymorphism of
Bovine MHC Class II genes. Joint Report of the Fifth
International Bovine Lymphocyte Antigen (BoLA)
Workshop. European Journal of Immunogenetics, 21(4),
259-289.
[3] Van Eijk, M.J., Stewart-Haynes, J.A. and Lewin, H.A.
(1992) Extensive polymorphism of the BoLA-DRB3
gene distinguished by PCR-RFLP. Animal Genetics, 23,
483-496.
[4] Do Nascimento, C.S., Machado, M.A., Martinez, M.L.,
da Silva, M.G.B., Martins Guimares, M.F., Campos, A.L.,
Sousa Azevedo, A.L., Teodoro, R.L., Silva erneque, R.
and Facioni Guimare, S.E. (2006) Association of the
Bovine major histocompatibility complex (BoLA)
BoLA-DRB3 gene with fat and protein production and
somatic cell score in Brazilian gyr dairy cattle (Bos
indicus). Genetics & Molecular Biology, 29(4), 641-647.
[5] Nassiry, M.R., Shahroodi, F.E., Mosafer, J.A.,
Mohammadi, A., Manshad, E., Ghazanfari, S.,
Mohammad Abadi, M.R. and Sulimova, G.E. (2005)
Analysis and frequency of Bovine lymphocyte antigen
(BoLA-DRB3) alleles in Iranian Holstein cattle. Russian
Journal of Genetics, 41(6), 664-668.
[6] Rupp, R., Hernandez, A., Mallard, B.A. (2007) Associ-
ation of Bovine leukocyte antigen (BoLA) DRB3.2 with
immune response, mastitis, and production and type
traitsin Canadian Holsteins. Journal of Dairy Science, 90,
1029-1038.
[7] Duangjinda, M., Buayai, D., Pattarajinda, V., Phasuk, Y.,
Katawatin, S., Vongpralub T. and Chaiyotvittayakul, A.
(2009) Detection of Bovine leukocyte antigen DRB3
alleles as Candidate markers for clinical mastitis re-
sistance in Holstein x zebu. Journal of Animal Science,
87, 469-476.
[8] Jeseph, S. and Rusell, D.W. (2001) Molecular cloning: A
laboratory manual. Cold Spring Habor Laboratory Press.
[9] Miretti, M.M., Ferro, J.A., Lara, M.A. and Conte, E.P.B.
(2001) Restriction fragment length polymorphism (RFLP)
in Exon 2 of the BoLA-DRB3 gene in South American
cattle. Bio Gene, 39(9-10), 311-324.
[10] Maillard, J., Renard, C., Chardon, P., Chantal, I. and
Bensaid, A. (1999) Characterization of 18 new
BoLA-DRB3 alleles. Animal Genetics, 30, 200-203.
[11] Sharif, S., Mallard, B.A., Wilkie, B.N., Sargeant, J.M.,
Scott, H.M., Dekkers, J.C.M. and Leslie, K.E. (1998)
Association of the Bovine major histocompatibility
complex DRB3 (BoLA-DRB3) alleles with occurrence
of disease and milk somatic cell score in Canadian dairy
cattle. Animal Genetics, 29, 185-193.